Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “MD simulation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 487 records · Page 27Linked to original sources
PubMed2002

A structure for the trimeric MHC class II-associated invariant chain transmembrane domain.

The major histocompatibility complex (MHC)-associated invariant chain (Ii) contains a single transmembrane domain that forms trimers. Ii is involved in the assembly of the MHC and antigen presentation, and is thus central to the function of the immune system. Here, we show by attenuated total reflectance, Fourier transform infrared (ATR-FTIR) spectroscopy that the transmembrane domain is alpha-helical and we provide a structural model of the transmembrane domain obtained by a combination of site-specific infrared dichroism and molecular dynamics (MD) simulations. This work resolves the backbone structure of a transmembrane peptide by multiple (13)C=(18)O labelling at ten different residues. A second purely computational approach, based on MD simulations of Ii transmembrane homologous sequences, yields a similar structure that is consistent with our experimental results. The structure presented forms a left-handed coiled coil with an average helix tilt of 13(+/-6) degrees; the residue Gln47 implicated in trimer formation forms strong interhelical contacts, Thr50 points to the inside of the trimeric coil and forms a network of hydrogen bonds.

Amino Acid Sequence↗
PubMed2006

The temperature dependence of salt-protein association is sequence specific.

Molecular dynamics (MD) simulations are used to probe the origin of the unexpected temperature dependence of salt accumulation in the C-terminal region of the protein human lymphotactin. As in previous MD simulations, sodium ions accumulate in an enhanced manner near the C-terminal helix at the lower temperature, while the temperature dependence of chloride accumulation is much weaker and slightly positive. In a designed mutant in which all positively charged residues in the C-terminal helix are replaced with neutral polar groups (Ser), the unexpected temperature dependence of the sodium ions is no longer observed. Therefore, these simulations convincingly verified the previous hypothesis that the temperature dependence of ion-protein association is sensitive to the local sequence. This is explained qualitatively in terms of the entropy of association between charged species in solution. These findings have general implications for the interpretation of thermodynamic quantities associated with binding events where ion release is important, such as protein-DNA interactions.

Amino Acid Sequence↗
PubMed2002

Regioselectivity of CYP2B6: homology modeling, molecular dynamics simulation, docking.

Human cytochrome P450 (CYP) 2B6 activates the anticancer prodrug cyclophosphamide (CPA) by 4-hydroxylation. In contrast, the same enzyme catalyzes N-deethylation of a structural isomer, the prodrug ifosfamide (IFA), thus causing severe adverse drug effects. To model the molecular interactions leading to a switch in regioselectivity, the structure of CYP2B6 was modeled based on the structure of rabbit CYP2C5. We modeled the missing 22-residue loop in CYP2C5 between helices F and G (the F-G loop), which is not resolved in the X-ray structure, by molecular dynamics (MD) simulations using a simulated annealing protocol. The modeled conformation of the loop was validated by unconstrained MD simulations of the complete enzymes (CYP2C5 and CYP2B6) in water for 70 and 120 ps, respectively. The simulations were stable and led to a backbone r.m.s. deviation of 1.7 A between the two CYPs. The shape of the substrate binding site of CYP2B6 was further analyzed. It consists of three well-defined hydrophobic binding pockets adjacent to the catalytic heme. Size, shape and hydrophobicity of these pockets were compared to the shapes of the two structurally isomeric substrates. In their preferred orientation in the binding site, both substrates fill all three binding pockets without repulsive interactions. The distance to the heme iron is short enough for 4-hydroxylation and N-deethylation to occur for CPA and IFA, respectively. However, if the substrates are docked in the non-preferred orientation (such that 4-hydroxylation and N-deethylation would occur for IFA and CPA, respectively), one pocket is left empty, and clashes were observed between the substrates and the enzyme.

Amino Acid Sequence↗
PubMed2002

Completion and refinement of 3-D homology models with restricted molecular dynamics: application to targets 47, 58, and 111 in the CASP modeling competition and posterior analysis.

A method is presented to refine models built by homology by the use of restricted molecular dynamics (MD) techniques. The basic idea behind this method is the use of structure validation software to determine for each residue the likelihood that it is modeled correctly. This information is used to determine constraints and restraints in an MD simulation including explicit solvent molecules, which is used for model refinement. The procedure is based on the idea that residues that the validation software identifies as correctly positioned should be strongly constrained or restrained in the MD simulations, whereas residues that are likely to be positioned wrongly should move freely. Two different protocols are compared: one (applied to CASP3 target T58) using full structural constraints with separate optimization of each short fragment and the other (applied to T47) allowing some freedom using harmonic restraining potentials, with automatic optimization of the whole molecule. Structures along the MD trajectory that scored best in structural checks were selected for the construction of models that appeared to be successful in the CASP3 competition. Model refinement with MD in general leads to a model that is less like the experimental structure (Levitt et al. Nature Struct Biol 1999;6:108-111). Actually, refined T47 was slightly improved compared to the starting model; changes in model T58 led not to further enhancement. After the X-ray structure of the modeled proteins became known, the procedure was evaluated for two targets (T47 and the CASP4 target T111) by comparing a long simulation in water with the experimental target structures. It was found that structural improvements could be obtained on a nanosecond time scale by allowing appropriate freedom in the simulation. Structural checks applied to fast fluctuations do not appear to be informative for the correctness of the structure. However, both a simple hydrogen bond count and a simple compactness measure, if averaged over times of typically 300 ps, correlate well with structural correctness and we suggest that criteria based on these properties may be used in computational folding strategies.

Amino Acid Sequence↗
PubMed2006

Atomistic molecular dynamics simulation of the temperature and pressure dependences of local and terminal relaxations in cis-1,4-polybutadiene.

The dynamics of cis-1,4-polybutadiene (cis-1,4-PB) over a wide range of temperature and pressure conditions is explored by conducting atomistic molecular dynamics (MD) simulations with a united atom model on a 32-chain C128 cis-1,4-PB system. The local or segmental dynamics is analyzed in terms of the dipole moment time autocorrelation function (DACF) of the simulated polymer and its temperature and pressure variations, for temperatures as low as 195 K and pressures as high as 3 kbars. By Fourier transforming the DACF, the dielectric spectrum, epsilon* = epsilon' + i epsilon" = epsilon*omega, is computed and the normalized epsilon"/epsilon(max)" vs omega/omega(max) plot is analyzed on the basis of the time-temperature and time-pressure superposition principles. The relative contribution of thermal energy and volume to the segmental and chain relaxation processes are also calculated and evaluated in terms of the ratio of the activation energy at constant volume to the activation energy at constant pressure, Q(V)/Q(P). Additional results for the temperature and pressure dependences of the Rouse times describing terminal relaxation in the two polymers show that, in the regime of the temperature and pressure conditions covered here, segmental and chain relaxations are influenced similarly by the pressure and temperature variations. This is in contrast to what is measured experimentally [see, e.g., G. Floudas and T. Reisinger, J. Chem. Phys. 111, 5201 (1999); C. M. Roland et al.,J. Polym. Sci. Part B, 41, 3047 (2003)] for other, chemically more complex polymers that pressure has a stronger influence on the dynamics of segmental mode than on the dynamics of the longest normal mode, at least for the regime of temperature and pressure conditions covered in the present MD simulations.

Journal Article↗
PubMed2006

Vstx1, a modifier of Kv channel gating, localizes to the interfacial region of lipid bilayers.

VSTx1 is a tarantula venom toxin which binds to the archaebacterial voltage-gated potassium channel KvAP. VSTx1 is thought to access the voltage sensor domain of the channel via the lipid bilayer phase. In order to understand its mode of action and implications for the mechanism of channel activation, it is important to characterize the interactions of VSTx1 with lipid bilayers. Molecular dynamics (MD) simulations (for a total simulation time in excess of 0.2 micros) have been used to explore VSTx1 localization and interactions with zwitterionic (POPC) and with anionic (POPE/POPG) lipid bilayers. In particular, three series of MD simulations have been used to explore the net drift of VSTx1 relative to the center of a bilayer, starting from different locations of the toxin. The preferred location of the toxin is at the membrane/water interface. Although there are differences between POPC and POPE/POPG bilayers, in both cases the toxin forms favorable interactions at the interface, maximizing H-bonding to lipid headgroups and to water molecules while retaining interactions with the hydrophobic core of the bilayer. A 30 ns unrestrained simulation reveals dynamic partitioning of VSTx1 into the interface of a POPC bilayer. The preferential location of VSTx1 at the interface is discussed in the context of Kv channel gating models and provides support for a mode of action in which the toxin interacts with the Kv voltage sensor "paddle" formed by the S3 and S4 helices.

Archaeal Proteins↗
PubMed2006

Structure and hydrogen bonding in neat N-methylacetamide: classical molecular dynamics and Raman spectroscopy studies of a liquid of peptidic fragments.

The results of classical molecular dynamics (MD) simulations and Raman spectroscopy studies of neat liquid N-methylacetamide (NMA), the simplest model system relevant to the peptides, are reported as a function of temperature and pressure. The MD simulations predict that near ambient conditions, the molecules form a hydrogen bond network consisting primarily of linear chains. Both the links between molecules within the hydrogen-bonded chains and the associations between chains are stabilized by weak methyl-donated "improper" hydrogen bonds. The three-dimensional structural motifs observed in the liquid show some similarity to protein beta-sheets. The temperature and pressure dependence of the hydrogen bond network, as probed by the mode frequency of the experimentally determined amide-I Raman band, blue shifts on heating and red shifts under compression, respectively, suggesting weakened and enhanced hydrogen bonding in response to temperature and pressure increases. Disruption of the hydrogen-bonding network is clearly observed in the simulation data as temperature is increased, whereas the improper hydrogen bonding is enhanced under compression to reduce the energetic cost of increasing the packing fraction. Because of the neglect of polarizability in the molecular model, the computed dielectric constant is underestimated compared to the experimental value, indicating that the simulation may underestimate dipolar coupling in the liquid.

Acetamides↗
PubMed1997

Conformational analysis of cyclo(2,9)-Ac-QCRSVEGSCG-OH from the C-terminal loop of human growth hormone.

A 10 amino acid residue cyclic peptide, cyclo(2,9)-Ac-Gln1-Cys2-Arg3-Ser4-Val5-Glu6-Gly7 -Ser8-Cys9-Gly10, from the C-terminal region of human growth hormone (hGH) was synthesized and studied by 2D proton NMR and molecular dynamics (MD) simulations. The solubility of the peptide was low in water; hence, NMR studies were done in two solvent mixtures, water and deuterated dimethyl sulfoxide. NOE-constrained molecular dynamics and MD simulations resulted in major and minor conformers in solution. The major conformer has a type I beta-turn at Gln1-Cys2-Arg3-Ser4 and a loop structure around Glu6-Gly7-Ser8. Comparison of the conformation of this peptide with the peptide fragment 181-190 in the intact hGH protein X-ray crystal structure indicated that the synthetic peptide retains some structural similarity to the intact protein. Since the C-terminal region is important in binding the hGH protein to its receptor, the conformation of the synthetic peptide could be useful in understanding the binding mechanism.

Amino Acid Sequence↗
PubMed2004

Dynamics and energetics of water permeation through the aquaporin channel.

Structural properties of water inside bovine aquaporin-1 are investigated by molecular simulation. The calculations, which are based on the recently determined X-ray structure at 2.2 A resolution (Sui et al., Nature 2001;414:872-878), are carried out on one monomeric subunit immersed in a water-n-octane-water bilayer. Molecular dynamics (MD) simulations suggest that His182, a fully conserved residue in the channel pore, is protonated in the delta position. Furthermore, they reveal a highly ordered water structure in the channel, induced by the electrostatic properties of the protein. Multiple-steering MD simulations are used to calculate the free-energy of water diffusion. To the best of our knowledge, this represents the first free-energy calculation based on the new, high-resolution structure of the pore. The calculated barrier is 2.5 kcal/mol, and it is associated to water permeation through the Asn-Pro-Ala (NPA) region of the pore, where water molecules are only hydrogen-bonded with themselves. These findings are fully consistent with those based on the previous MD studies on the human protein (de Groot and Grubmüller, Science 2001;294:2353-2357).

Animals↗
PubMed1992

Molecular dynamics study of the conformational behavior of a representative elastin building block: Boc-Gly-Val-Gly-Gly-Leu-OMe.

The conformational behavior of the synthetic peptide, Boc-Gly-Val-Gly-Gly-Leu-OMe, containing the X-Gly-Gly and Gly-Gly-X (X = Val or Leu) repeating sequences and constituting a fragment of elastin was investigated by molecular mechanics and molecular dynamics (MD) simulation. The results suggest that, irrespective of the approximations used, the molecule shows a manifold of low energy conformations characterized by gamma-turns and type II beta-turns. Furthermore, MD simulations point out a conformational floppiness due to very low barriers between different conformations. Experimental CD measurements in a virtually apolar medium (dioxane--epsilon = 2.209), which better mimics the vacuum conditions of the simulation, support the theoretical results. The general emerging picture, indicating the molecule as characterized by a combination of flexibility with conformational preferences, is in agreement with previous experimental findings and enriches of new aspects the description of the microscopic behavior of this molecule suggesting more detailed interpretation of previous data.

Amino Acid Sequence↗
PubMed2006

Atomistic and coarse-grained analysis of double spectrin repeat units: the molecular origins of flexibility.

Spectrin is an ubiquitous protein in metazoan cells, and its flexibility is one of the keys to maintaining cellular structure and organization. Both alpha-spectrin and beta-spectrin polypeptides consist primarily of triple coiled-coil modular repeat units, and two important factors that determine spectrin flexibility are the bending flexibility between two consecutive repeat units and the conformational flexibility of individual repeat units. Atomistic molecular dynamics (MD) simulations are used here to study double spectrin repeat units (DSRUs) from the human erythrocyte beta-spectrin (HEbeta89) and the chicken brain alpha-spectrin (CBalpha1617). From the results of MD simulations, a highly conserved Trp residue in the A-helix of most repeat units that has been suggested to be important in conferring stability to the coiled-coil structures is found not to have a significant effect on the conformational flexibility of individual repeat units. Characterization of the bending flexibility for two consecutive repeats of spectrin via atomistic simulations and coarse-grained (CG) modeling indicate that the bending flexibility is governed by the interactions between the AB-loop of the first repeat unit, the BC-loop of the second repeat unit and the linker region. Specifically, interactions between residues in these regions can lead to a strong directionality in the bending behavior of two repeat units. The biological implications of these finding are discussed.

Amino Acid Sequence↗
PubMed2006

Water exchange dynamics of lithium(I) ion in aqueous solution.

The water exchange dynamics of the fourfold coordinated first hydration shell of the lithium(I) ion was studied by both direct and umbrella sampling QM/MM-MD and classical MD simulations. The structural changes and energetics accompanying the activation process are discussed. The overall exchange rate constant was found to be k(ex) = 5.8 x 10(9) s(-1) from classical MD simulations. QM/MM-MD umbrella sampling simulations predict an exchange rate constant of k(TST) = 1.01 x 10(10) s(-1) as obtained from classical transition-state theory. First-shell ligands exchange preferably via an associatively activated mode.

Cations↗
PubMed1994

RNA tertiary structure of the HIV RRE domain II containing non-Watson-Crick base pairs GG and GA: molecular modeling studies.

We have used molecular modeling techniques to model the RNA tertiary structure of the viral RNA element (referred to as domain II of Rev responsive element, RRE) bound by the Rev protein of HIV. In this study, the initial three-dimensional model was built from its established RNA secondary structure, including three non-Watson-Crick G:G, G:A and G:U base pairs. Molecular dynamics (MD) simulations were performed with hydrated or unhydrated sodium ions. Our results indicate that the non-Watson-Crick base pairs in the simulation with unhydrated sodium ions and water are more stable than those with hydrated sodium ions only. The RNA can maintain its compact double helical structure throughout the course of the MD simulations with water and unhydrated sodium ions, although the non-Watson-Crick base pairs and two bulge loops show much more flexibility and conformational distortion than the classical RNA helical region. The distinct distortion of the sugar-phosphate backbone significantly widens the RNA major groove so that the major groove is readily accessible for hydrogen bonding by specific Rev binding. This model emphasizes the importance of specific hydrogen bonding in the stabilization of the three-dimensional structure of the HIV Rev core binding element, not only between the nucleotide bases, but also among the ribose hydroxyls, phosphate anionic oxygens, base oxygens and nitrogens, and bridging water molecules. Moreover, our results suggest that sodium ions play an important role in the formation of base pairs G:G and G:A of the RRE by a manner similar to the arginine of the Rev-RRE complex.

Adenine↗
PubMed2005

Systematic coarse-graining of nanoparticle interactions in molecular dynamics simulation.

A recently developed multiscale coarse-graining procedure [Izvekov, S.; Voth, G. A. J. Phys. Chem. B 2005, 109, 2469] is extended to derive coarse-grained models for nanoparticles. The methodology is applied to C(60) and to carbonaceous nanoparticles produced in combustion environments. The coarse-graining of the interparticle force field is accomplished applying a force-matching procedure to data obtained from trajectories and forces from all-atom MD simulations. The CG models are shown to reproduce accurately the structural properties of the nanoparticle systems studied, while allowing for MD simulations of much larger self-assembled nanoparticle systems.

Models, Molecular↗
PubMed2006

Immunophysical properties and prediction of activities for vaccinia virus complement control protein and smallpox inhibitor of complement enzymes using molecular dynamics and electrostatics.

We present immunophysical modeling for VCP, SPICE, and three mutants using MD simulations and Poisson-Boltzmann-type electrostatic calculations. VCP and SPICE are homologous viral proteins that control the complement system by imitating, structurally and functionally, natural regulators of complement activation. VCP and SPICE consist of four CCP modules connected with short flexible loops. MD simulations demonstrate that the rather complex modules of VCP/SPICE and their mutants exhibit a high degree of intermodular spatial mobility, which is affected by surface mutations. Electrostatic calculations using snapshots from the MD trajectories demonstrate variable spatial distribution of the electrostatic potentials, which suggests dynamic binding properties. We use covariance analysis to identify correlated modular oscillations. We also use electrostatic similarity indices to cluster proteins with common electrostatic properties. Our results are compared with experimental data to form correlations between the overall positive electrostatic potential of VCP/SPICE with binding and activity. We show how these correlations can be used to predict binding and activity properties. This work is expected to be useful for understanding the function of native CCP-containing regulators of complement activation and receptors and for the design of antiviral therapeutics and complement inhibitors.

Amino Acid Sequence↗
PubMed2000

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.

Base Pairing↗
PubMed2000

Molecular dynamics simulations highlight mobile regions in proteins: A novel suggestion for converting a murine V(H) domain into a more tractable species.

The V(H) region of the murine antibody 1F7 has been identified as a single-domain chorismate mutase, but a tendency to denature and aggregate has hampered its biochemical characterization. Standard mutagenesis approaches targeting antibody chain dimerization areas have been exhausted. We describe a new approach to the problem, where we use molecular dynamics (MD) simulations to find the differences between the untractable protein and the known soluble V(H) domain from a llama antibody. MD simulations of proteins yield information on the relative stability and fluctuations of parts of the proteins. By comparing simulation results of two related proteins their differences in stability and fluctuations can be analyzed and may suggest mutations aimed at (de)stabilization of one of the two proteins. For the mouse versus llama simulations, this approach highlights an untried area in the protein which shows increased fluctuations. The replacement of this eight-residue segment with the corresponding llama sequence gave a chimeric mutant which shows significantly decreased fluctuations. We see this as a general scheme to generate suggestions for mutagenesis experiments, not only obviously generalizable to other immunoglobulin domains, but to other protein systems as well.

Amino Acid Sequence↗
PubMed2006

Two-dimensional Raman spectra of atomic solids and liquids.

We calculate third- and fifth-order Raman spectra of simple atoms interacting through a soft-core potential by means of molecular-dynamics (MD) simulations. The total polarizability of molecules is treated by the dipole-induced dipole model. Two- and three-body correlation functions of the polarizability at various temperatures are evaluated from equilibrium MD simulations based on a stability matrix formulation. To analyze the processes involved in the spectroscopic measurements, we divide the fifth-order response functions into symmetric and antisymmetric integrated response functions; the symmetric one is written as a simple three-body correlation function, while the antisymmetric one depends on a stability matrix. This analysis leads to a better understanding of the time scales and molecular motions that govern the two-dimensional (2D) signal. The 2D Raman spectra show novel differences between the solid and liquid phases, which are associated with the decay rates of coherent motions. On the other hand, these differences are not observed in the linear Raman spectra.

Journal Article↗