SEARCH · Search PubMed

Results for “Genome Stability”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 505 records · Page 28Linked to original sources

PubMed1997

Properties of intraepithelial neoplasia relevant to the development of cancer chemopreventive agents.

Cancer chemoprevention is concerned with the development of drugs or diet supplements that will avert the onset or stop the progression of the intraepithelial neoplasia which precedes invasive cancer. Two basic processes underlie the onset and development of intraepithelial neoplasia. First is genomic instability (often associated with chronic diffuse epithelial hyperplasia), which is the increased production of genomic structural variants due to unrepaired DNA breaks with secondary formation of abnormal structures, including "mutator" mutations in genes responsible for genomic stability, gene copy amplification or loss from DNA breakage-fusion-anaphase bridge cycles, unequal sister chromatid exchange, and accumulation of double minutes. Second is the development within an epithelium having genomic instability of multicentric neoplastic lesions that independently progress through each of the following processes at a continuously accelerating rate: clonal evolution, hyperproliferation, production of genomic structural variants, and apoptosis. Recommended chemoprevention strategies based on these mechanisms are (1) early diagnosis and treatment of genomic instability before the appearance of intraepithelial neoplasia, i.e., during the "predysplastic" or "premorphologic" phase, (2) development of multiple agents that block intralesional proliferation at steps along the "command" pathways of mitotic signal transduction and along the "execute" pathways of synthesis of daughter cell components, (3) development of nontoxic antiinflammatory agents, antioxidants, antimutagens, and proapoptotics, (4) avoidance of "clonal escape" through use of drug combinations, and (5) use of computer-assisted quantitative image analysis to assay modulation of surrogate endpoints in chemoprevention clinical trials.

Carcinoma in Situ↗

PubMed2007

Cdc42 GTPase-activating protein deficiency promotes genomic instability and premature aging-like phenotypes.

Cdc42 is a member of the Rho GTPase family known to regulate cell actin cytoskeleton organization, polarity, and growth, but its function in mammalian organismal physiology remains unclear. We found that natural aging of WT mice is marked with increased Cdc42 activity in various tissues. Among the negative regulators of Cdc42, gene targeting of Cdc42 GTPase-activating protein (Cdc42GAP) results in constitutively elevated Cdc42-GTP level in diverse tissues of adult mice; significantly shortened life span of the animals; and multiple premature aging-like phenotypes, including a reduction in body mass, a loss of subdermal adipose tissue, severe lordokyphosis, muscle atrophy, osteoporosis, and reduction of reepithelialization ability in wound-healing. Cdc42GAP-/- mouse embryonic fibroblasts and/or tissues display reduced population doubling, significantly dampened DNA damage repair activity after DNA-damaging agent treatment, accumulated genomic abnormalities, and induction of p53, p16Ink4a, p21Cip1, and senescence-associated beta-galactosidase expressions. Furthermore, Cdc42 activation is sufficient to promote a premature cellular senescence phenotype that depends on p53. These results suggest a role of Cdc42 activity in regulating mammalian genomic stability and aging-related physiology.

Aging, Premature↗

PubMed2002

Protecting genomic integrity during DNA replication: correlation between Werner's and Bloom's syndrome gene products and the MRE11 complex.

DNA replication is a critical step for cells because of the propensity of replication forks to stall, as a consequence either of endogenous DNA damage or of the propensity of repeated sequences to form tertiary structures, which can impede fork progression. Moreover, as a result of stalled replication fork processing, potentially lethal and recombinogenic double-strand breaks can be formed. Thus cells (in particular human cells) have evolved a sophisticated network to deal with replication fork stall. Recently, WRN and BLM, two helicases mutated in the genetic hereditary conditions Werner and Bloom syndromes, appeared crucial for the correct recovery from replication arrest; however, it seems that other proteins assist them in this role. One of the possible partners is the MRE11 complex, which is found mutated in two other genetic instability syndromes: Nijmegen breakage syndrome and ataxia telangiectasia-like disorder. This strongly supports the idea of a central role of preventing crisis during DNA replication for the maintenance of genomic stability and integrity in human cells.

Adenosine Triphosphatases↗

PubMed2003

PML colocalizes with and stabilizes the DNA damage response protein TopBP1.

The PML tumor suppressor gene is consistently disrupted by t(15;17) in patients with acute promyelocytic leukemia. Promyelocytic leukemia protein (PML) is a multifunctional protein that plays essential roles in cell growth regulation, apoptosis, transcriptional regulation, and genome stability. Our study here shows that PML colocalizes and associates in vivo with the DNA damage response protein TopBP1 in response to ionizing radiation (IR). Both PML and TopBP1 colocalized with the IR-induced bromodeoxyuridine single-stranded DNA foci. PML and TopBP1 also colocalized with Rad50, Brca1, ATM, Rad9, and BLM. IR and interferon (IFN) coinduce the expression levels of both TopBP1 and PML. In PML-deficient NB4 cells, TopBP1 was unable to form IR-induced foci. All-trans-retinoic acid induced reorganization of the PML nuclear body (NB) and reappearance of the IR-induced TopBP1 foci. Inhibition of PML expression by siRNA is associated with a significant decreased in TopBP1 expression. Furthermore, PML-deficient cells express a low level of TopBP1, and its expression cannot be induced by IR or IFN. Adenovirus-mediated overexpression of PML in PML(-/-) mouse embryo fibroblasts substantially increased TopBP1 expression, which colocalized with the PML NBs. These studies demonstrated a mechanism of PML-dependent expression of TopBP1. PML overexpression induced TopBP1 protein but not the mRNA expression. Pulse-chase labeling analysis demonstrated that PML overexpression stabilized the TopBP1 protein, suggesting that PML plays a role in regulating the stability of TopBP1 in response to IR. Together, our findings demonstrate that PML regulates TopBP1 functions by association and stabilization of the protein in response to IR-induced DNA damage.

Adenoviridae↗

PubMed2006

The role of the nonhomologous end-joining DNA double-strand break repair pathway in telomere biology.

Double-strand breaks are a cataclysmic threat to genome integrity. In higher eukaryotes the predominant recourse is the nonhomologous end-joining (NHEJ) double-strand break repair pathway. NHEJ is a versatile mechanism employing the Ku heterodimer, ligase IV/XRCC4 and a host of other proteins that juxtapose two free DNA ends for ligation. A critical function of telomeres is their ability to distinguish the ends of linear chromosomes from double-strand breaks, and avoid NHEJ. Telomeres accomplish this feat by forming a unique higher order nucleoprotein structure. Paradoxically, key components of NHEJ associate with normal telomeres and are required for proper length regulation and end protection. Here we review the biochemical mechanism of NHEJ in double-strand break repair, and in the response to dysfunctional telomeres. We discuss the ways in which NHEJ proteins contribute to telomere biology, and highlight how the NHEJ machinery and the telomere complex are evolving to maintain genome stability.

Animals↗

PubMed2003

Small molecule modulation of the human chromatid decatenation checkpoint.

After chromosome replication, the intertwined sister chromatids are disentangled by topoisomerases. The integrity of this process is monitored by the chromatid decatenation checkpoint. Here, we describe small molecule modulators of the human chromatid decatenation checkpoint identified using a cell-based, chemical genetic modifier screen. Similar to 1,2,7-trimethylyxanthine (caffeine), these small molecules suppress the G(2)-phase arrest caused by ICRF-193, a small molecule inhibitor of the enzymatic activity of topoisomerase II. Analysis of specific suppressors, here named suptopins for suppressor of Topoisomerase II inhibition, revealed distinct effects on cell cycle progression, microtubule stability, nucleocytoplasmic transport of cyclin B1, and no effect on the chromatin deacetylation checkpoint induced by trichostatin A. The suptopins provide new molecular tools for dissecting the role of topoisomerases in maintaining genomic stability and determining whether inhibiting the chromatid decatenation checkpoint sensitizes tumor cells to chemotherapeutics.

Acetylation↗

PubMed2005

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

Acidianus↗

PubMed2002

Defending genome integrity during S-phase: putative roles for RecQ helicases and topoisomerase III.

The maintenance of genome stability is important not only for cell viability, but also for the suppression of neoplastic transformation in higher eukaryotes. It has long been recognised that a common feature of cancer cells is genomic instability. Although the so-called three 'Rs' of genome maintenance, DNA replication, recombination and repair, have historically been studied in isolation, a wealth of recent evidence indicates that these processes are intimately interrelated and interdependent. In this article, we will focus on challenges to the maintenance of genome integrity that arise during the S-phase of the cell cycle, and the possible roles that RecQ helicases and topoisomerase III play in the maintenance of genome integrity during the process of DNA replication.

Adenosine Triphosphatases↗

PubMedDate not supplied

Stable karyotypes in epithelial cancer cell lines despite high rates of ongoing structural and numerical chromosomal instability.

Most human tumors and tumor cell lines exhibit numerical and structural chromosomal abnormalities. The goal of this study was to determine the ongoing rates of structural and numerical instability in selected cancer cell lines and to investigate the consequences of these rates to karyotypic progression. We studied two colorectal (HCT-116 and HT-29) and two ovarian (SKOV-3 and OVCAR-8) cancer cell lines and their single cell subclones. We found that the signature karyotypes of all four cell lines were distinct and each aberrant. Whereas high rates of ongoing structural and/ or numerical chromosomal instability could be demonstrated in all cell lines, there was a relative stability of the consensus karyotype over many generations. No new clonal structural chromosomal reconfigurations emerged and the few numerical changes of karyotypes were restricted to abnormal chromosomes. This implies a kind of genomic optimization under the conditions of cell culture and suggests a link between genomic stabilization and cell propagation. We have been able to support this possibility by computer modeling. We did not observe a profound difference in the rates of numerical or structural instability in the cell lines with a replication error phenotype (RER+) versus the other cell lines.

Chromosome Aberrations↗

PubMed2006

Characterizing genetically stable and unstable gastric cancers by microsatellites and array comparative genomic hybridization.

Gastric cancer (GCA) displays a variety of genomic aberrations, including DNA copy number alterations, microsatellite instability (MSI), and loss of heterozygosity (LOH). The main aim of the present work was to determine the copy number aberrations in tumors with and without MSI or LOH. Fifteen fresh-frozen GCA samples, 11 of the intestinal and 4 of the diffuse type, were grouped by microsatellite analysis into high-level MSI (MSI-H, n = 2), LOH (n = 5), and microsatellite stable, LOH not detected (MSS/LOH-N, n = 8) tumors. The DNA samples were subsequently analyzed by array comparative genomic hybridization with 16,000 cDNA clones. As expected, the LOH tumors showed more copy number changes; however, the frequency of small-size amplifications was similar across all tumor groups. In addition, the cDNA arrays detected two apparently single-gene amplicons, at 11q13 (CCND1) and 12p12.1 (K-RAS), the presence of which were confirmed using oligonucleotide arrays. A novel amplicon at 5q13.2 was found only in diffuse-type tumors, which were otherwise genetically stable. The results suggest that DNA copy number changes may also occur in gastric cancers that show genomic stability in microsatellite analysis.

Aged↗

PubMedDate not supplied

Functional and evolutionary roles of long repeats in prokaryotes.

Most recently published complete bacterial genomes have revealed unexpectedly high numbers of long strict repeats. In this article we discuss the various functional and evolutionary roles of these repeats, focusing in particular on their role in terms of genome stability, gene transfer, and antigenic variation.

Antigenic Variation↗

PubMed2026

Biallelic loss of RB1 in hepatocellular carcinoma as synthetic lethal target for artificial intelligence-guided therapy.

The retinoblastoma (RB1) gene is a critical tumor suppressor that regulates cell cycle progression and genomic stability. Although RB1 alterations have been reported in hepatocellular carcinoma (HCC), the biological and clinical consequences of biallelic RB1 inactivation (RB1-Bi) remain poorly defined. We performed a comprehensive allele-specific genomic analysis of HCC patients from the TCGA-LIHC (n = 355) and in-house AMC (n = 206) cohorts, collectively comprising the AMC-TCGA discovery cohort. In this combined cohort, RB1-Bi was identified in 14.6% of tumors, was enriched in poorly differentiated HCCs and was independently associated with significantly reduced overall survival (adjusted hazard ratio 3.32, 95% CI 1.93-5.72, p < 0.001). Additionally, a deep learning-based histopathology model using hematoxylin and eosin-stained slides (i.e., FR-MIL model) accurately predicted RB1-Bi status (F1 score 84.39% [95% CI, ±0.02]), making it readily identifiable in routine clinical practice. The prevalence and prognostic impact of RB1-Bi, as well as FR-MIL model performance, were consistent across independent validation cohorts, including advanced-stage tumors and external institutions. High-throughput drug screening in isogenic HCC models revealed that RB1-Bi HCC cells were particularly sensitive to inhibitors targeting mitotic regulators (e.g., AURKA, PLK1, KSP) and DNA damage response pathways (e.g., PARP inhibitors). Synthetic lethal interactions between RB1-Bi and these compounds were demonstrated in vitro and in vivo, and combination treatment with mitotic and PARP inhibitors had synergistic effects with acceptable tolerability. We conclude that RB1-Bi represents a clinically actionable biomarker that identifies a high-risk HCC subtype with specific therapeutic vulnerabilities, offering new opportunities for precision medicine.

Humans↗

PubMed2004

Peroxiredoxin-null yeast cells are hypersensitive to oxidative stress and are genomically unstable.

Peroxiredoxins are a family of abundant peroxidases found in all organisms. Although these antioxidant enzymes are thought to be critically involved in cellular defense and redox signaling, their exact physiological roles are largely unknown. In this study, we took a genetic approach to address the functions of peroxiredoxins in budding yeast. We generated and characterized a yeast mutant lacking all five peroxiredoxins. The quintuple peroxiredoxin-null mutant was still viable, though the growth rate was lower under normal aerobic conditions. Although peroxiredoxins are not essential for cell viability, peroxiredoxin-null yeast cells were more susceptible to oxidative and nitrosative stress. In the complete absence of peroxiredoxins, the expression of other antioxidant proteins including glutathione peroxidase and glutathione reductase was induced. In addition, the quintuple mutant was hypersensitive to glutathione depletion. Thus, the glutathione system might cooperate with other antioxidant enzymes to compensate for peroxiredoxin deficiency. Interestingly, the peroxiredoxinnull yeast cells displayed an increased rate of spontaneous mutations that conferred resistance to canavanine. This mutator phenotype was rescued by yeast peroxiredoxin Tsa1p, but not by its active-site mutant defective for peroxidase activity. Our findings suggest that the antioxidant function of peroxiredoxins is important for maintaining genome stability in eukaryotic cells.

Gene Deletion↗

PubMed2005

Evolutionary diversification of DNA methyltransferases in eukaryotic genomes.

In eukaryotes, C5-cytosine methylation is a common mechanism associated with a variety of functions such as gene regulation or control of genomic stability. Different subfamilies of eukaryotic methyltransferases (MTases) have been identified, mainly in metazoa, plants, and fungi. In this paper, we used hidden Markov models to detect MTases in completed or almost completed eukaryotic genomes, including different species of Protozoa. A phylogenetic analysis of MTases enabled us to define six subfamilies of MTases, including two new subfamilies. The dnmt1 subfamily that includes all the known MTases with a maintenance activity seems to be absent in the Protozoa. The dnmt2 subfamily seems to be the most widespread, being present even in the nonmethylated Dictyostelium discoideum. We also found two dnmt2 members in the bacterial genus Geobacter, suggesting that horizontal transfers of MTases occurred between eukaryotes and prokaryotes. Even if the direction of transfer cannot be determined, this relationship might be useful for understanding the function of this enigmatic subfamily of MTases. Globally, our analysis reveals a great diversity of MTases in eukaryotes, suggesting the existence of different methylation systems. Our results also suggest acquisitions and losses of different MTases in every eukaryotic lineage studied and that some eukaryotes appear to be devoid of methylation.

DNA Modification Methylases↗

PubMed2025

Recent Non-LTR Retrotransposon Activity Predicts Cancer Prevalence in Mammals.

Non-long terminal repeat retrotransposons (nLTRs), including long and short interspersed nuclear elements (L1 and SINEs), are the most abundant and active mobile elements in mammals. NLTRs play critical mutagenic and regulatory roles during oncogenesis in humans and model species. However, it is not known whether recent nLTR activity in the genome is related to the lifetime cancer risk of a species beyond humans and conventional model organisms. We examined whether recent nLTR activity predicts cancer prevalence across mammals using comparative analyses of de novo whole-genome repeat annotations from 55 species, each with over 20 published zoo pathology records. We quantified nLTR activity as the number of potentially active elements, their proximity to protein-coding genes and cancer gene orthologs (CGOs), and insertions within these genes. Across all three metrics, neoplasia prevalence was associated with both L1 and combined L1-SINE activity, while malignancy was linked exclusively to the L1-SINE predictors. This pattern suggests a complementary and escalating trajectory, where L1s contribute to early tumorigenic events, while SINE activity, driven by L1s, amplifies their impact and fuels the transition to malignancy. Moreover, genomes harboring more CGOs tended to exhibit higher neoplasia prevalence, and the number of fusion cancer genes was strongly correlated with the number of potentially active L1s across species. Our results further revealed a pattern wherein species with minimal cancer prevalence exhibit restricted activity of at least one major nLTR superfamily, suggesting that preserving genome stability through limited retrotransposition may serve as a protective mechanism against cancer.

Cancer Genes↗

PubMed1994

Efficient subtyping of pathogenic Yersinia enterocolitica strains by pulsed-field gel electrophoresis.

Yersinia enterocolitica is an enteropathogen that has recently and rapidly expanded over the world. There is a close correlation between the biotypes, serotypes, and phage types of the strains, making it virtually impossible to distinguish isolates of the same serotype with the classical phenotypic markers. In the present study, pulsed-field gel electrophoresis (PFGE) was used to compare the NotI genomic profile (i.e., pulsotype) of 20 strains each of serotypes O:3, O:9, and O:5. Eleven, 12, and 18 different pulsotypes were obtained, respectively, indicating that this technique is very efficient for subtyping pathogenic isolates of Y. enterocolitica. Within strains of serotype O:5, PFGE differentiated two subgroups that corresponded to two biotypes (biotypes 1A and 3). Comparison of the pulsotypes of three strains of biotype 3 and serotype O:3 (referred to as 3/O:3) with those of strains 4/O:3 and 3/O:5 suggested that the pulsotype is closer to the biotype than to the serotype. The pulsotypes of five pairs of strains isolated from the same patient or siblings were also analyzed. In four pairs, the two strains displayed identical pulsotypes, indicating that PFGE might be a powerful epidemiological tool. In the fifth pair, one restriction fragment differed, suggesting that genomic polymorphism may occur in vivo in Y. enterocolitica. Finally, the in vitro genomic stabilities of one strain each of Y. enterocolitica O:3, O:9, and O:5 were investigated. The pulsotypes of 10 isolated colonies were identical within each strain, indicating that in vitro, the genome of Y. enterocolitica is much more stable than that of Y. pestis.

Bacterial Typing Techniques↗

PubMed2007

Cell cycle inhibitor, p19INK4d, promotes cell survival and decreases chromosomal aberrations after genotoxic insult due to enhanced DNA repair.

Genome integrity and cell proliferation and survival are regulated by an intricate network of pathways that includes cell cycle checkpoints, DNA repair and recombination, and programmed cell death. It makes sense that there should be a coordinated regulation of these different processes, but the components of such mechanisms remain unknown. In this report, we demonstrate that p19INK4d expression enhances cell survival under genotoxic conditions. By using p19INK4d-overexpressing clones, we demonstrated that p19INK4d expression correlates with the cellular resistance to UV treatment with increased DNA repair activity against UV-induced lesions. On the contrary, cells transfected with p19INK4d antisense cDNA show reduced ability to repair DNA damage and increased sensitivity to genotoxic insult when compared with their p19INK4d-overexpressing counterparts. Consistent with these findings, our studies also show that p19INK4d-overexpressing cells present not only a minor accumulation of UV-induced chromosomal aberrations but a lower frequency of spontaneous chromosome abnormalities than p19INK4d-antisense cells. Lastly, we suggest that p19INK4d effects are dissociated from its role as CDK4/6 inhibitor. The results presented herein support a crucial role for p19INK4d in regulating genomic stability and overall cell viability under conditions of genotoxic stress. We propose that p19INK4d would belong to a protein network that would integrate DNA repair, apoptotic and checkpoint mechanisms in order to maintain the genomic integrity.

Animals↗

PubMed2002

50 million years of genomic stasis in endosymbiotic bacteria.

Comparison of two fully sequenced genomes of Buchnera aphidicola, the obligate endosymbionts of aphids, reveals the most extreme genome stability to date: no chromosome rearrangements or gene acquisitions have occurred in the past 50 to 70 million years, despite substantial sequence evolution and the inactivation and loss of individual genes. In contrast, the genomes of their closest free-living relatives, Escherichia coli and Salmonella spp., are more than 2000-fold more labile in content and gene order. The genomic stasis of B. aphidicola, likely attributable to the loss of phages, repeated sequences, and recA, indicates that B. aphidicola is no longer a source of ecological innovation for its hosts.

Animals↗