Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “replicon”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 505 records · Page 28Linked to original sources
PubMed1987

A nuclease-derived fragment of metaphase DNA and its relationship to the replicon.

When isolated Chinese hamster cells (CHO) metaphase chromosomes are treated with nuclease Bal-31, the DNA is reduced to a size class that is resistant to further degradation. This size class resembles the distribution of replicon sizes in this particular cell line in both average size and size range. Tests based on molecular weight (MW) analysis were devised to locate the origin of replication within the Bal-31 segments. The evidence indicates that replication origins are positioned at or near the center of these segments. The tests were made possible by the additional discovery that BrdU-substituted DNA is highly susceptible to Bal-31 nuclease attack while still contained in the isolated metaphase chromosome.

Animals↗
PubMed1993

A human T lymphotropic virus type I (HTLV-I) long terminal repeat-directed antisense c-myc construct with an Epstein-Barr virus replicon vector inhibits cell growth in a HTLV-I-transformed human T cell line.

A panel of EB virus replicon-based vectors was constructed to examine the relative utility of four distinct eukaryotic promoters for high-level gene expression in a HTLV-I-transformed human T cell line, HUT102. We found that HTLV-I LTR, which is trans-activated by the viral tax protein, was most suited for EBV vector-based stable gene expression in it. We prepared a HTLV-I LTR-directed antisense c-myc construct with an EBV vector. This antisense plasmid suppressed c-myc expression and inhibited growth of HUT102 cells in vitro with unaltered expression of tax. Non-specific plasmid toxicity was excluded by showing that the antisense construct had little effect on growth and c-myc expression of HTLV-I-negative Jurkat T cells, in which the viral LTR is expected to be less active. Our results indicate that c-myc may play an important role in the deregulated growth of HTLV-I-transformed T cells.

Actins↗
PubMed1996

Resistance against cucumber mosaic virus in plants expressing the viral replicon.

CMV RNAs 1 and 2 are considered to constitute the viral replicon. Tobacco plants were transformed with either RNA1 or RNA2 to produce plant lines V1 and V2, respectively. Plants homozygous for each of the RNAs were generated and crossed to produce V1V2 (V2V1) lines that expressed both RNA1 and RNA2. An RNase protection assay indicated that RNA1 and RNA2 multiplied in V1V2 (V2V1) plants. Surprisingly, V1V2 (V2V1) plants, unlike their parent lines, showed a remarkably high level of resistance to CMV; this resistance was more effective against RNA inoculation than against virion inoculation. Experiments using protoplasts showed that the resistance was expressed at the single cell level. All the data together suggested that the observed resistance does not fit the criteria for either 'RNA-mediated' or 'replicase-mediated' resistance.

Base Sequence↗
PubMed1984

P1 plasmid replication: replicon structure.

Bacteriophage P1 lysogenizes Escherichia coli as a unit-copy plasmid. We have undertaken to define the plasmid-encoded elements implicated in P1 plasmid maintenance. We show that a 2081 base-pair fragment of the 90,000 base P1 plasmid confers the capacity for controlled plasmid replication. DNA sequence analysis reveals several open reading frames in this fragment. The largest is shown to encode a 32,000 Mr protein required for plasmid replication. The corresponding gene, repA, has been identified genetically. A set of five 19 base-pair repeats is located upstream from repA; a set of nine similar repeats is located immediately downstream from repA. Each set of repeats, when cloned into pBR322, exerts incompatibility towards a P1 replicon. The upstream set, designated incC, consists of direct repeats that are spaced about two turns of the DNA helix apart; the downstream set, designated incA, consists of nine repeats arranged three in one orientation and six in the other. Spacing between incA repeats were three or four turns of the helix apart. The organization of the plasmid maintenance regions of P1 and the unit-copy sex factor plasmid, F, is strikingly similar. Although the DNA sequences of this region in the two plasmids exhibit little homology, a 9 base-pair sequence that appears four times in the origin region of members of the Enterobacteriaceae also occurs twice as direct repeats in similar positions in P1 and F. This sequence, where it occurs in E. coli, has been postulated to be the binding site for the essential replication protein determined by dnaA. The dnaA protein appears not to be essential for the replication of either plasmid; therefore, the function of the sequence in P1 and F may be regulatory.

Base Sequence↗
PubMed1985

DNA topoisomerase I mutants. Increased heterogeneity in linking number and other replicon-dependent changes in DNA supercoiling.

Plasmid pBR322 DNA isolated from Salmonella typhimurium supX (topoisomerase I) mutants exhibits a novel supercoiling distribution characterized by extreme heterogeneity in linking number and the presence of highly negatively supercoiled topoisomers. The most negatively supercoiled topoisomers isolated from one supX mutant have more than twice the wild-type level of supercoiling; the distribution as a whole has a median superhelix density about 1.3 times that of wild type. Surprisingly, the supercoiling distribution of plasmid pUC9 DNA isolated from supX mutants differs from that of pBR322. Escherichia coli topoisomerase I mutants have been shown to acquire compensatory mutations that reduce bacterial chromosome supercoiling to below the wild-type level even in the absence of topoisomerase I. We find that such a compensatory mutation in an E. coli topoisomerase I deletion mutant does not reduce pBR322 DNA supercoiling to a level below that of wild type. Thus, the effects of topoisomerase mutations on supercoiling depend on the replicon.

Centrifugation, Density Gradient↗
PubMed1990

Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon.

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.

Animals↗
PubMed1992

Genetic and functional analysis of the basic replicon of pPS10, a plasmid specific for Pseudomonas isolated from Pseudomonas syringae patovar savastanoi.

The sequence of a 1823 base-pair region containing the replication functions of pPS10, a narrow host-range plasmid isolated from a strain of Pseudomonas savastanoi, is reported. The origin of replication, oriV, or pPS10 is contained in a 535 base-pair fragment of this sequence that can replicate in the presence of trans-acting function(s) of the plasmid. oriV contains four iterons of 22 base-pairs that are preceded by G+C-rich and A+T-rich regions. A dnaA box located adjacent to the repeats of the origin is dispensable but required for efficient replication of pPS10; A and T are equivalent bases at the 5' end of the box. repA, the gene of a trans-acting replication protein of 26,700 Mr has been identified by genetic and functional analysis. repA is adjacent to the origin of replication and is preceded by the consensus sequences of a typical sigma 70 promoter of Escherichia coli. The RepA protein has been identified, using the minicell system of E. coli, as a polypeptide with an apparent molecular mass of 26,000. A minimal pPS10 replicon has been defined to a continuous 1267 base-pair region of pPS10 that includes the oriV and repA sequences.

Amino Acid Sequence↗
PubMed1983

Rate of DNA synthesis in mammalian cells irradiated with ultraviolet light: a model based on the variations in the rate of movement of the replication fork and in the number of active replicons.

A model is proposed to describe the rate of DNA synthesis observed under certain conditions in UV irradiated mammalian cells. It is assumed that shortly after irradiation the rate of DNA synthesis drops mainly as a consequence of the drop in the rate of movement of the replication fork. This in turn, is due to a pause at the dimer for a limited length of time. Later on, a recovery in the rate of DNA synthesis occurs, and it is proposed that one of the parameters contributing to that is an increase in the number of active replicons. This simple model enables one to predict variations in the rate of DNA synthesis as a function both of UV dose and of time after irradiation.

Animals↗
PubMed1987

The sequence encoding the 43-kilodalton trfA protein is required for efficient replication or maintenance of minimal RK2 replicons in Pseudomonas aeruginosa.

The trfA gene of the broad-host-range plasmid RK2 encodes two proteins of 43- and 32-kDa by initiating translation at either of two in-phase AUG codons in a single open reading frame. At least one of these proteins is essential for replication of RK2 derivatives. In order to study the role of the 43-kDa protein, Bal31 deletions into the 5' end of the trfA gene were constructed and incorporated into minimal RK2 replicons. When examined in Escherichia coli, replication and maintenance properties of plasmids encoding only the 32-kDa protein were indistinguishable from those of plasmids encoding both the 43- and the 32-kDa proteins. In four other gram-negative hosts deletion of sequences encoding only the 43-kDa protein did not have a substantial effect on plasmid establishment or stable maintenance. However, in Pseudomonas aeruginosa, deletion of 43-kDa coding sequences greatly reduced the efficiency of plasmid maintenance, suggesting a host-specific role for the 43-kDa TrfA protein in RK2 replication.

Bacterial Proteins↗
PubMed1990

Chloramphenicol acetyltransferase expression in marine Rhodobacter sp. NKPB 0021 by use of shuttle vectors containing the minimal replicon of an endogenous plasmid.

A vector, pUK318, was constructed to allow the expression of foreign genes in the marine photosynthetic bacterium Rhodobacter sp. NKPB 0021. This strain has been cured of its two endogenous plasmids. pUK318 consists of a 2.3-kb PstI-BamHI restriction fragment, containing a marine Rhodobacter plasmid replication region, cloned into pUC18. This fragment was derived from plasmid pRD31, a 3.1-kb endogenous plasmid purified from the marine strain Rhodobacter sp. NKPB 043402. A kanamycin resistance gene from Tn903 was cloned into the PstI restriction site to provide antibiotic selection. pUK318 was transferred to Rhodobacter sp. NKPB 0021 by transformation, and efficiencies of 7.2 x 10(-5) were obtained. Furthermore, pUK318 was stably maintained when transformants were grown either heterotrophically or photosynthetically in the absence of antibiotics. pUK318 was used to express the Escherichia coli chloramphenicol acetyl transferase (CAT) gene in Rb. NKPB 0021. Transformants expressed a maximum CAT activity of 1.12 mmol/min/g dry cells. In addition, the DNA region essential for pUK318 replication in Rb. NKPB 0021 was localized to a 1.36-kb HincII-PstI fragment. This is the first report of a plasmid vector containing a marine Rhodobacter-specific replicon that allows stable expression of foreign genes in the absence of antibiotic selection.

Chloramphenicol O-Acetyltransferase↗
PubMed1991

Molecular organization of the minimal replicon of novel, narrow-host-range, lactococcal plasmid pCI305.

Plasmid pCI305 is an 8.7-kb, narrow-host-range, cryptic plasmid originating from Lactococcus lactis subsp. lactis UC317. The nucleotide sequence of the pCI305 replication region was determined. A single open reading frame of 1158 bp was identified in the trans-active domain repB. The size of the predicted repB protein (46 kDa) is in close agreement with the size of the repB product visualized in vivo in Escherichia coli when repB was placed under control of the inducible phi T7 RNA polymerase promoter. In vivo substitution of the native repB promoter sequence with a Tn5-derived promoter sequence was demonstrated. repA, a 344-bp cis-acting region which is the probable pCI305 replication origin region, was noncoding, was AT-rich, and possessed a unique set of inverted and direct repeat sequences. No significant homology between repA or repB and other gram-positive replication regions was evident. Combined with the absence of a detectable single-stranded DNA intermediate during replication, these results indicate that the pCI305 replication region differs markedly from most gram-positive replicons examined to date. The presence on other lactococcal plasmids of replication regions related to that of pCI305 was demonstrated.

Amino Acid Sequence↗
PubMed1992

The large plasmids found in enterohemorrhagic and enteropathogenic Escherichia coli constitute a related series of transfer-defective Inc F-IIA replicons.

Forty-six of 52 (88.5%) enterohemorrhagic Escherichia coli (EHEC) strains screened carried a "common" plasmid of about 90 kb which encoded sequences homologous to the Inc F-IIA replicon. A similarly high incidence of Inc F-IIA plasmid-containing strains was observed in other groups of diarrheagenic E. coli, but not in random environmental coliform isolates. Enteropathogenic E. coli (EPEC) contain plasmids of similar properties and share a 23-kb DNA fragment with plasmids from EHEC. The common region encodes the F-IIA replication region and sequences homologous to the transfer operon of the Inc F-II plasmid R1. Sequence homology varied between plasmids isolated from different EHEC/EPEC strains with > 80% showing homology to the regions encoding the rep and par genes. Only 5% of plasmids from EHEC strains had intact sequences homologous to the DNA between these two regions, including the oriT site. Some plasmids with an apparently intact tra operon still failed to plaque F-pilus-specific phages. This is consistent with observations that the large plasmids of EHEC and EPEC are phenotypically nonconjugative. These results suggest that the large plasmids of EHEC/EPEC constitute a family of transfer-deficient Inc F-IIA plasmids with varying degrees of deletion in tra function. The evolutionary ramifications of this finding are considered.

DNA Probes↗
PubMed1985

Effect of ultraviolet light on thymidine incorporation, DNA chain elongation and replicon initiation in wild-type and excision-deficient Chinese hamster ovary cells.

Wild-type Chinese hamster ovary cells (AA8) and five excision-deficient clones derived from the AA8 line (UV-4, UV-5, UV-20, UV-24 and UV-41) were exposed to ultraviolet light and then analyzed for their ability to incorporate [3H]thymidine and to initiate as well as elongate replicon-sized DNA fragments. After exposure to ultraviolet light, all cell lines exhibited a depression in the rate of thymidine incorporation. For exposures of 4.0 J/m2 or higher the wild-type cells recovered normal rates of thymidine incorporation within a few hours, while none of the excision-deficient lines exhibited complete recovery. For fluences below 4.0 J/m2 all but the UV-5 line exhibited at least some recovery. The ability to elongate DNA chains appeared to correlate with the thymidine incorporation data, with the UV-5 line exhibiting the strongest blockage of DNA chain elongation, the AA8 line exhibiting the least blockage, and the UV-20 line exhibiting an intermediate response. All cell lines exhibited a decrease in the distance between replication origins, thus supporting models which propose that exposure to ultraviolet light results in the use of alternative sites for the initiation of replication.

Animals↗
PubMed1982

Reduced inhibition of replicon initiation and chain elongation by neocarzinostatin in skin fibroblasts from patients with ataxia telangiectasia.

Cells from patients with the genetic disease ataxia telangiectasia are hypersensitive to the DNA-breaking agents X-rays, bleomycin and neocarzinostatin, and show reduced inhibition of DNA synthesis after treatment with these agents, as compared to normal cells. The rate of replicon initiation and chain elongation was measured shortly after brief exposure of two normal and two ataxia telangiectasia fibroblast strains to low doses (0.10-0.30 microgram/ml) of neocarzinostatin, by means of alkaline sucrose gradient analysis. Neocarzinostatin was found to inhibit both initiation and elongation, and both components of DNA synthesis were more resistant to this inhibition in the A-T strains.

Antibiotics, Antineoplastic↗
PubMed1985

Theophylline release of replicon initiation inhibition by nitrosoureas correlates with the synergistic killing in L1210 leukemia in vitro.

This report demonstrates the synergistic killing of murine L1210 leukemia in vitro by BCNU and theophylline as has previously been reported in vivo. Synergism is also seen with the related nitrosourea CNU plus theophylline. As measured on alkaline sucrose gradients and by pH-step alkaline elution, the nitrosourea-induced inhibition of DNA replicon initiation is completely reversed in the presence of theophylline. DNA interstrand crosslinking, the damage which usually correlates with nitrosourea cytotoxicity, is not increased by the combination of nitrosourea plus theophylline. At high nitrosourea doses, this interstrand crosslinking is reduced in the presence of theophylline. At least part of the mechanism of the two-drug synergism is the theophylline release of nitrosourea-induced DNA initiation inhibition. Some of the results have been presented at the Annual Meeting of the American Association for Cancer Research.

Animals↗
PubMed1992

Construction of a shuttle lacZ alpha-based Escherichia coli-actinomycetes vector containing the phage JHJ-3 replicon.

Using the broad replicating range JHJ-3 phage replicon, a shuttle vector for Escherichia coli and actinomycetes has been constructed. The vector, pOJ31, bears the lacZ alpha fragment allowing a blue/white gene cloning system. pOJ31 also contains a polylinker of 15 unique cloning sites and the phage T7 promoter. The vector has been used to stably express the mel gene from plasmid pIJ702 in Streptomyces lividans.

Actinomycetales↗
PubMed1985

Endpoint distribution for deletions into imm lambda region forming p lambda CM replicons: phage lambda gene rex affects plasmid establishment.

For the p lambda CM family of lambda-derived self-encapsidating plasmids, the rexB gene product facilitates plasmid establishment following injection into a new host cell. Temperature-stable chloramphenicol resistance (CmR at 40 degrees C) conferred by low-multiplicity infection with lambda::Tn9 cI857 lysates (Tn9 sites tested: 22.60 or 24.08 kb, in the b region, or 28.41 kb, in int) is usually due to a lambda::Tn9 plasmid (p lambda CM) formed by a deletion penetrating the lambda immunity region. These grow either as plasmids in the absence of, or lytic phages in the presence of N function supplied by a host such as lambda cI857 delta H1 lysogen MS1449. The 'groplaque' (plaque-shaped growth spot) assay, which selects for CmR growth in an MS1449 lawn at 32 degrees C after an initial plaquing period at 37 degrees C, reveals two distinguishable classes of p lambda CM isolates. All variants whose deletions extend into or beyond rexB give rise to visible CmR growth only after the temperature shift to 32 degrees C, and thus produce a hollow-centered 'donut' type of groplaque. In contrast, 16 out of 17 variants whose deletions fall short of rexB produce 'solid' groplaques which appear before the temperature shift. Tests of T4rII phage exclusion show the exceptional 17th variant to be Rex-, confirming the identification of rex as the lambda component whose loss results in the 'donut' groplaque morphology. More specific physiological tests showed that in the absence of Rex the establishment of a newly injected p lambda CM plasmid becomes temperature-sensitive (ts), while plasmid maintenance remains unaffected. This indicates that the role of Rex in plasmid survival is confined to the early stages of transduction, where it might either assist plasmid replication or retard host replication, to help the plasmid replicon achieve a copy number sufficient for stable transmission.

Bacteriophage lambda↗