Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “small RNA”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 487 records · Page 27Linked to original sources
PubMed2003

Characterization of the small subgenomic RNA of Soybean dwarf virus.

We have characterized a small subgenomic RNA of Japanese strains of Soybean dwarf virus (SbDV). Northern blot analyses of SbDV-infected plants showed that the small RNA contained the 3' terminal sequence of the genome and was detected in four typical Japanese SbDV strains, YS, YP, DS and DP. In the case of SbDV-DS, the RNA was 220 nucleotides in length and was transcribed from the 3' terminal region of the genome. This RNA appeared at a similar time to genomic RNA and a large sgRNA, and thereafter persisted in the infected plant. Since no conserved open reading frame (ORF) among the strains was postulated in the 3' terminal region, the small subgenomic RNA may have some regulatory roles in SbDV infections.

Luteovirus↗
PubMed2000

The 3' UTR of human MnSOD mRNA hybridizes to a small cytoplasmic RNA and inhibits gene expression.

Human MnSOD localizes to the mitochondria and plays a key protective role by detoxifying oxygen free radicals. The MnSOD mRNA 3' UTR contains a 280-bp region (Alu-like element or Alu-E) that shows high homology to human Alu and 7SL sequences. MnSOD 3' UTR probes hybridize to a specific cytoplasmic RNA species of approximately 300 nucleotides. This antisense RNA is most likely 7SL RNA based on its size, ubiquitousness, high levels, and lack of inducibility. Hybridization of this small RNA to the MnSOD 3' UTR may modulate posttranscriptional MnSOD gene expression. This regulation could occur by several means including inhibition of translation and mRNA destabilization. Regulation at the level of translational initiation does not seem to occur as MnSOD mRNA containing the Alu-E is efficiently bound by ribosomes. To test the role of the MnSOD 3' UTR, and in particular the Alu-E in gene expression, luciferase reporter gene constructs were made containing various regions of the MnSOD 3' UTR including the Alu-E. These constructs were transfected into human A549 lung carcinoma cells and luciferase activity was measured. Reporter constructs containing the MnSOD 3' UTR and the Alu-E repress luciferase activity. Taken together, these results suggest that naturally occurring antisense RNA may bind MnSOD mRNA and repress its expression. These results also suggest that other mRNAs containing Alu elements may be similarly repressed.

3' Untranslated Regions↗
PubMed1988

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA).

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.

Animals↗
PubMed1991

Phylogeny of capsid proteins of small icosahedral RNA plant viruses.

Statistically significant alignment was generated between the amino acid sequences of the (putative) shell (S) domains of the capsid proteins of small RNA plant viruses with icosahedral capsids in the tombusvirus, carmovirus, dianthovirus, sobemovirus and luteovirus groups. Inspection of the alignment showed good correspondence between the experimentally defined beta-strands and alpha-helices of the capsid proteins of tomato bushy stunt, southern bean mosaic and turnip crinkle viruses, allowing prediction of the secondary structure elements in proteins with unresolved tertiary structure. It is concluded that this set of viral capsid proteins forms a tight evolutionary cluster. Comparison of the alignment of the proteins of this family with the sequences of other capsid proteins of icosahedral RNA viruses revealed more distant similarities to the satellites of tobacco necrosis, panicum mosaic, tobacco mosaic and maize white line mosaic viruses, as well as to nepo- and comoviruses. The tentative phylogenetic tree derived from the capsid protein alignment separated into three main lineages: (I) carmo-, tombus- and dianthoviruses, (II) southern bean mosaic, tobacco necrosis and maize chlorotic mottle viruses, and (III) luteoviruses. Comparison of this tree topology with the tentative evolutionary schemes for the respective virus RNA-dependent RNA polymerases suggested that gene shuffling is the universal trend in the evolution of small RNA plant virus genomes.

Amino Acid Sequence↗
PubMed2006

Therapeutic RNA interference of malignant melanoma by electrotransfer of small interfering RNA targeting Mitf.

Microphthalmia-associated transcription factor (Mitf) is critically involved in melanin synthesis as well as differentiation of cells of the melanocytic lineage. Some earlier studies suggested that Mitf is also essential in the survival of melanoma cells, but this notion remains controversial. We synthesized short interfering RNA (siRNA) duplexes corresponding to the mitf sequence and transfected them into B16 melanoma. Lipid-mediated transfection in vitro of Mitf-specific siRNA resulted in specific downregulation of Mitf and of the tyrosinase that is a transcriptional target of Mitf. This treatment also remarkably reduced the viability of melanoma cells by inducing apoptosis. To examine the potential feasibility of RNAi therapy against melanoma, B16 cells were subcutaneously injected into syngenic mice and siRNA was transfected into the pre-established tumor by means of electroporation. The Mitf-specific siRNA drastically reduced outgrowth of subcutaneous melanoma, while nonspecific siRNA failed to affect tumor progression. Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling-based analysis of tumor specimens demonstrated that the tumor cells transfected with Mitf-siRNA effectively underwent apoptosis in vivo. The present results indicate that Mitf plays important roles in melanoma survival. Intratumor electrotransfer of Mitf-specific siRNA may provide a powerful strategy for therapeutic intervention of malignant melanoma.

Animals↗
PubMed1985

Nuclease S1-sensitive sites in multigene families: human U2 small nuclear RNA genes.

We show here that human U2 small nuclear RNA genes contain a 'strong nuclease S1 cleavage site' (SNS1 site), a sequence that is very sensitive to digestion by nuclease S1. This site is located 0.50-0.65 kb downstream of the U2 RNA coding region. It comprises a 0.15-kb region in which (dC-dT)n:(dA-dG)n co-polymeric stretches represent greater than 90% of the sequence. Nuclease S1 is able to excise unit length repeats of the human U2 RNA genes both from cloned fragments and total human genomic DNA. The precise locations of the cleavage sites are dependent on the superhelicity of the substrate DNA. In negatively supercoiled substrates, cleavages are distributed over the entire 0.15-kb region, but in linearized substrates, they occur within a more limited region, mainly at the boundary of the SNS1 site closest to the human U2 RNA coding region. Nuclease S1 cleavage of negatively supercoiled substrates occurs at pHs as high as 7.0; in contrast, cleavage of linearized substrates requires a pH less than 5.0, indicating that supercoiling contributes to the sensitivity of this site. Mung bean nuclease gives results similar to that observed with nuclease S1.

Base Sequence↗
PubMed1956

Small granules in the amphibian oocyte nucleus and their relationship to RNA.

Small particles (100 to 300 A in diameter) are seen in sections of nucleoli, the loops of the amphibian lampbrush chromosomes, and the Balbiani-ring regions of dipteran salivary-gland chromosomes. All of these structures contain cytochemically demonstrable RNA. Furthermore, the annuli seen on the nuclear envelope are composed of small particles which are similar to or identical with those commonly associated with the endoplasmic reticulum. It seems likely that ribonucleoproteins are organized as small particulates in the nucleus as well as in the cytoplasm.

Amphibians↗
PubMed1978

Small stable RNAs from Escherichia coli: evidence for the existence of new molecules and for a new ribonucleoprotein particle containing 6S RNA.

Small stable RNA molecules of Escherichia coli other than 5S (rRNA) and 4S (tRNA) were studied. Two of the molecules corresponded to 4.5S and 6S RNA, which have been reported previously. The third stable RNA molecule, 10S RNA, has not been described before. RNA labeled with (32)P(i) or [(14)C]uracil for a relatively long time, when separated in 5%/12% tandem polyacrylamide gels, displayed three bands corresponding to 10S, 6S, and 4.5S RNA in addition to rRNA and tRNA bands. These RNAs were stable in pulse-chase-labeling experiments. The amount of these RNAs was small, comprising only 0.2 to 0.5% of the total (32)P incorporation. However, this amount represented a large number of molecules; for 6S and 4.5S, it was about 1,000/DNA molecule. These three RNAs were found in the postribosomal supernatant fraction. None of them was found in purified nucleoid fractions in which the tightly coiled DNA molecules were contained. Of these three RNAs, 6S RNA was unique in that it seemed to exist in a ribonucleoprotein particle. All these RNAs, as well as tRNA, were very stable in the cell under various physiological conditions. 5S RNA was less stable. On the other hand, purified 6S RNA was more susceptible than tRNA to cell nucleases when incubated with cell extracts, suggesting that, being in a particle, it is protected from cell nucleases.

Electrophoresis, Polyacrylamide Gel↗
PubMed2005

Inhibition of hepatitis B virus surface antigen expression by small hairpin RNA in vitro.

AIM: To explore the anti-hepatitis B virus effect of RNA interference (RNAi) using small hairpin RNA (shRNA) expression vector. METHODS: Hepatitis B virus surface antigen green fluorescent protein (HBs-GFP) fusion vector and shRNA expression vectors were constructed and cotransfected transiently into HepG2 cells. mRNAs extracted from HepG2 cells were detected by real-time PCR. Fluorescence of HBs-GFP protein was detected by fluorescence-activated cell sorting (FACS). The effective shRNA expression vector was transfected into HepG2.2.15 cells. HBsAg and HBeAg in HepG2.2.15 cells were analyzed by radioimmunoassay (RIA) method. RESULTS: FACS revealed that shRNA targeting at HBsAg reduced the GFP signal by 56% compared to the control. Real-time PCR showed that HBs-GFP mRNA extracted from HepG2 cells cotransfected with pAVU6+27 and HBs-GFP expression plasmids decreased by 90% compared to the empty vector control. The expressions of HBsAg and HBeAg were also inhibited by 43% and 64%, respectively. CONCLUSION: RNAi using shRNA expression vector can inhibit the expression of HBsAg, providing a fresh approach to screening the efficient small interfering RNAs (siRNAs).

Carcinoma, Hepatocellular↗
PubMedDate not supplied

Small nucleolar RNA.

A growing list of small nucleolar RNAs (snoRNAs) has been characterized in eukaryotes. They are transcribed by RNA polymerase II or III; some snoRNAs are encoded in the introns of other genes. The nonintronic polymerase II transcribed snoRNAs receive a trimethylguanosine cap, probably in the nucleus, and move to the nucleolus. snoRNAs are complexed with proteins, sometimes including fibrillarin. Localization and maintenance in the nucleolus of some snoRNAs requires the presence of initial precursor rRNA (pre-rRNA). Many snoRNAs have conserved sequence boxes C and D and a 3' terminal stem; the role of these features are discussed. Functional assays done for a few snoRNAs indicate their roles in rRNA processing for cleavage of the external and internal transcribed spacers (ETS and ITS). U3 is the most abundant snoRNA and is needed for cleavage of ETS1 and ITS1; experimental results on U3 binding sites in pre-rRNA are reviewed. 18S rRNA production also needs U14, U22, and snR30 snoRNAs, whereas U8 snoRNA is needed for 5.8S and 28S rRNA production. Other snoRNAs that are complementary to 18S or 28S rRNA might act as chaperones to mediate RNA folding. Whether snoRNAs join together in a large rRNA processing complex (the "processome") is not yet clear. It has been hypothesized that such complexes could anchor the ends of loops in pre-rRNA containing 18S or 28S rRNA, thereby replacing base-paired stems found in pre-rRNA of prokaryotes.

Animals↗
PubMed2002

Transcription: surprising role for an elusive small nuclear RNA.

Since 7SK was discovered as an abundant small nuclear RNA in the mid-70s, its role has remained tantalizingly unsolved. Two recent studies have shown that 7SK acts as a negative regulator of the RNA polymerase II elongation factor P-TEFb, and that this activity is influenced by stress response pathways.

Animals↗
PubMed1999

Box H and box ACA are nucleolar localization elements of U17 small nucleolar RNA.

The nucleolar localization elements (NoLEs) of U17 small nucleolar RNA (snoRNA), which is essential for rRNA processing and belongs to the box H/ACA snoRNA family, were analyzed by fluorescence microscopy. Injection of mutant U17 transcripts into Xenopus laevis oocyte nuclei revealed that deletion of stems 1, 2, and 4 of U17 snoRNA reduced but did not prevent nucleolar localization. The deletion of stem 3 had no adverse effect. Therefore, the hairpins of the hairpin-hinge-hairpin-tail structure formed by these stems are not absolutely critical for nucleolar localization of U17, nor are sequences within stems 1, 3, and 4, which may tether U17 to the rRNA precursor by base pairing. In contrast, box H and box ACA are major NoLEs; their combined substitution or deletion abolished nucleolar localization of U17 snoRNA. Mutation of just box H or just the box ACA region alone did not fully abolish the nucleolar localization of U17. This indicates that the NoLEs of the box H/ACA snoRNA family function differently from the bipartite NoLEs (conserved boxes C and D) of box C/D snoRNAs, where mutation of either box alone prevents nucleolar localization.

Animals↗
PubMed1983

Structural analysis of gene loci for rat U1 small nuclear RNA.

Four phage clones which hybridize with U1 small nuclear RNA were obtained from a rat gene library. Two clones contain a presumed pseudogene. A third clone includes two gene candidates that are co-linear with the rat U1-RNA, 3.6kb apart and in the opposite orientation. The two genes are surrounded by identical sequences of 491bp upstream and 178bp downstream. The upstream sequences do not contain a TATA box, but share many block homologies with those for the human U1-RNA gene(1-3). A 101bp "identifier (ID) sequence", which was reported to be specifically expressed in rat brain (4), is inserted immediately after the shared sequence downstream of one of the genes. In the fourth clone, there are two putative pseudogenes, which have one or three nucleotide changes, 3kb apart and in the same orientation. Southern blot analysis of total rat DNA reveals about 50 U1-RNA genes/pseudogenes in the genome.

Animals↗
PubMed2003

Multiple, dispersed human U6 small nuclear RNA genes with varied transcriptional efficiencies.

Vertebrate U6 small nuclear RNA (snRNA) gene promoters are among the founding members of those recognized by RNA polymerase III in which all control elements for initiation are located in the 5'-flanking region. Previously, one human U6 gene (U6-1) has been studied extensively. We have identified a total of nine full-length U6 loci in the human genome. Unlike human U1 and U2 snRNA genes, most of the full-length U6 loci are dispersed throughout the genome. Of the nine full-length U6 loci, five are potentially active genes (U6-1, U6-2, U6-7, U6-8 and U6-9) since they are bound by TATA-binding protein and enriched in acetylated histone H4 in cultured human 293 cells. These five all contain OCT, SPH, PSE and TATA elements, although the sequences of these elements are variable. Furthermore, these five genes are transcribed to different extents in vitro or after transient transfection of human 293 cells. Of the nine full-length U6 loci, only U6-7 and U6-8 are closely linked and contain highly conserved 5'-flanking regions. However, due to a modest sequence difference in the proximal sequence elements for U6-7 and U6-8, these genes are transcribed at very different levels in transfected cells.

Acetylation↗
PubMed1998

The microsatellite sequence (CT)n x (GA)n promotes stable chromosomal integration of large tandem arrays of functional human U2 small nuclear RNA genes.

The multigene family encoding human U2 small nuclear RNA (snRNA) is organized as a single large tandem array containing 5 to 25 copies of a 6.1-kb repeat unit (the RNU2 locus). Remarkably, each of the repeat units within an individual U2 tandem array appears to be identical except for an irregular dinucleotide tract, known as the CT microsatellite, which exhibits minor length and sequence polymorphism. Using a somatic cell genetic assay, we previously noticed that the CT microsatellite appeared to stabilize artificial tandem arrays of U2 snRNA genes. We now demonstrate that the CT microsatellite is required to establish large tandem arrays of transcriptionally active U2 genes, increasing both the average and maximum size of the resulting arrays. In contrast, the CT microsatellite has no effect on the average or maximal size of artificial arrays containing transcriptionally inactive U2 genes that lack key promoter elements. Our data reinforce the connection between recombination and transcription. Active U2 transcription interferes with establishment or maintenance of the U2 tandem array, and the CT microsatellite opposes these effects, perhaps by binding GAGA or GAGA-related factors which alter local chromatin structure. We speculate that the mechanisms responsible for maintenance of tandem arrays containing active promoters may differ from those that maintain tandem arrays of transcriptionally inactive sequences.

Adenine↗
PubMed2005

Therapeutic EphA2 gene targeting in vivo using neutral liposomal small interfering RNA delivery.

Inducing destruction of specific mRNA using small interfering RNA (siRNA) is a powerful tool in analysis of protein function, but its use as a therapeutic modality has been limited by inefficient or impractical delivery systems. We have used siRNA incorporated into the neutral liposome 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) for efficient in vivo siRNA delivery. In nude mice bearing i.p. ovarian tumors, nonsilencing siRNA tagged with the fluorochrome Alexa 555 was encapsulated into DOPC liposomes and shown to be taken up by the tumor as well as many major organs. Furthermore, DOPC-encapsulated siRNA targeting the oncoprotein EphA2 was highly effective in reducing in vivo EphA2 expression 48 hours after a single dose as measured by both Western blot and immunohistochemistry. Therapy experiments in an orthotopic mouse model of ovarian cancer were initiated 1 week after injection of either HeyA8 or SKOV3ip1 cell lines. Three weeks of treatment with EphA2-targeting siRNA-DOPC (150 microg/kg twice weekly) reduced tumor growth when compared with a nonsilencing siRNA (SKOV3ip1: 0.35 versus 0.70 g; P = 0.020; HeyA8: 0.98 versus 1.51 g; P = 0.16). When EphA2-targeting siRNA-DOPC was combined with paclitaxel, tumor growth was dramatically reduced compared with treatment with paclitaxel and a nonsilencing siRNA (SKOV3ip1: 0.04 versus 0.22 g; P < 0.001; HeyA8: 0.21 versus 0.84 g; P = 0.0027). These studies show the feasibility of siRNA as a clinically applicable therapeutic modality.

Animals↗
PubMed2005

Growth inhibition of K562 cells by cyclin E gene-specific small interfering RNA.

OBJECTIVE: To study the inhibitory effect of small interference RNA(siRNA) of cyclin E gene on the growth of K562 cells. METHODS: siRNA targeting the 940 bp site of the cyclin E mRNA were designed and generated by PCR amplification. The PCR products containing U6 promoter and the siRNA were then transfected into K562 cells via Lipofectamine2000. The cells transfected with non-functional siRNA served as the negative control group and those only treated with serum-free RPMI1640 as the blank control group. Cell counting, reverse transcriptase (RT)-PCR and flow cytometry were employed to evaluate the effect of RNA interference. RESULTS: Compared with the negative and blank control groups, the viable cell count in the interference group was decreased by approximately 80%, the ratio of G(1)-phase cells increased by nearly 30%, and growth arrest was observed. Cyclin E mRNA expression in the cells of the interference group was significantly lowered by about 70%; as compared with that of the negative and blank control groups, whereas the latter two groups had similar expression levels. CONCLUSION: RNA interference induces obvious inhibition of cyclin E gene expression, which consequently affects the proliferation of K562 cells.

Cell Proliferation↗
PubMed1994

Purification of human U6 small nuclear RNA capping enzyme. Evidence for a common capping enzyme for gamma-monomethyl-capped small RNAs.

To understand the mechanism of gamma-monomethyl (meppp) cap formation, we attempted to identify and purify the U6 small nuclear RNA capping enzyme. Although more than one protein was cross-linked to U6, 7SK, B2, or plant U3 RNA, only one protein of approximately 130 kDa was common to all four meppp-capped RNAs; 5 S RNA, which is an uncapped RNA, was not cross-linked to this protein. In addition to specific cross-linking with meppp-capped RNAs, an approximately 130-kDa protein was also cross-linked to 3H-labeled AdoMet. We purified the capping enzyme from a HeLa cell S-100 extract by several successive chromatographic steps, and an approximately 130-kDa protein was purified along with the capping activity. The capping activity and the approximately 130-kDa protein also cosedimented on a glycerol gradient. The purified enzyme catalyzed meppp cap formation of U6, 7SK, B2, and plant U3 RNA, and this enzyme is probably responsible for the capping of multiple RNAs in vivo. The capping activity is distinct from U6 snRNA N6-adenosine methyltransferase, and this is the first methyltransferase to be purified that methylates gamma-phosphate residues in RNAs.

Catalysis↗