Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Response Elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 505 records · Page 28Linked to original sources
PubMed1995

Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

Base Sequence↗
PubMed2003

Transcriptional regulation of the mouse steroidogenic acute regulatory protein gene by the cAMP response-element binding protein and steroidogenic factor 1.

Transcriptional induction by cAMP is mediated through the interaction of the cAMP response-element binding protein (CREB) with a cAMP response element (CRE) in the promoter of target genes. The steroidogenic acute regulatory (StAR) protein gene is regulated by cAMP-mediated signaling in steroidogenic cells even though its promoter lacks a consensus CRE. Previously, we have identified three highly conserved 5'-CRE half-sites within the -96/-67 bp region of the mouse StAR gene, and a member of the CREB family (CREB/CRE modulator (CREM)) was shown to be involved in its expression and regulation. Here we show that CREB and CREMtau (but not CREMalpha and CREMbeta) have qualitatively similar effects on StAR promoter activity in response to (Bu)(2)cAMP. Studies on the effects of the functional integrity of the CRE half-sites on CREB-dependent (Bu)(2)cAMP-mediated StAR gene transcription demonstrated the greater importance of the CRE2 site in comparison with the CRE1 and CRE3 sites. The CRE2 sequence was also found to bind specifically to recombinant CREB protein and nuclear extract from MA-10 mouse Leydig tumor cells. The cAMP and CREB/CREM responsive region (-151/-1 bp) of the mouse StAR promoter also contains three recognition motifs for steroidogenic factor 1 (SF-1). Electrophoretic mobility shift assays and reporter gene analyses demonstrated the involvement of different SF-1 elements in StAR gene expression with the order of importance being SF-1/3>SF-1/1>SF-1/2. Specific mutations that eliminated the binding sites of CRE and SF-1 elements, either alone or in combination, resulted in an attenuation of StAR promoter activity, indicating that CREB and SF-1 can regulate StAR gene transcription in a cooperative fashion. In addition, mammalian two-hybrid assays revealed a high affinity protein-protein interaction between CREB/CREMtau and SF-1 which appeared to be dependent upon CREB protein phosphorylation. These findings further demonstrate CREB's role in StAR gene transcription and also provide evidence that the combined action of CREB/CREMtau and SF-1 results in enhanced activation of the StAR promoter.

Animals↗
PubMed2005

cAMP response element binding protein (CREB) activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene.

BACKGROUND: The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE). RESULTS: The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP) family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA) in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2), known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. CONCLUSIONS: Using a constitutively active CREB2/CREB fusion protein and a mutant of the PKA catalytic subunit that is targeted to the nucleus, we have shown that the glucose-6-phosphatase gene has two distinct genetic elements that function as bona fide CRE. This study further shows that the expression vectors encoding C2/CREB and catalytic subunit of PKA are valuable tools for the study of CREB-mediated gene transcription and the biological functions of CREB.

Cyclic AMP Response Element-Binding Protein↗
PubMed1997

Polarity and specific sequence requirements of peroxisome proliferator-activated receptor (PPAR)/retinoid X receptor heterodimer binding to DNA. A functional analysis of the malic enzyme gene PPAR response element.

The malic enzyme (ME) gene is a target for both thyroid hormone receptors and peroxisome proliferator-activated receptors (PPAR). Within the ME promoter, two direct repeat (DR)-1-like elements, MEp and MEd, have been identified as putative PPAR response elements (PPRE). We demonstrate that only MEp and not MEd is able to bind PPAR/retinoid X receptor (RXR) heterodimers and mediate peroxisome proliferator signaling. Taking advantage of the close sequence resemblance of MEp and MEd, we have identified crucial determinants of a PPRE. Using reciprocal mutation analyses of these two elements, we show the preference for adenine as the spacing nucleotide between the two half-sites of the PPRE and demonstrate the importance of the two first bases flanking the core DR1 in 5'. This latter feature of the PPRE lead us to consider the polarity of the PPAR/RXR heterodimer bound to its cognate element. We demonstrate that, in contrast to the polarity of RXR/TR and RXR/RAR bound to DR4 and DR5 elements respectively, PPAR binds to the 5' extended half-site of the response element, while RXR occupies the 3' half-site. Consistent with this polarity is our finding that formation and binding of the PPAR/RXR heterodimer requires an intact hinge T region in RXR while its integrity is not required for binding of the RXR/TR heterodimer to a DR4.

3T3 Cells↗
PubMed2004

Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration.

Metal-responsive transcription factor-1 (MTF-1) is a zinc finger protein with a central role in heavy metal homeostasis/detoxification. MTF-1 binds to DNA sequence motifs known as metal response elements (MREs) with a core consensus TGCRCNC. Since MTF-1 is also involved in other stress responses, we tested whether it is able to recognize different types of DNA sequence motifs. To this end we selected MTF-1-binding oligonucleotides from a collection of random sequences. Since MTF-1 binds to known target sequences at relatively high zinc concentrations, oligonucleotide selection was performed in a mammalian cell nuclear extract both at high and low zinc concentrations. Irrespective of zinc concentration, we find a robust representation of MRE consensus sequences, however with specific features. Selection was most efficient at 100 microM zinc, yielding many oligonucleotides with two MRE motifs in divergent orientation of the sequence GTGTGCATCACTTTGCGCAC (core consensus underlined). Oligonucleotides selected without zinc supplement contain a single high-affinity MRE with an extended flanking sequence of consensus TTTTGCGCACGGCACTAAAT (core consensus underlined). This low-zinc MRE motif can bind MTF-1 and induce transcription in vivo, and is less dependent on zinc than the classical MREd motif from the mouse metallothionein-I promoter. At low zinc, we also found evidence for a negative role of nuclear factor-I (NF-I/CTF-I) in MTF-1-dependent transcription. Finally, a selection in the presence of cadmium yielded no specific binding site for MTF-1, strongly supporting the concept of an indirect activation of MTF-1 by cadmium within a living cell.

Base Sequence↗
PubMed1994

Serum response elements mediate protein kinase C dependent transcriptional induction of early growth response gene-1 by arginine vasopressin in rat mesangial cells.

Arginine vasopressin (AVP) regulates glomerular hemodynamics, alters extracellular matrix production, and induces proliferation of glomerular mesangial cells (MCs). Therefore, AVP may play a role in glomerular sclerosis and the progression of chronic renal failure. To investigate changes in early gene expression which may link intracellular biochemical events with changes in MC phenotype following AVP stimulation, we studied expression of the Early growth response gene-1 (Egr-1). Nuclear run off assays demonstrate that AVP induces Egr-1 at the transcriptional level. Transcriptional induction was, like induction of mitogenesis, dependent upon activation of protein kinase C (PK C). Promoter deletion analysis revealed that the region critical for Egr-1 inducibility by AVP contained several serum response element (SRE) consensus sequences. Sequential deletion of these SREs led to a drop in AVP-stimulated promoter activity. AVP was also able to stimulate transcription from a construct containing an Egr-1 SRE upstream of a heterologous promoter and this effect required activation of PK C. Electrophoretic mobility shift assays, using an Egr-1 SRE as probe, demonstrate up to four protein-SRE complexes of differing size that undergo modest quantitative changes following AVP stimulation. These data in MCs suggest that upstream SREs mediate transcriptional induction of Egr-1 by AVP in a PK C-dependent fashion and that changes in DNA-protein interaction involving the SREs may be in part responsible for this effect.

Animals↗
PubMed1991

The AP-1 site and the cAMP- and serum response elements of the c-fos gene are constitutively occupied in vivo.

The c-fos proto-oncogene is inducible by cAMP, phorbol esters, serum, and growth factors. The induction by cAMP is mediated by the conserved cAMP response element (CRE), while induction by phorbol esters, serum, and growth factors requires a distal element called the serum response element (SRE). In addition to these elements, a consensus AP-1 transcription factor binding site is located next to SRE. Upstream regions of the mouse and human c-fos genes were footprinted in vivo by the ligation-mediated polymerase chain (PCR). Our results show that all three elements are constitutively protected in mouse liver and lung and in cultured human A431 cells. No major change in the protection profile was detected in A431 cells following stimulation with epidermal growth factor or in mice at birth, when c-fos is known to be induced. These results suggest that the inducible cis elements of the c-fos gene are poised, ready to respond immediately to external signals.

Animals↗
PubMed2001

Glucose and cAMP regulate the L-type pyruvate kinase gene by phosphorylation/dephosphorylation of the carbohydrate response element binding protein.

Recently we purified and identified a previously uncharacterized transcription factor from rat liver binding to the carbohydrate responsive element of the L-type pyruvate kinase (L-PK) gene. This factor was named carbohydrate responsive element binding protein (ChREBP). ChREBP, essential for L-PK gene transcription, is activated by high glucose and inhibited by cAMP. Here, we demonstrated that (i) nuclear localization signal and basic helix-loop-helix/leucine-zipper domains of ChREBP were essential for the transcription, and (ii) these domains were the targets of regulation by cAMP and glucose. Among three cAMP-dependent protein kinase phosphorylation sites, Ser(196) and Thr(666) were the target sites. Phosphorylation of the former resulted in inactivation of nuclear import, and that of the latter resulted in loss of the DNA-binding activity and L-PK transcription. On the other hand, glucose activated the nuclear import by dephosphorylation of Ser(196) in the cytoplasm and also stimulated the DNA-binding activity by dephosphorylation of Thr(666) in the nucleus. These results thus reveal mechanisms for regulation of ChREBP and the L-PK transcription by excess carbohydrate and cAMP.

Amino Acid Sequence↗
PubMed1990

Regulation of glutathione S-transferase Ya subunit gene expression: identification of a unique xenobiotic-responsive element controlling inducible expression by planar aromatic compounds.

We have identified a region in the 5' flanking sequence of the glutathione S-transferase (RX:glutathione R-transferase, EC 2.5.1.18) Ya subunit gene that contains a unique xenobiotic-responsive element (XRE). The regulatory region spans nucleotides -722 to -682 of the 5' flanking sequence and is responsible for part of the basal level as well as inducible expression of the Ya subunit gene by planar aromatic compounds such as beta-naphthoflavone (beta-NF) and 3-methyl-cholanthrene. The DNA sequence of this region (beta-NF-responsive element) is distinct from the DNA sequence of the XRE found in the cytochrome P-450 IA1 gene. In addition to the region containing the beta-NF-responsive element, two other regulatory regions of the Ya subunit gene have been identified. One region spans nucleotides -867 to -857 and has a DNA sequence with identity to the hepatocyte nuclear factor 1 recognition motif found in several liver-specific genes. The second region spans nucleotides -908 to -899 and contains a DNA sequence with identity to the XRE found in the cytochrome P-450 IA1 gene. The XRE sequence also contributes to part of the responsiveness of the Ya subunit gene to planar aromatic compounds. Our data suggest that regulation of gene expression by planar aromatic compounds can be mediated by a DNA sequence that is distinct from the XRE sequence.

Base Sequence↗
PubMed1991

A retinoic acid response element is part of a pleiotropic domain in the phosphoenolpyruvate carboxykinase gene.

Several hormones, including insulin, glucagon, and glucocorticoids, regulate the expression of the rate-limiting gluconeogenic enzyme, phosphoenolpyruvate carboxykinase [GTP: oxaloacetate carboxy-lyase (transphosphorylating); EC 4.1.1.32; PEPCK] in liver. In this report we demonstrate that retinoic acid (RA) also regulates PEPCK expression by inducing a 3-fold increase in the rate of transcription of the PEPCK gene. A RA response element located between -468 and -431 in the PEPCK promoter mediates a 7-fold increase in expression of a chimeric construct containing the basal PEPCK promoter ligated to the chloramphenicol acetyltransferase reporter gene. This element confers RA responsiveness through the heterologous thymidine kinase promoter and functions relatively independent of position and orientation. An 18-base-pair core sequence (-451 to -434) (i) mediates an effect of RA on PEPCK gene expression and contains motifs found in two other RA response elements; (ii) corresponds to AF1, an accessory factor element that is an integral component of the complex glucocorticoid response unit in the PEPCK gene promoter; (iii) is in a region involved in the developmental expression of the PEPCK gene; and (iv) shows homology to elements involved in the tissue-specific regulation of genes, including the hepatic apolipoprotein genes and the alpha 1-antitrypsin gene.

Animals↗
PubMed1996

IL-6-inducible complexes on an IL-6 response element of the junB promoter contain Stat3 and 36 kDa CRE-like site binding protein(s).

The junB gene is one of immediate-early genes whose expression are regulated by a variety of extracellular stimuli and play important roles in cellular responses to the given stimuli. Interleukin-6 (IL-6) activates the junB promoter through an IL-6 response element, JRE-IL6, that is composed of two cooperative DNA motifs, a low affinity Stat-binding site overlapping with an Ets-binding site (JEBS) and a cAMP responsive element (CRE)-like site. This element is a target for the Jak-Stat signal transduction pathway. We showed that IL-6 induced novel complexes on JRE-IL6, termed JRE-IL6-BC1 and 2, which contained Stat3 but migrated more slowly than the complexes containing homo- or heterodimer of Stat3 and Stat1 in gel shift assays. These slow-migrating JRE-IL6-BCs appeared to contain CRE-like site binding proteins besides Stat3, since the formation of JRE-IL6-BCs required both the JEBS and CRE-like site of JRE-IL6 and oligonucleotides containing the CRE-like site or somatostatin CRE efficiently competed with JRE-IL6 for making JRE-IL6-BCs. The formation of the complexes correlated well with the responsiveness of JRE-IL6 to IL-6 signals. U.v.-cross linking study revealed that JRE-IL6 bound a 90 kDa protein, corresponding to Stat3, and a 36 kDa protein, most likely a CRE-like site binding protein(s). Furthermore, we showed that the IL-6/interferon gamma (IFN gamma) response element in the IRF-1 promoter (IR/IRF-1), which contains a Stat-binding site and an adjacent CRE-like site, also makes IL-6-induced binding complexes similar to JRE-IL6-BCs.

Base Sequence↗
PubMed1999

The cyclic AMP response element modulator family regulates the insulin gene transcription by interacting with transcription factor IID.

We analyzed a mechanism of transcriptional regulation of the human insulin gene by cyclic AMP response element modulator (CREM) through four cyclic AMP response elements (CREs). We isolated two novel CREM isoforms (CREMDeltaQ1 and CREMDeltaQ2), which lack one of the glutamine-rich domains, Q1 and Q2 respectively, and six known isoforms (CREMtaualpha, CREMalpha, inducible cyclic AMP early repressor (ICER) I, ICER Igamma, CREM-17X, and CREM-17) from rat pancreatic islets and the RINm5F pancreatic beta-cell line. CREM isoforms functioned as efficient transcriptional activators or repressors to modulate insulin promoter activity by binding to all of the insulin CREs. The binding activity of repressors is higher than that of activators and suppressed not only basal activity but also activator-induced activities. Furthermore, CREM activator interacted directly with the transcription factor IID components hTAF(II)130 and TATA box-binding protein (TBP). These results suggest that the activation of the insulin gene transcription by CREM activator is mediated by not only direct binding to the CREs but also by recruiting transcription factor IID to the insulin promoter via its interaction with hTAF(II)130 and TBP. On the other hand, the CREM repressor ICER competitively interrupts the binding of the activators to CREs and does not interact with either TBP or hTAF(II)130; therefore, it might fail to stabilize the basal transcriptional machinery and repress transactivation.

Animals↗
PubMed1994

Evidence for other binding component(s) than retinoid receptors specifically interacting with a retinoic acid response element in the rat liver.

A nuclear component interacting with a retinoic acid response element (RARE-beta) derived from the all-trans-retinoic acid receptor beta (RAR beta) gene promoter was detected in the rat liver by gel-shift assay. Competition experiments using the competitors of the other retinoid response elements and non-specific sequences upon the binding of this hepatic component (HBC) to the RARE-beta revealed that the binding of the HBC to the RARE-beta was competed only by the self competitor, but not the other elements, suggesting that the HBC is specific for the RARE-beta. Moreover, although the specific monoclonal antibodies for RAR alpha, RAR beta, and RAR gamma reacted and shifted up the DNA complexes of endogenous as well as recombinant RARs, the DNA complex with HBC was not subjected to the immunoreaction with the antibodies. Thus, newly identified HBC, which is distinct from the characterized retinoid receptors, may modulate retinoid signaling through its direct binding upon the RARE-beta.

Animals↗
PubMed1998

Identification of a functional glucocorticoid response element in the CYP3A1/IGC2 gene.

The rat CYP3A subfamily of cytochrome P450 consists of steroid- and drug-metabolizing enzymes inducible by pregnenolone 16alpha-carbonitrile and by supra-physiological doses of dexamethasone. The induction of CYP3A by dexamethasone has been proposed to be mediated by a mechanism distinct from the glucocorticoid receptor mediated response. However, a synergistic induction of CYP3A has been observed with physiological doses of glucocorticoids and other CYP3A inducers. We have identified the presence of a glucocorticoid-responsive element in the CYP3A1/IGC2 gene that mediates the induction with physiological doses of glucocorticoids. A 219-bp dexamethasone responsive fragment of the CYP3A1/IGC2 gene localized at -2100/-1882 bp upstream of the transcription initiation site was identified in transfection experiments with HepG2 cells. Maximum induction was achieved with 50-100 nM dexamethasone. DNase I footprinting analysis revealed two glucocorticoid receptor-protected sequences in the 5' flank of the CYP3A1/IGC2 gene. Point mutations in footprint I (-1982/-1960-bp) completely abolished binding and transcription activation whereas a mutation in footprint II (-2001/-1986-bp) only decreased the binding and had no effect on transcription activation. These results led to the conclusion that the glucocorticoid response element present in footprint I mediated the dexamethasone response in transfection experiments with HepG2 cells. Pregnenolone 16alpha-carbonitrile failed to induce any transcriptional effect mediated by this response element in the HepG2 cells.

Animals↗
PubMed1990

Spacing between GT-1 binding sites within a light-responsive element is critical for transcriptional activity.

Dissection of the light-responsive element (LRE) located between -166 and -50 of rbcS-3A from pea has revealed critical spacing requirements between the two GT-1 binding sites for light-responsive transcription. An increase in spacing between the two sites by as little as 2 bp reduces dramatically the rbcS-3A transcript levels in vivo. Mutation of the 10 bp between the binding sites leads to slightly lower transcript levels, as do deletions of either 3 bp or 8 bp. Deletions of 5 bp or 7 bp from between the GT-1 binding sites do not affect rbcS-3A transcript levels; however, a deletion of 10 bp virtually abolishes the activity of this element. These spacing changes within the light-responsive element similarly affect transcription of a divergently oriented and truncated nopaline synthase promoter. Most spacing changes between the two GT-1 binding sites, however, do not impair the binding of GT-1 to this element in vitro. Together with previous observations, these results suggest that the nuclear factor GT-1 may interact with the binding sites in either a productive or nonproductive manner and that GT-1 binding is necessary but not sufficient for light-responsive transcription. We also discuss our results in relation to the observed spacing of similar sequence elements present within other light-responsive promoters.

Amino Acid Oxidoreductases↗
PubMed1992

The iron-responsive element binding protein. Purification, cloning, and regulation in rat liver.

The iron-responsive element binding protein (IRE-BP) is a cytosolic protein that binds a highly conserved sequence in the untranslated regions of mRNAs involved in iron metabolism including ferritin, transferrin receptor, and erythroid 5-aminolevulinate acid synthase. This conserved sequence is termed the iron-responsive element and is necessary for the post-transcriptional regulation of these mRNAs by iron. The rat liver IRE-BP was purified to homogeneity by chromatographic methods and partial amino acid sequence was obtained. A cDNA was isolated from a rat liver cDNA library and sequenced. The amino acid sequence deduced from the cDNA sequence corresponds to a protein of 889 amino acids with a predicted molecular weight of 97.946. The NH2-terminal sequence obtained by Edman degradation matched the deduced amino acid sequence obtained from the cDNA, confirming the translational start site. Rat liver IRE-BP shares 95% identity with human IRE-BP and 98% identity with mouse IRE-BP indicating that the IRE-BPs have remained highly conserved during evolution. The 5'-untranslated region is at least 236 nucleotides and contains interesting structural features including two direct repeats, an inverted repeat, and three small open reading frames. The rat IRE-BP mRNA is approximately 3600 nucleotides and is expressed in a variety of rat tissues including liver, spleen, and gut. Over the course of 16 h following an intraperitoneal injection of iron in rats. IRE-BP RNA binding activity decreases to 50% of control levels. The decrease in IRE-BP RNA binding activity in extracts from iron-treated rats is reversible by pretreatment of the extracts with reducing agents. The steady-state levels of IRE-BP mRNA remain constant during iron treatment. These data suggest that the decrease in IRE-BP RNA binding activity by iron in rat liver is due to post-translational changes in the RNA binding affinity of the IRE-BP and not due a decrease in the transcription of the IRE-BP gene or to the destabilization of the IRE-BP mRNA.

Amino Acid Sequence↗
PubMed1990

Identification of a high molecular weight steroid response element binding protein.

In this study we report the identification of a Steroid Response Element-Binding Protein (SRE-BP) present in whole cell extracts of HeLa cells and GH3 pituitary tumor cells which specifically binds to two classes of functionally distinct SREs. In gel retardation experiments SRE-BP binds preferably to oligonucleotides containing an estrogen response element (ERE) or a symmetrical glucocorticoid response element (GRE); it binds less well to a mutant GRE and poorly, if at all, to a thyroid response element (TRE). The SRE-BP does not recognize transcription factor binding sites present in the promoter of the Herpes Simplex Virus thymidine kinase gene. We have shown, using gel filtration chromatography that the SRE-BP has a relative molecular weight under nondenaturing conditions of 205 K (+/- 20 K). The SRE-BP is not a steroid receptor as evidenced by different DNA sequence specificity, cell type distribution, and molecular weight. We propose that by modulating the interaction of steroid receptors with target SREs, the SRE-BP plays a role in specificity of steroid hormone action.

Base Sequence↗
PubMed1998

Characterization of the enhancer-like okadaic acid response element region of the cyclin-dependent kinase 1 (p34cdc2) promoter.

Expression of the cdk1 (p34cdc2) gene is enhanced 5-10 fold as cells re-enter the cell cycle from quiescence in response to serum-refeeding or following exposure to the protein phosphatase 1/2A inhibitor okadaic acid. Transient transfection analysis of nested deletions of the human cdk1 promoter identified regions that confer sensitivity to okadaic acid on a CAT-reporter gene. Putative okadaic acid response elements (OARE) were located between nt -942 to -763 (Site I) and nt -416 to -186 (Site II) before transcription start. The Site I element has enhancer-like characteristics as activity is independent of sequence orientation. Mobility shift analysis of Site I revealed the presence of 2 high molecular weight complexes, one of which was enhanced in the presence of okadaic acid-treated cell extracts. Site I contained several sequence motifs with conserved homology to heat shock response element core sequences and homeobox protein binding sites. Site II contained a myb-binding site, a G1/S phase enhancer, and 2 retinoblastoma response elements flanking an E2F binding site. Enhancement of cdk1 expression appears dependent on 2 nonhomologous okadaic acid-sensitive promoter regions.

Base Sequence↗