Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “temperate”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 505 records · Page 28Linked to original sources
PubMed1996

Sequence analysis and molecular characterization of the temperate lactococcal bacteriophage r1t.

The temperate lactococcal bacteriophage r1t was isolated from its lysogenic host and its genome was subjected to nucleotide sequence analysis. The linear r1t genome is composed of 33,350 bp and was shown to possess 3' staggered cohesive ends. Fifty open reading frames (ORFs) were identified which are, probably, organized in a life-cycle-specific manner. Nucleotide sequence comparisons, N-terminal amino acid sequencing and functional analyses enabled the assignment of possible functions to a number of DNA sequences and ORFs. In this way, ORFs specifying regulatory proteins, proteins involved in DNA replication, structural proteins, a holin, a lysin, an integrase, and a dUTPase were putatively identified. One ORF seems to be contained within a self-splicing group I intron. In addition, the bacteriophage att site required for site-specific integration into the host chromosome was determined.

Amino Acid Sequence↗
PubMed2006

Functional coordination between leaf gas exchange and vulnerability to xylem cavitation in temperate forest trees.

We examined functional coordination among stem and root vulnerability to xylem cavitation, plant water transport characteristics and leaf traits in 14 co-occurring temperate tree species. Relationships were evaluated using both traditional cross-species correlations and phylogenetically independent contrast (PIC) correlations. For stems, the xylem tension at which 50% of hydraulic conductivity was lost (psi50) was positively associated (P < 0.001) with specific conductivity (K(S)) and with mean hydraulically weighted xylem conduit diameter (D(h-w)), but was only marginally (P = 0.06) associated with leaf specific conductivity (K(L)). The PIC correlation for each of these relationships, however, was not statistically significant. There was also no relationship between root psi50 and root K(S) in either cross-species or PIC analysis. Photosynthetic rate (A) and stomatal conductance (g(s)) were strongly and positively correlated with root psi50 in the cross-species analysis (P < 0.001), a relationship that was robust to phylogenetic correction (P < 0.01). A and g(s) were also positively correlated with stem psi50 in the cross-species analysis (P = 0.02 and 0.10, respectively). However, only A was associated with stem psi50 in the PIC analysis (P = 0.04). Although the relationship between vulnerability to cavitation and xylem conductivity traits within specific organs (i.e. stems and roots) was weak, the strong correlation between g(s) and root psi50 across species suggests that there is a trade-off between vulnerability to cavitation and water transport capacity at the whole-plant level. Our results were therefore consistent with the expectation of coordination between vulnerability to xylem cavitation and the regulation of stomatal conductance, and highlight the potential physiological and evolutionary significance of root hydraulic properties in controlling interspecific variation in leaf function.

Biological Transport↗
PubMed1992

The overwintering of Fasciola hepatica eggs under semi-arid and temperate Mediterranean climate (Madrid, Spain).

In this experimental work, conducted over two consecutive years (1988 and 1989), we have analyzed the overwintering possibilities of Fasciola hepatica eggs deposited in winter in a semi-arid and temperate Mediterranean area (Madrid, Spain). Eggs did not survive for more than a week in faeces at environmental moisture conditions. In contrast, over a 75% of the eggs maintained in permanently wet faeces survived winter temperatures, showing no high mortality until important thermic increment from June. The success of overwintering was higher in eggs arrested in wet faeces than included in water (55% "versus" 20% of hatching in spring), and it was unrelated to the deposition time (excretion in early or late winter). The hatching period of overwintered eggs started in May, at the same time as those excreted in early spring. Therefore, overwintering of eggs will have an effect on the level but not on the start of the spring contamination with miracidia. The dry winters of this semi-arid area greatly restrict the overwintering eggs contamination to soils next to streams, ponds or irrigation channels.

Animals↗
PubMed1995

Seasonal availability of Fasciola hepatica metacercariae in a temperate Mediterranean area (Madrid, Spain).

In this experiment, conducted over a 3-year period (1988-1990), the seasonal availability of Fasciola hepatica metacercariae in a temperate Mediterranean area (Madrid, central Spain) was analysed according to the rhythms of snail infection, the periods of cercarial emission, and the resistance of metacercariae. In this area, snails could be infected from late April to early November. Cercarial emission by spring infection started at the beginning of summer and terminated 3-4 weeks later. Mid-summer temperatures led to the extinction of shedding populations and of the metacercariae emitted by them, but were well tolerated by the snails with undeveloped infections. No aestivation was observed and summer infection led to a progressive shedding wave from August to late December, when it was interrupted. These populations became extinguished in the colder winter of 1988, but overwintered in the mild and belated winter of 1989. Only the snails infected from late summer onwards resumed activity and shed cercariae in spring, from the second half of March to late June. Risk of infection for grazing animals during winter will depend on survival of metacercariae. With a mean mortality of 23% during December and January, and of 38% during the following 2 months, no more than 30% of metacercariae reach the spring alive. Accordingly, risk of infection for grazing animals in spring will depend on overwintering infection of snails. These results indicate that temperature more than humidity could be responsible for different transmission patterns from year to year as winter thermic profiles could be the key for the transmission of fasciolosis during spring.

Animals↗
PubMed2006

Dynamics of infestation of cattle and pasture by gastrointestinal nematodes in an Atlantic temperate environment.

The objective of the present study was to determine the dynamics of infestation of cattle and pasture by gastrointestinal nematodes in a mild humid environment in northwestern Spain. For this, infestation of pasture by free-living stages (L3), dynamics of faecal egg output, blood pepsinogen levels and worm burden in slaughtered animals were quantified. The results showed a high degree of annual variability, which was dependent on weather conditions. The seasons were clearly defined in the study area, with mild humid winters and relatively dry summers registered throughout the years of the study. Infestation of pasture by larvae varied from year to year, peaking during August in the first year, between August and December in the second year, and during October in the third year. The annual variation was mainly due to weather conditions, particularly the amount of rain in summer. The patterns of faecal egg output were similar in the first and third grazing seasons, with maximum levels observed in May/June; however, in the second year, the peak was reached in October. Blood pepsinogen levels increased from pasture turnout (March/April) until the end of the grazing season (November/December), reaching maximum values from August/September onwards. The nematode parasite species identified at necropsy were Ostertagia osteragi, O. lyrata, Cooperia oncophora, C. macmasteri, C. punctata and Trichuris ovis, with O. ostertagi and C. oncophora predominating. In faecal cultures, the following genera were also identified: Haemonchus, Trichostrongylus, Nematodirus, Bunostomum, Oesophagostomum and Strongyloides. There was a significant correlation (r=0.97, P<0.01) between worm burden (Ostertagia spp.) and pasture infestation (Ostertagia L3) 3 weeks prior to slaughter of the calves, and also between blood pepsinogen levels and pasture infestation by Ostertagia L3 (r=0.33, P<0.02). Correlations between worm burden and faecal egg output and between blood pepsinogen level and faecal egg output were not significant. The results obtained in the present study confirm that there is annual variability in the time-course of nematodosis in cattle, and demonstrate the importance of weather, particularly summer rainfall, in an Atlantic temperate environment.

Animals↗
PubMedDate not supplied

Aquatic fungi parasitic on temperate fishes of Kumaun Himalaya, India.

Eighty isolates of different species of aquatic fungi belonging to Achlya, Aphanomyces, Dictyuchus, Protoachlya, Saprolegnia, Thraustotheca and Pythium are observed as parasites of certain temperate fish of Kumaun Himalaya, India. The parasitic ability of each isolate was confirmed by artificial inoculation experiments under laboratory conditions. The genera of Saprolegnia and Achlya were more virulent fish parasites than Aphanomyces, Dictyuchus, Protoachlya, Thraustotheca and Pythium. All the fish species observed are new hosts for these pathogens. Protoachlya paradoxa, Achlya klebsiana, Thraustotheca clavata and Pythium undulatum are reported for the first time as natural pathogens of fish.

Animals↗
PubMed2005

Respiratory illness during winter: a cohort study of urban children from temperate Australia.

OBJECTIVE: To examine the epidemiology and burden of respiratory illness during winter in urban children from temperate Australia. METHODS: We conducted a cohort study of healthy Melbourne children, aged from 12 to 71 months. Parents kept a daily respiratory symptom diary and recorded resource use when an influenza-like illness (ILI) occurred. RESULTS: One-hundred and eighteen children had 137 ILI episodes over 12 weeks for a rate of 0.53 ILI episodes per child-month (95% CI 0.44-0.61). Risk factors for ILI included younger age, fewer people residing in the household, structured exposure to other children outside the home, and a higher household income. Episodes had a mean duration of 10.4 days with 64 visits to a general practitioner (46.7 GP visits per 100 episodes), 27 antibiotic courses prescribed (19.7 antibiotic courses per 100 episodes), and three overnight hospitalizations (2.2 admissions per 100 episodes). Parents reported an average of 11.7 h excess time spent caring for a child per episode. CONCLUSIONS: Respiratory illnesses are a common and largely neglected cause of illness in Australian children. Pathogen-specific data are required to better assess the likely impact of available and developing vaccines and other treatment options.

Anti-Bacterial Agents↗
PubMed2006

Recovery of temperate Desulfovibrio vulgaris bacteriophage using a novel host strain.

A novel sulfate-reducing bacterium (strain DePue) closely related to Desulfovibrio vulgaris ssp. vulgaris strain Hildenborough was isolated from the sediment of a heavy-metal impacted lake using established techniques. Although few physiological differences between strains DePue and Hildenborough were observed, pulse-field gel electrophoresis (PFGE) revealed a significant genome reduction in strain DePue. Comparative whole-genome microarray and polymerase chain reaction analyses demonstrated that the absence of genes annotated in the Hildenborough genome as phage or phage-related contributed to the significant genome reduction in strain DePue. Two morphotypically distinct temperate bacteriophage from strain Hildenborough were recovered using strain DePue as a host for plaque isolation.

Bacteriophages↗
PubMed2006

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome.

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

Chromosomes, Bacterial↗
PubMed2005

Winter photosynthesis by saplings of evergreen broad-leaved trees in a deciduous temperate forest.

* Here we investigated photosynthetic traits of evergreen species under a deciduous canopy in a temperate forest and revealed the importance of CO2 assimilation during winter for annual CO2 assimilation. * Saplings were shaded by the canopy trees from spring through to autumn, but were less shaded during the winter months. Photosynthetic rates at light saturation (Aarea) were lower during winter than during the growing season. Aarea was higher in Camellia, Ilex and Photinia than in Castanopsis, Cleyera and Quercus during the winter, but differed little during summer and autumn. * Estimated daily CO2 assimilation (Aday) was higher during the winter than during the growing season in Camellia, Ilex and Photinia but was higher than that during the growing season only at the beginning and end of winter in Castanopsis, Cleyera and Quercus. Aday was higher in Camellia, Ilex and Photinia than in Castanopsis, Cleyera and Quercus but differed little among them during the growing season. * These results reveal the importance of winter CO2 assimilation for the growth of Camellia, Ilex and Photinia. Furthermore, differences in annual CO2 assimilation among species are strongly modified by species-specific photosynthetic traits during the winter under deciduous canopy trees.

Carbon Dioxide↗
PubMed2006

Shoot life span in relation to successional status in deciduous broad-leaved tree species in a temperate forest.

In trees, leaf life span is closely related to successional status. Although leaves are attached to shoots, shoot life span has been insufficiently studied in the context of ecological systems. Interspecific variation in shoot survivorship was investigated over 27 months in 15 temperate hardwood tree species. Relationships between shoot architecture and shoot survival were also investigated. Shoot life span was shortest in early successional species, and longest in late successional species, in each of the families Betulaceae and Fagaceae. In Salicaceae, all of which were early successional species, shoot life span was longer in mountainous than in riparian species. Early successional or riparian species distributed longer shoots densely, even in proximal positions on mother shoots, resulting in mutual shading and consequent early and massive shoot shedding. By contrast, late successional or mountainous species concentrated shoots in distal positions, allowing shoots to receive equally favorable light, resulting in a longer life span. These results reveal close relationships between shoot life span and environmental resource availability or successional status and suggest a causal relationship between shoot shedding and shoot architecture.

Betulaceae↗
PubMed2006

Conservation benefits of temperate marine protected areas: variation among fish species.

Marine protected areas, and other fishery management systems that impart partial or total protection from fishing, are increasingly advocated as an essential management tool to ensure the sustainable use of marine resources. Beneficial effects for fish species are well documented for tropical and reef systems, but the effects of marine protected areas remain largely untested in temperate waters. We compared trends in sport-fishing catches of nine fish species in an area influenced by a large (500-km2) towed-fishing-gear restriction zone and in adjacent areas under conventional fishery management controls. Over the period 1973-2002 the mean reported weight of above-average-sized (trophy) fish of species with early age at maturity and limited home range was greatest within the area influenced by the fishing-gear restriction zone. The reported weight of trophy fish of species that mature early also declined less and more slowly over time within the area influenced by the fishing-gear restriction zone. Importantly, the mean reported weight of trophy fish of species that mature late and those that undertake extensive spatial movements declined at the same rate in all areas. Hence these species are likely to require protected areas > 500 km2 for effective protection. Our results also indicated that fish species with a localized distribution or high site fidelity may require additional protection from sport fishing to prevent declines in the number or size of fish within the local population.

Animals↗
PubMed2006

Differences in structure and dynamics of Polynucleobacter communities in a temperate and a subtropical lake, revealed at three phylogenetic levels.

The results of ecological studies investigating bacteria by cultivation-independent methods are expected to be influenced by the phylogenetic resolution of the applied molecular tools. This potential influence was investigated in a comparative community study on Polynucleobacter cluster bacteria (Betaproteobacteria) inhabiting the pelagic of the large, shallow, partially hypertrophic Taihu Lake located in subtropical East Asia, and the deep oligo-mesotrophic Lake Mondsee located in temperate Central Europe. The two contrasting habitats were sampled over the same period of 12 months. The community dynamics were investigated at three phylogenetic levels by fluorescent in situ hybridizations with a set of nested probes specific for the beta II clade (including the Polynucleobacter cluster), the genus-like monophyletic Polynucleobacter cluster, and four species-like subclusters. Subcluster B was the numerically dominating subcluster in both lakes over the investigation periods, but demonstrated different population dynamics in the two habitats. Interhabitat comparisons of the Polynucleobacter community structure in the two lakes in the study, and a previously investigated acidic pond indicated ecological diversification within the phylogenetically narrow Polynucleobacter cluster. These results could be obtained by help of the subcluster-specific probes, but would have been missed with probes of a lower phylogenetic resolution.

Austria↗
PubMed1995

Characterization of phage phi O139, a Vibrio cholerae O139 temperate bacteriophage with cohesive DNA termini.

A temperate bacteriophage isolated from Vibrio cholerae O139, the new epidemic strain of cholera, was found to have a polyhedral head 65 nm in diameter and a rigid contractile tail 120 nm in length. The phage chromosome was a double-stranded DNA of 35 kb, with unique cohesive ends and had a G + C content of 58.8%. A restriction map of the phage DNA was constructed using the restriction endonucleases AvaI and BstEII. The phage, whose presence could be detected in nine out of 13 V. cholerae O139 isolates tested, was found to have identical chromosomal integration sites in all the strains. The phage attachment site (attP) was found to be located very close to one end of the genome.

Bacteriophages↗
PubMed1995

A new root-nodulating symbiont of the tropical legume Sesbania, Rhizobium sp. SIN-1, is closely related to R. galegae, a species that nodulates temperate legumes.

Rhizobium sp. SIN-1, isolated in India from root nodules on the tropical legume Sesbania aculeata, also induces nitrogen-fixing nodules on roots of S. macrocarpa, S. speciosa, S. procumbens, S. punicea, S. rostrata, and Vigna unguiculata. Unlike Azorhizobium caulinodans, SIN-1 does not induce stem nodules on S. rostrata. The nodules induced by SIN-1 develop exclusively at the bases of secondary roots. Electron microscopic studies of mature nodule sections revealed rhizobia within intercellular spaces, indicating a 'crack entry' mechanism of root infection. SIN-1 is a fast-growing, acid-producing, salt-tolerant Rhizobium that utilizes a wide variety of carbon sources. The nodulation (nod) genes of this strain are located on a 300-MDa symbiosis (sym) plasmid. Fatty acid profile and sequence comparison of a 260-bp conserved region of the 16S rRNA gene demonstrated that SIN-1 is phylogenetically closely related to R. galegae, a species that nodulates temperate legumes.

Base Sequence↗
PubMed2006

Diversity of temperate bacteriophages induced in bovine and ovine Mannheimia haemolytica isolates and identification of a new P2-like phage.

The diversity of temperate bacteriophages was examined in 32 Mannheimia haemolytica, six Mannheimia glucosida and four Pasteurella trehalosi isolates. Phage particles were induced and identified by electron microscopy in 24 (75%) M. haemolytica isolates, but in only one (17%) M. glucosida and one (25%) P. trehalosi isolate. The M. haemolytica phages were relatively diverse as seven Siphoviridae, 15 Myoviridae and two Podoviridae-like phages were identified; the Myoviridae-type phages also exhibited structural variation of their tails. The bacteriophages induced in M. glucosida and P. trehalosi were of the Myoviridae type. Restriction endonuclease (RE) analysis identified nine distinct RE types among the M. haemolytica bacteriophages, providing further evidence of their relative diversity. A limited number of phages caused plaques on indicator strains and the phages exhibited a narrow host range. A subgroup of 11 bovine serotype A1 and A6 isolates contained Myoviridae-type phages of the same RE type (type A), but these differed in their abilities to infect and form plaques on the same panel of indicator strains. A P2-like phage (phiPHL213.1), representative of the RE type A phages, was identified from the incomplete M. haemolytica genome sequence. The phiPHL213.1 genome contains previously unidentified genes and represents a new member of the P2 phage family.

Animals↗
PubMed1987

Observations on equine strongyle control in southern temperate USA.

A program of rotational anthelmintic treatments at eight-week intervals had failed to provide satisfactory equine strongyle control at a stable in southern USA. Anthelmintic resistance had rendered benzimidazoles ineffective, and intervals between treatments with other drugs were too great to prevent environmental contamination with ova. Ivermectin treatments at eight week intervals or pyrantel pamoate treatments at four week intervals successfully reduced egg counts for the majority of the summer grazing period. In southern temperate USA, translation of strongyle ova to larvae was most efficient during autumn and winter. Minimal larval translation occurred during summer when meteorological conditions limited pasture infectivity as effectively as anthelmintic treatments.

Animals↗
PubMed1996

Sensitization of bacteria to danofloxacin by temperate prophages.

Danofloxacin (CP-76,136) is in a class of agents that inhibit DNA gyrase and trigger induction of the SOS response and temperate bacteriophages. Killing studies against the bovine pathogen Pasteurella haemolytica demonstrated that danofloxacin exhibits particularly rapid killing kinetics. Here, lysogenic Escherichia coli bearing lambda is found to be more sensitive to danofloxacin than nonlysogenic E. coli. Danofloxacin exposure also induced a prophage in P. haemolytica. The potency of danofloxacin against lysogens in likely enhanced by this prophage induction.

Animals↗