Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “LEPTOSPIRA”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 487 records · Page 27Linked to original sources
PubMedDate not supplied

[Development of a test system for detecting Leptospira interrogans using the polymerase chain reaction].

Based on polymerase chain reaction a test-system has been elaborated permitting one to identify the leptospirae of the most common serogroups (Icterohaemorrhagiae, Canicola, Javanica, Ballum, Pyrogenes, Pomona, Habdomadis, Sejroe, Tarassovi) of the species Leptospira interrogans. Sensitivity of the technique is 1-10 cells in a sample. The specificity of the system has been shown to depend on the temperature of the primers annealing. The elaborated system exceeds all other systems for leptospiral identification in sensitivity. It is prospective for leptospiral identification in biological liquids aimed at early diagnosis of leptospiroses and in the studies of leptospiral persistence in host organisms in the saprophitic phase of life cycle.

DNA Primers↗
PubMedDate not supplied

[A polymerase chain reaction method for studying host persistence of pathogenic leptospira].

Polymerase chain reaction has for the first time been shown to be applicable to indication of Leptospira interrogans in the organs of infected animals with acute or chronic leptospirosis (on the model of golden syrian hamsters). Polymerase chain reaction is superior to microscopic and bacteriological analyses in identification of leptospirae in organ suspensions. The sensitivity of the technique is 1-10 cells per sample in studies of kidney or brain suspensions or 100-1000 cells in studies of liver suspensions.

Acute Disease↗
PubMed1993

Identification of Leptospira interrogans strains by monoclonal antibodies and genomic analysis.

A recombinant probe derived from a genomic library of serovar hardjo strain Hardjoprajitno, and a panel of serovar specific Monoclonal Antibodies (MAbs) were used for the characterization of 31 Leptospira isolates from cattle and swine. The two methods performed equally well in serovar identification except for the distinction of the genotypes hardjoprajitno and hardjobovis within serovar hardjo which could only be obtained by genomic analysis. The combination of immunological and genetic information was also useful to evaluate the degree of variability of Leptospira strains. The quality of the patterns and the sensitivity provided by a digoxigenin labelled probe were comparable to those obtained with a radioactive reagent.

Animals↗
PubMed1993

[Amplified 23S rRNA gene of 52 strains of Leptospira and detection of leptospiral DNA in 55 patients by PCR].

Based upon the polymerase chain reaction (PCR), We have developed a sensitive assay for Leptospira interrogans, the agent of leptospirosis. DNA amplification was carried out using primer A: 5'GATCTAATTCGCTGTAGCAGG3' and primer B: 5'ACTTTCACCCTCTATGGTCGG3'. After 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. A segment (124 bp) was amplified in all strains of L. interrogans including 20 Serogroups, 49 Serovars tested, but it was not detected in Patoc I strain, Serovar patoc of Leptospira biflexa and 3055 strain of Leptonema illini (both of which are nonpathogenic). All of the serum (first time) which proved either by blood culture or MAT showed that positive rates were 100%. Leptospiral infection in humans and some domestic animals leads to one or more of a variety of manifestation and persists through a considerable duration of time. However it is relatively difficult to demonstrate the presence of leptospires in serum. The serum (second time) obtained from 55 patients with leptospirosis (6-60 days after on set) showed that PCR positive rates were 74.55% (41/55). The PCR positive rates for healthy subjects were 15% (3/20), P < 0.001. The diagnosis of leptospirosis by using PCR may become a significant addition to the routine laboratory diagnosis and a valuable technique for the investigation of leptospirosis pathogenesis.

Base Sequence↗
PubMed1996

Leptospira interrogans serovar grippotyphosa infection in dogs.

Leptospirosis attributed to infection with serovar grippotyphosa was diagnosed in 11 dogs. In naturally and experimentally infected dogs, a stereotypic serologic response to infection with Leptospira serovar grippotyphosa was detected. Although the highest serum antibody titers developed against serovar grippotyphosa, most dogs also had lower titers against serovars bratislava and pomona. Acute renal failure was evident in 10 dogs. One dog died prior to initiation of treatment; the remaining 10 dogs were treated with antibiotics and fluids. Two dogs were euthanatized, 2 dogs recovered without clinical or biochemical evidence of residual renal dysfunction, and 6 dogs recovered but had varying degrees of renal insufficiency. Hepatic involvement appeared to be a minor component of the disease in these dogs. Our results indicate that Leptospira serovar grippotyphosa infection is an important problem in dogs and should be considered when evaluating a dog with renal failure.

Acute Kidney Injury↗
PubMed1997

Development and initial evaluation of an indirect enzyme-linked immunosorbent assay for the detection of Leptospira interrogans serovar hardjo antibodies in bovine sera.

Outer sheath antigen from Leptospira interrogans serovar hardjo type hardjoprajitno and acetic acid extracted antigens from serovar hardjo types hardjoprajitno and hardjobovis were evaluated in an immunoassay for ability to detect hyperimmune rabbit serum to serovar hardjo. The degree of cross-reactivity with hyperimmune rabbit sera to L. interrogans serovars pomona, copenhageni, grippotyphosa, canicola and sejroe, and Leptospira biflexa serovar patoc was also measured for each antigen. All of the antigens reacted with the antiserum to L. interrogans serovar hardjo. The outer sheath antigen however, also showed wide cross-reactivity with the antisera to all of the serovars of L. interrogans tested and with the antiserum to L. biflexa serovar patoc. The acetic acid extracted antigen from either type hardjoprajitno, or type hardjobovis, showed a high degree of specificity for serovar hardjo antiserum. The hardjobovis acetic acid extracted antigen was characterized by sodium dodecyl sulfate polyacrylamide gel electrophoresis and immunoblotting, and was incorporated into an indirect ELISA for detection of anti-serovar hardjo antibodies in bovine serum. This ELISA showed a relative specificity of 100% with 156 bovine sera which were negative at a dilution of 1:100 in the microscopic agglutination test (MAT) for L. interrogans serovars hardjo, pomona, sejroe, icterohaemorrhagiae, copenhageni, canicola, and grippotyphosa. The relative sensitivity of this assay with 192 bovine sera which had serovar hardjo MAT titres of > or = 100 was 95.3% (95% confidence limit = 2.99%). The degree of cross-reactivity with 289 bovine sera which had serovar pomona MAT titres of > or = 100 (with no detectable serovar hardjo MAT titres) was approximately 1.0%. This assay was: easily standardized, scored objectively, repeatable, semi-automated and used a non-hazardous antigen that can be routinely prepared in gram amounts.

Acetic Acid↗
PubMed1976

[Review of the incidence of antibodies to various serological groups of the species Leptospira interrogans in a number of farm animals in the Netherlands (author's transl)].

Report on the results of serological studies on the species Leptospira interrogans in cattle (19,607), swine (6,348), dogs (182) and horses (88) from the Netherlands during the period from 1969 to 1974. Living cultures of the serotypes of pomona, icterohaemorrhagiae, canicola, guidae (Tarassovi serological group), grippotyphosa and sejroe were used as antigen in the micro-agglutination test. The numerical findings showed that antibodies to serotypes of the species Leptospira interrogans were present in 7.67 per cent of the cattle, 22.21 per cent of the pigs, 36.81 per cent of the dogs and 92.05 per cent of the horses studied. Infection with the serotypes of icterohaemorrhagiae and grippotyphosa was most common in cattle and horses, icterohaemorrhagiae and tarassovi were most common in swine and icterohaemorrhagiae and canicola were most common in dogs. The presence of pomona is not a factor in the Netherlands. In view of statistical findings, grippotyphosa infections in cattle may be assumed to result in abortion.

Abortion, Septic↗
PubMed2002

A serosurvey for antibodies to Leptospira in dogs in the lower North Island of New Zealand.

AIMS: To investigate the prevalence of antibodies to endemic and exotic Leptospira serovars in samples from a serum bank, collected from dogs in the lower North Island of New Zealand. METHODS: Sera (n=466), which had been collected from apparently healthy dogs, were screened using the microscopic agglutination test (MAT) for antibodies to serovars L. borgpeterseni serovar hardjo, L. interrogans serovars pomona, copenhageni and canicola, and L. kirschneri serovar grippotyphosa. RESULTS: Antibody to Leptospiral antigen was found in 14.2% of dogs tested. The highest level of reactivity was with serovar copenhageni, to which 9.5% (41/433) of sera were positive. Antibodies to serovars grippotyphosa and canicola were not detected in this population of dogs. CONCLUSIONS: Leptospira infection is relatively common in dogs in the lower North Island . CLINICAL RELEVANCE: Vaccination of dogs against leptospirosis should be considered using vaccine containing antigen to serovars hardjo, pomona and copenhageni. The presence of moderate levels of copenhageni antibody in dogs in the lower North Island raises the possibility that this serovar has become established in rodent populations in this region.

Journal Article↗
PubMed1998

In vivo apoptosis of hepatocytes in guinea pigs infected with Leptospira interrogans serovar icterohaemorrhagiae.

To investigate the contribution of the previously demonstrated in vitro apoptosis to the pathogenesis of leptospirosis, guinea pigs were infected with Leptospira interrogans serovar icterohaemorrhagiae strain Verdun and sequentially killed to collect target organs involved in the natural history of the disease (liver, kidneys, lungs, spleen and heart). The combination of histopathological procedures and a specific TUNEL assay showed a significant Leptospira-induced programmed cell death of hepatocytes with a peak at 48 h post inoculation. Hepatocyte nuclei showed morphological changes including fragmented and condensed nuclei. This phenomenon occurred early in the course of the disease at a time where infecting leptospires were present at a low density between the liver parenchyma cells.

Animals↗
PubMed1967

Enzyme patterns in the study of leptospira.

An analysis of intracellular and extracellular leptospiral enzymes was made by use of starch-gel electrophoresis with natural and synthetic substrates. Of 37 serotypes examined for extracellular exterase, all had activity of varying mobility and degree. All extracellular preparations were negative for catalase, phosphatase, and naphthylamidase. Intracellularly, five serotypes were examined, including Leptospira biflexa Patoc I, L. biflexa Waz, L. canicola Moulton, L. icterohaemorrhagiae RGA, and L. pomona S91. Among the enzymes detected by this electrophoretic technique were transaminase and catalase, confirming the results of previous investigators. Further, other enzymes heretofore unreported have been detected. These include esterases, phosphatases, lactic, malic, glutamic, succinic, alpha-glycerophosphate, and 6-phosphogluconic dehydrogenases, and a naphthylamidase. The presence of these enzymes suggests the existence of tricarboxylic acid, glycolytic, and pentose-related pathways in Leptospira. In addition, enzyme patterns show promise in leptospiral classification.

Journal Article↗
PubMed1962

IN VIVO AND IN VITRO OBSERVATIONS OF LEPTOSPIRA POMONA BY ELECTRON MICROSCOPY.

Miller, Norman G. (University of Nebraska College of Medicine, Omaha) and Richard B. Wilson. In vivo and in vitro observations of Leptospira pomona by electron microscopy. J. Bacteriol. 84:569-576. 1962.-Leptospira pomona 3341 was observed by electron microscopy, after the preparation of thin sections from culture material and from infected hamster tissue. The external membrane of low electron density envelops the entire leptospire and appears to be quite flexible, as suggested by its many folds. The spiral protoplasmic body is tubular in structure with a relatively dense wall and a central area of low electron density. Occasionally, very dark circumscribed bodies were seen imbedded in the protoplasmic wall. Detailed morphology is presented of a knoblike structure located at the end of the axial filament. Bifurcation of the axial filament could be demonstrated in leptospires from cultures. Leptospires were observed free or enclosed in vesicles within the cytoplasm of liver parenchymal and renal tubule cells. Erythrocytes located in kidney tissue also contained leptospires within the cytoplasm. The appearance of intracellular leptospires is much the same as those seen extracellularly or from culture.

Journal Article↗
PubMed1966

Growth of Leptospira pomona and Its Effect on Various Tissue Culture Systems.

Miller, Robert E. (University of Nebraska College of Medicine, Omaha), Norman G. Miller, and Roberta J. White. Growth of Leptospira pomona and its effect on various tissue culture systems. J. Bacteriol. 92:502-509. 1966.-Leptospira pomona strain 3341 was grown in association with primary fetal bovine kidney (PBK) and human embryonic skin-muscle fibroblastic (HE) cells in Eagle's minimal essential medium (MEM) with 5% sheep serum. Growth curves of leptospires in PBK and HE cell cultures showed no substantial increase in growth above that obtained in Eagle's MEM in the absence of tissue culture cells. This suggested that no stimulatory growth factors for leptospires were produced by the tissue cells. Fibroblastic cells of the PBK monolayer showed separation, deterioration, and, finally, complete disintegration. Epithelial-like cells remained unaffected. HE cells showed the same cytopathic effect as PBK fibroblastic cells, indicating that this effect was not limited to PBK fibroblastic cells. Warthin-Starry stains of PBK and HE cell monolayers showed masses of leptospires adhering to fibroblastic cells, whereas only a few were seen on epithelial-like cells. Large numbers of leptospires on the surface of fibroblastic cells are very likely associated with the cytopathic effect. Dislodgment of leptospires from fibroblastic cells did not increase the total number of spirochetes in the culture. This indicated that leptospiral growth did not occur on the surface of these cells.

Journal Article↗
PubMed1976

[Severe course of an infection with Leptospira grippotyphosa (author's transl)].

In a 22 years old female patient severe jaundice, renal failure and myocarditis developed 3 days after the onset of fever and other uncharacteristic symptoms. In dark-field microscopy leptospires were found. Inspite of high-dose penicillin therapy exitus letalis occurred in myocardial and circulatory failure, due to a severe interstitial myocarditis. Leptospira grippotyphosa could be proven serologically as the causative bacterium. It is pointed out, that leptospirosis inspite of their rare occurrence should be included in the differential diagnosis of infections of undetermined origin, especially if jaundice develops. The demonstration of leptospira in blood, cerebro-spinal fluid or urin by means of darkfield microscopy may quickly support the diagnosis. Since the course of severe leptospirosis can be influenced significantly only up to the 4th day after the onset, high-dose penicillin G or tetracycline therapy should be initiated already when the clinical suspicion is present.

Acute Kidney Injury↗
PubMedDate not supplied

[Serologic investigation on the prevalence of Leptospira spp infection in occupationally exposed subjects].

BACKGROUND: Leptospirosis is a worldwide zoonotic infection with a high in tropical regions. OBJECTIVE: The aim of the present survey was to verify the occurrence of diffusion of leptospirosis infections in Eastern Sicily, in some groups (6 veterinarians, 34 farmers and 28 abattoir workers), who were considered at high occupational risk. METHODS: Serologic investigation were performed using the immunological method (Martin Petit test); the Leptospira serovars considered were: ictero-haemorrhagiae (Bianchi 1); canicola (Alarik); pomona (Mezzano 1); grippo-typhosa (Moskva V); bratislava (Riccio 2); sejroe (Topino 1); hardjo (Hardjoprajitno); saxkoebing (Mus 24). RESULTS: Contagion was observed in 16 subjects out of 68 (23.5%), and the anti-leptospira antibodies detected were canicola, hardjo, sejroe grippo-typhosa e ictero-haemorrhagiae. CONCLUSIONS: The authors stress the importance carrying out periodic health surveillance in subjects working in wet and contaminated environments or who are continuously in contact with animals receptive to infections. The present study also confirms the need to adopt preventive measures such as vaccines, and control programs for activities at high risk.

Adult↗
PubMed1987

[Etiological structure and clinical epidemiological characteristics of Leptospira infection in Rostov Province based on data from therapeutic institutions from 1960 to 1983].

Changes in communal conditions, in economy, as well as in ecology and fauna, which took place in Rostov Province during the last decade (1973-1983) determined shifts in the etiological structure of Leptospira infection and in its course. The study revealed an increase in morbidity caused by L. icterohaemorrhagiae (up to 61%) and L. hebdomadis (up to 22%) with a simultaneous decrease in the isolation rate of L. grippotyphosa and L. pomona (up to 2-3%). In most cases (77%) the diseases caused by leptospires of different serogroups were found to take an icteric course accompanied by the development of hepatorenal insufficiency (46%). The similarity of clinical manifestations in different etiological forms of Leptospira infection was determined by common pathogenetic and pathophysiological features characteristic of the development of the leptospiral infectious process.

Age Factors↗
PubMed1977

Leptospiras as causative organisms of meningitis.

Data concerning the incidence of meningeal syndromes during the course of leptospirosis are analyzed, in relation to the Italian epidemiological situation in the years 1973-1976. From this analysis, some characteristic aspects concerning meningitis from leptospiras emerge. Specifically: the remarkable frequency of meningeal syndromes in leptospirosis; the greater incidence of the syndrome among young people; the neurotropism common to all serotypes of leptospira observed in Italy. These data suggest to extend the search for leptospiroses in all forms of the so called aseptic meningitis in order to determine better the actual incidence of leptospiroses in meningeal syndromes.

Adult↗
PubMed1998

Pneumonia due to Leptospira spp.: results of an epidemiological and clinical study.

OBJECTIVE: To evaluate the prevalence of Leptospira spp. infections in a population of in- and out-patients with community acquired pneumonia (CAP) and the incidence of leptospiral pneumonia. DESIGN AND RESULTS: Of 176 patients infected with CAP who were evaluated for the presence of Leptospira spp. as causative agent, 10 were found positive for leptospiral antibodies (prevalence rate: 5.7%), but seroconversion was observed in only one case (incidence rate: 0.6%). The patient had had recent contact with possibly contaminated water. She had pulmonary involvement and signs of mild hepatic damage, but recovered fully. CONCLUSION: The authors highlight the importance of testing for leptospirosis in case of pneumonia in endemic areas where the more common causative pathogens for CAP can not be documented and when initial empiric therapy is ineffective.

Adult↗
PubMed1972

Composition of fatty acids and carbohydrates in Leptospira.

The fatty acid and monosaccharide composition of four pathogenic and two saprophytic strains of Leptospira was analyzed by gas chromatography (GC) and GC-mass spectrometry. Among the fatty acids, palmitic acid was most abundant and constituted 30 to 50% of the total fatty acids. Even-numbered unsaturated acids including octadecenoic, hexadecenoic, octadecadienoic, and tetradecadienoic acids comprised 40 to 60% of the total fatty acids. Tetradecanoic acid was about 5% in saprophytic strains, but 1% or less in pathogenic strains. The amount of chloroform-methanol extract of L. biflexa strain Ancona was 14 to 20% of the dry weight of the cell. Tetradecadienoic acid was found in the chloroform-methanol insoluble fraction, suggesting the presence of the acid in a bound form. GC analysis of monosaccharides revealed the existence of arabinose, xylose, rhamnose, mannose, galactose, glucose, glucosamine, and muramic acid in the cells. Among the neutral sugars, glucose was a minor component and was especially low in pathogenic strains. Total pentose content was about two to three times greater than total hexose.

Amino Sugars↗