Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “MOSAICISM”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 505 records · Page 28Linked to original sources
PubMed2000

Somatic and germline mosaic mutations in the doublecortin gene are associated with variable phenotypes.

Mutations in the X-linked gene doublecortin lead to "double cortex" syndrome (DC) in females and to X-linked lissencephaly (XLIS) in males. Because most patients with DC and XLIS are sporadic, representing de novo doublecortin mutations, we considered that some of these patients could be somatic or germline mosaics. Among a population of 20 patients and their families, we found evidence for mosaic doublecortin mutations in 6 individuals. Germline mosaicism was identified in two unaffected women, each with two affected children. Additionally, one affected male with DC was found to be a somatic mosaic, which presumably spared him from the more severe phenotype of lissencephaly. The high rate of mosaicism indicates that there may be a significant recurrence risk for DC/XLIS in families at risk, even when the mother is unaffected.

Adult↗
PubMed2003

Incidence of chromosomal mosaicism in human embryos at different developmental stages analyzed by fluorescence in situ hybridization.

Chromosomal mosaicism has been reported in in vitro-cultured embryos at early cleavage stages, as well as in morulae and blastocysts. We have assessed the incidence and pattern of mosaicism during in vitro development of human embryos from early-cleavage stages to morula and blastocyst. Fifty spare embryos were fixed for fluorescence in situ hybridization (FISH) analysis for chromosomes X, Y, 13, 18, and 21 on days 2 or 3 (4- to 10-cell stage) (n = 16), on day 4 (morula stage) (n = 14), on day 5 (pre-expanded blastocyst) (n = 5), and the expanded blastocyst stages (n = 15). Blocked embryos (no cleavage observed within the last 24 hr) were not included. A total of 2367 cells were analyzed. Four early-cleavage stage embryos were found uniformly diploid; all of the others were mosaic for the chromosomes analyzed (mean diploid nuclei 48.3% +/- 28.7). All of the embryos at more advanced developmental stages, except one fully normal morula, had mosaic chromosome constitutions, with an increase in the percentage of diploid cells in morulae, pre-expanded, and expanded blastocysts, respectively (mean diploid nuclei 78.6% +/- 11.7, 66.0% +/- 20.8, 79.6% +/- 12.8), in comparison with earlier stages. Hypotheses about the origin of mosaicism and embryo regulation mechanisms will be discussed.

Aneuploidy↗
PubMed1982

The mathematics of mosaic analysis. II. Formulae for interacting foci.

Mosaic fate mapping requires first a measurement of the frequency of separation (by genotype) of two structures and then a conversion of this frequency of separation to distance (WYMAN and THOMAS 1982). If the genotype of two structures is visible, the frequency of separation (sturt distance) may be directly obtained. If the genotype is not visible (e.g., for behavioral foci) then the frequency of separation (sturt distance) itself must be calculated. The formulae introduced by HOTTA and BENZER (1972) for calculating frequency of separation are appropriate only for a set of mosaics in which each fly has half normal and half mutant tissue. Using these formulae for a set of mosaics with a different fraction of mutant tissue can give enormously incorrect results.--In this paper we use intuitive lines of reasoning to obtain simple formulae for frequencies of separation that are algebraically equal to the more elaborate HOTTA and BENZER (1972) formulae.--We show that when calculating sturt distances, data from a collection of mosaics with a range of malenesses, even if the average maleness is 1/2, cannot be lumped together. We prove that applying any formula appropriate for m = 1/2 to a set of mosaics all of maleness m, and then to a set of maleness 1-m, and then averaging the two results, does give the correct value for sturt distances. In this way all the mapping distances may be obtained.--Another method for locating foci is called "contour mapping". We show that the currently available contour formulae are inaccurate. We suggest that contour maps be drawn using the accurate sturt distances.

Animals↗
PubMed1996

Mosaic analysis using a ncl-1 (+) extrachromosomal array reveals that lin-31 acts in the Pn.p cells during Caenorhabditis elegans vulval development.

We describe a genetic mosaic analysis procedure in which Caenorhabditis elegans mosaics are generated by spontaneous loss of an extrachromosomal array. This technique allows almost any C. elegans gene that can be used in germline transformation experiments to be used in mosaic analysis experiments. We identified a cosmid clone that rescues the mutant phenotype of ncl-1, so that this cell-autonomous marker could be used to analyze mosaic animals. To determine the sites of action for unc-29 and lin-31, an extrachromosomal array was constructed containing the ncl-1(+) cosmid linked to lin-31(+) and unc-29(+) cosmids. This array is mitotically unstable and can be lost to produce a clone of mutant cells. The specific cell division at which the extrachromosomal array had been lost was deduced by scoring the Ncl phenotypes of individual cells in genetic mosaics. The Unc-29 and Lin-31 phenotypes were then scored in these animals to determine in which cells these genes are required. This analysis showed that unc-29, which encodes a subunit of the acetylcholine receptor, acts in the body muscle cells. Furthermore, lin-31, which specifies cell fates during vulval induction and encodes a putative transcription factor similar to HNF-3/fork head, acts in the Pn.p cells.

Animals↗
PubMed1998

Mosaicism in sporadic neurofibromatosis 2 patients.

More than half of neurofibromatosis 2 (NF2) patients represent de novo mutations which could have occurred at either pre-zygotic or post-zygotic stages. A post-zygotic mutation can result in mosaicism. In four sporadic NF2 patients, we found NF2 mutations in only a portion of corresponding leukocytes. In two other sporadic patients, no mutations were found in leukocytes but constitutional NF2 mutations were suggested by identical mutations in different tumors from each patient. We screened leukocyte DNA from a total of 16 inherited and 91 sporadic NF2 patients, and found NF2 mutations in 13 (81%) of the former and in 46 (51%) of the latter cases. The 30% difference in the rate of detection of mutations ( P = 0.051) might be partially explained by mosaicism in a portion of sporadic NF2 patients who carry the mutations in such a fashion that their leukocytes are unaffected. Among sporadic cases, we found mutations more frequently in patients with severe phenotypes (59%) than in patients with mild phenotypes (23%) (difference of 36%, P = 0.007). Mosaicism might be more common in the latter patient group since small populations of mutation-bearing cells can in some cases result in mild phenotypes and can also lead to difficulties in identifying mutations. No mutations were found in eight patients suspected of having NF2. Mosaicism with an extremely small population of affected cells may explain the incomplete phenotypes in some of these patients and the lack of mutations in their leukocytes. These findings suggest that mosaicism is relatively common in NF2 and may have important implications for diagnosis, prognosis and genetic counseling.

Adolescent↗
PubMed1998

Mosaicism in the inner cell mass of human blastocysts.

Although mosaicism was shown to be a normal feature in cleaving embryos, its consequences for the late preimplantation stages are unknown. We performed blastocyst immunosurgery, followed by fluorescent in-situ hybridization (FISH), to determine the number of cells and degree of mosaicism in the inner cell mass (ICM) of human blastocysts. Of 47 ICM samples analysed, 20 had aneuploid cells, and two also had a few tetraploid cells. The average degree of aneuploidy in the ICM was similar to the overall blastocyst mosaicism, suggesting that there is probably no selection for euploid ICM. The lower degree of blastocyst mosaicism, compared with the cleavage-stage embryos, may be due to a mechanism of selection against the embryos with high frequency of mosaicism, leading to elimination of these embryos prior to blastocyst formation.

Aneuploidy↗
PubMed2005

Mosaic status in lymphocytes of infertile men with or without Klinefelter syndrome.

BACKGROUND: Gonosomal aneuploidies such as Klinefelter syndrome (47,XXY) are the most frequent chromosomal aberration in infertile men. Normally the chromosomal status of patients is detected by karyotyping of up to 20 metaphase spreads of lymphocyte nuclei, whereby low grade mosaicism may be overlooked. To test whether Klinefelter patients with 47,XXY karyotype or infertile men with 46,XY karyotype represent gonosomal mosaicisms, we performed meta- and interphase fluorescence in situ hybridization (FISH) on 45 men. METHODS AND RESULTS: A total of 400 interphase and 40 metaphase lymphocyte nuclei per patient were scored after hybridization with DNA probes specific for chromosomes X and Y, and chromosome 9 as a control. On the basis of conventional karyotype, hormone levels and clinical appearance, patients were subdivided into 18 Klinefelter syndrome patients with 47,XXY (group I), 11 Klinefelter syndrome-like patients with normal karyotype, 46,XY (group II) and six non-Klinefelter-like infertile patients with normal 46,XY karyotype (group III). Ten normal men (group IV) served as controls. Testicular volume in the Klinefelter group I was smaller compared with group II (P = 0.016), group III (P < 0.001) and group IV (P < 0.001). In addition, testicular volumes in group II were lower compared with group III and group IV (P < 0.004). No significant differences between the aneuploidy rate analysed by FISH in interphase nuclei and metaphases were found in either single patients or groups. Patients with Klinefelter syndrome, 47,XXY (group I) or with symptoms similar to those in Klinefelter patients 46,XY (group II) showed a similar aneuploidy rate (group I 7.1 +/- 4.0% and group II 4.6 +/- 3.4%) and two 47,XXY patients with a high prevalence for normal 46,XY lymphocytes had sperm in their ejaculate. However, in general, no correlations between FISH mosaic status and serum hormone parameters, nor with ejaculate parameters were found. CONCLUSIONS: The results suggest that 47,XXY patients with an increased incidence of XY cells (average of 4.2 +/- 2.3) may have a higher probability of germ cells as we found sperm only in the ejaculate of Klinefelter syndrome patients with mosaic 46,XY cells (6.0 and 7.0%). On the other hand, 46,XY patients with mosaic sex chromosome aneuploidies detected by FISH analysis more often show symptoms of hypogonadism phenotypically resembling Klinefelter syndrome.

Adult↗
PubMed2005

Preimplantation genetic screening reveals a high incidence of aneuploidy and mosaicism in embryos from young women undergoing IVF.

BACKGROUND: In order to assess the frequency of aneuploidy and mosaicism in embryos obtained from IVF patients aged <38 years, preimplantation genetic screening (PGS) was performed after biopsy of two blastomeres. Furthermore, the reliability of this diagnosis was assessed by performing reanalysis of the embryo on day 5. METHOD: The copy numbers of 10 chromosomes (1, 7, 13, 15, 16, 18, 21, 22, X and Y) were investigated by fluorescence in situ hybridization (FISH) analysis. Embryos that were found to be abnormal or of insufficient morphological quality were cultured until day 5 and reanalysed. Results obtained were compared to the day 3 blastomere analysis. RESULTS: After analysis of 196 embryos (one cell in 38% and two cells in 62%), only 36% of the embryos were found to be normal on day 3. After analysis of two blastomeres, 50% showed chromosomal mosaicism. Comparison of the FISH results from day 3 blastomeres and day 5 embryos yielded an overall cytogenetic confirmation rate of 54%. CONCLUSIONS: The rates of mosaicism and aneuploidy in these embryos from young IVF patients are similar to those published for older women. We found the best confirmation rate after a diagnosis based on two cells, where both blastomeres showed the same chromosomal abnormality. In contrast, after a mosaic diagnosis the confirmation rate was low. The present study provides the first detailed reanalysis data of embryos analysed by PGS and clearly demonstrates the impact of mosaicism on the reliability of the PGS diagnosis.

Adult↗
PubMedDate not supplied

Mosaic male honey bees produced by queens inseminated with frozen spermatozoa.

Mosaic male honey bees were found as the progeny of queens that had been inseminated with spermatozoa stored in liquid nitrogen. The origins of these mosaics and the genotype of their gametes were determined by using mutant markers. The mosaics probably developed from an egg pronucleus and a sperm pronucleus that did not unite after the latter had entered the egg. Instead, both pronuclei produced haploid tissue independently. The three mosaics that were mated to queens all had mosaic testes. Therefore, these were situations in which a male honey bee produced two types of spermatozoa.

Animals↗
PubMed1979

No evidence for chromosomal mosaicism in multiple tissues of 10 patients with 45, XO Turner syndrome.

Why the frequency of spontaneous abortions among monosomy X conceptuses is 98% while the postnatal course of Turner syndrome is relatively benign has not been understood. One explanation could be that mosaicism for a euploid cell line confers viability and that those 2% of 45,XO zygotes surviving in utero have some degree of mosaicism. We thus reasoned that if the non-mosaic 45,XO karyotype is lethal, a thorough study of living Turner syndrome patients might reveal a much higher frequency of mosaicism than the 30--40% reported. Ten adult women with a 45,XO leukocyte karyotype were investigated, looking at five tissue types from all three germ layers: buccal mucosa and hair from ectoderm, urinary epithelium from endoderm and ectoderm, and lymphocytes and skin fibroblasts from mesoderm. We were unable to confirm mosaicism in these patients, although in 2 out of 10 there was the suggestion of a small percentage of euploid cells in skin and blood karyotypes.

Abortion, Spontaneous↗
PubMed1991

Pigmentary dysplasias in long survivors with mosaic trisomy 18: report of two cases.

We describe two patients, a 19-year-old girl and a 19-year-old boy, with mosaic trisomy 18 and pigmentary dysplasias. Both patients had profound growth and mental retardation, marked kyphoscoliosis, bushy eyebrows, bulbous nose, simple ears, and joint contractures - clinical manifestations of long survivors with mosaic or non-mosaic trisomy 18. In addition, the boy showed total asymmetry. Pigmentary dysplasias of the skin with hypopigmented whorls and streaks, initially absent or overlooked at the ages 2 and 15 years, were detected on close examination. It is advisable to check closely every long survivor with mosaic or purportedly non-mosaic trisomy 18 for pigmentary dysplasias.

Abnormalities, Multiple↗
PubMed1993

Low frequency mosaicism of normal cells in a 16-year-old girl with trisomy 18.

A 16-year-old girl with mosaicism of trisomy 18 has been followed from birth in our department. She had stigmata characteristic for trisomy 18. Chromosome analysis of lymphocytes showed trisomy 18 both at birth and at age 15, whereas analysis of fibroblasts at age 16 showed trisomy 18 with low frequency mosaicism of normal cells (4%). In most case reports, karyotype analyses have been performed in lymphocytes only. The low frequency mosaicism of normal cells found in fibroblasts from the present patient may raise the question of mosaicism in other long-living patients previously reported to be non-mosaic trisomy 18. The main disorders in the present patient were limited to severe mental deficiency, structural cerebral malformations and skeletal deformities, including bilateral equinovarus deformities. At birth, she had a ventricular septal defect which closed spontaneously. Frequent respiratory infections subsided after age 2. At age 7 she developed a seizure disorder. Since then, her medical condition has been stable. Even though patients with trisomy 18 rarely survive early childhood, the possibility that they may reach their teens must be kept in mind when treatment is planned. In our case, the decision not to treat her equinovarus deformities means that she cannot stand, a major problem in her everyday life.

Abnormalities, Multiple↗
PubMed1999

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

Child↗
PubMed2006

Discrepancies in cytogenetic results between amniocytes and postnatally obtained blood: trisomy 9 mosaicism.

When amniocentesis reveals a mosaic karyotype and the baby presents with multiple malformations, an analysis of the baby's peripheral blood typically reveals a mosaic karyotype. We present a boy who was prenatally diagnosed by amniocentesis as having trisomy 9 mosaicisim but who had normal G-banding results on postnatal blood karyotyping; the patient also exhibited multiple malformations, including a diaphragmatic hernia, arthrogryposis, undescended testes, and characteristic facies. Because of the discrepancy between the phenotype and karyotype, we repeated the chromosomal studies on multiple occasions. Interphase FISH performed on abdominal wall muscle tissue revealed a mosaic trisomy 9 karyotype: 47,XY, + 9(159)/46,XY (19). Based on these findings, we finally diagnosed the patient as having trisomy 9 mosaicism and counseled the parents that the risk of recurrence was low. We conclude that it is important to be aware of the possibility that the patient can have a normal postnatal blood karyotype and an abnormal phenotype with multiple malformations when trisomy 9 mosaicism is detected prenatally. When the baby's phenotype is abnormal, karyotyping on multiple tissues is useful for confirming clinical impression as well as determining the prognosis and providing accurate genetic counseling.

Amniocentesis↗
PubMed1997

Anterior segment dysgenesis in mosaic Turner syndrome.

AIMS/BACKGROUND: Females with Turner syndrome commonly exhibit ophthalmological abnormalities, although there is little information in the literature documenting findings specific to Turner syndrome mosaics. Ophthalmic findings are described in four patients with mosaic Turner syndrome. All had anterior chamber abnormalities and all four had karyotypic abnormalities with a 45, X cell line. The possible relation between the karyotypic and the phenotypic findings in these patients is discussed. METHODS: Four girls with mosaic Turner syndrome underwent a full ophthalmological assessment, including examination under anaesthesia where indicated. RESULTS: Three of the four patients presented with congenital glaucoma. Two had the karyotype 45, X/46, X, idic(Y) and one a 45, X/47, XXX karyotype. The remaining child had a Rieger malformation of the iris and the karyotype 45, X/46, X, r(X). CONCLUSIONS: These findings suggest that Turner syndrome mosaicism (where there are two abnormal cell lines) is associated with anterior segment dysgenesis. The findings in these four patients are compared with those seen in other mosaic phenotypes and it is postulated that the presence of two or more genetically different cell lines may have an adverse effect on anterior segment development.

Anterior Chamber↗
PubMed1993

Mosaicism for duplication 12q (12q13-->q24.2) in a dysmorphic male infant.

We report the clinical findings in a boy with mosaicism for a duplication of chromosome 12q13.1-->q24.2. His clinical characteristics are very similar to previously reported mosaic duplications of the distal long arm of 12, as well as several cases with non-mosaic duplications. It is proposed that this represents a clinically distinguishable syndrome for 12q duplication, in mosaic or non-mosaic form.

Abnormalities, Multiple↗
PubMed1993

Epidermal mosaicism and Blaschko's lines.

To test the hypothesis that epidermal rather than dermal mosaicism determines Blaschko's lines in hypomelanosis of Ito (HI), we studied the distribution of chromosomal mosaicism in four patients. In two, mosaicism had not been detected in lymphocytes or dermal fibroblasts, but was clearly shown in epidermal keratinocytes; furthermore, the abnormal cell line was confirmed to the hypopigmented epidermis and the normal epidermis contained only normal cells. Negative findings in the other two patients might be because of mosaicism which was undetected either because it was submicroscopic or because it was present in melanocytes, which have not yet been studied. These preliminary results support the ideas that (1) Blaschko's lines represent single clones of epidermal cells; (2) in patients with HI and severe neurological involvement mosaicism, if detectable, is best shown in keratinocytes; and (3) the cytogenetic defect in epidermal cells may be directly responsible for the failure of pigmentation in HI.

Adolescent↗
PubMed1995

Inheritance of CMT1A duplication from a mosaic father.

We describe a case with molecular duplication of chromosome 17 (p11.2-p12) whose duplicated chromosome was inherited from a mosaic father. The patient has clinical manifestations consistent with Charcot-Marie-Tooth disease type 1A (CMT1A), while the mosaic father has minimal findings of CMT1A. The father was found to be homozygous with DNA markers VAW409R3A (D17S122) and p132G8RI (PMP-22) which are duplicated in CMT1A cases. Fluorescence in situ hybridisation (FISH) analysis with YAC clone 49H7 confirmed the duplication in the affected patient and diagnosed the mosaicism in his father. These findings based on clinical diagnosis and FISH analysis suggest that the mosaicism may have occurred early in embryogenesis leading to the disease in the father. This is the only reported case of CMT1A with transmission from a mildly affected mosaic father.

Blotting, Southern↗