SEARCH · Search PubMed

Results for “genome composition”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 469 records · Page 26Linked to original sources

PubMed1992

Nucleotide sequence of the genome of the filamentous bacteriophage I2-2: module evolution of the filamentous phage genome.

The nucleotide sequence of the circular single-stranded genome of the filamentous Escherichia coli phage I2-2 has been determined and compared with those of the filamentous E. coli phages Ff(M13, fl, or fd) and IKe. The I2-2 DNA sequence comprises 6744 nucleotides; 139 nucleotides less than that of the N- and I2-plasmid-specific phage IKe, and 337 (336) nucleotides more than that of the F-plasmid-specific phage Ff. Nucleotide sequence comparisons have indicated that I2-2, IKe, and Ff have a similar genetic organization, and that the genomes of I2-2 and IKe are evolutionarily more closely related than those of I2-2 and Ff. The studies have further demonstrated that the I2-2 genome is a composite replicon, composed of only two-thirds of the ancestral genome of IKe. Only a contiguous I2-2 DNA sequence of 4615 nucleotides encompassing not only the coat protein and phage assembly genes, but also the signal required for efficient phage morphogenesis, was found to be significantly homologous to sequences in the genomes of IKe and Ff. No homology was observed between the consecutive DNA sequence that contains the origins for viral and complementary strand replication and the replication genes. Although other explanations cannot be ruled out, our data strongly suggest that the ancestor filamentous phage genome of phages I2-2 and IKe has exchanged its replication module during evolution with that of another replicon, e.g., a plasmid that also replicates via the so-called rolling circle mechanism.

Amino Acid Sequence↗

PubMed2006

Evolutionary systems biology: links between gene evolution and function.

The recent accumulation of genome-wide data on various facets of gene expression, function and evolution stimulated the emergence of a new field, evolutionary systems biology. Many significant correlations were detected between variables that characterize the functioning of a gene, such as expression level, knockout effect, connectivity of genetic and protein-protein interaction networks, and variables that describe gene evolution, such as sequence evolution rate and propensity for gene loss. The first attempts on multidimensional analysis of genomic data yielded composite variables that describe the 'status' of a gene in the genomic community. However, it remains uncertain whether different functional variables affect gene evolution synergistically or there is a single, dominant factor. The number of translation events, linked to selection for translational robustness, was proposed as a candidate for such a major determinant of protein evolution. These developments show that, although the methodological basis of evolutionary systems biology is not yet fully solidified, this area of research is already starting to yield fundamental biological insights.

Evolution, Molecular↗

PubMed1990

From gene to chromosome: organization levels defined by the interplay of transcription and replication in vertebrates.

In higher eukaryotes, gene activation is accompanied by an increased sensitivity to DNaseI over a domain that extends beyond the limits of the gene itself, or of the gene cluster to which it belongs. This increased sensitivity probably reflects both the partial decondensation of chromatin and an increased communication with the outside of the nucleus. In addition, gene activation usually causes a coreplication domain that extends much beyond the decondensation domain to switch to an early replication time in S phase. This switch is produced, at least in some cases, by an early firing of origins of replication situated in flanking condensed chromatin. Some of the recently identified DNA domains that tether chromosomal loops to the nuclear matrix do represent the borders of decondensation domains. They may also constitute pausing sites for replication forks. The different replication times of successive 200- to 400-kb regions along the genome may have been the basis for the observed long-term differentiation of very large genomes in domains of different overall sequence composition (G:C content and distribution of short repeated motifs). Chromosomal bands represent a low resolution picture of this pattern. Just like gene methylation, differential replication timing and the consequent compositional differentiation of the genome have probably contributed to making the management of very large genomes workable.

Animals↗

PubMed1993

The isochore patterns of mammalian genomes and their phylogenetic implications.

The compositional distributions of high molecular weight DNA fragments from 20 species belonging to 9 out of the 17 eutherian orders were investigated by analytical CsCl density gradient centrifugation and by preparative fractionation in Cs2SO4/BAMD density gradients followed by analysis of the fractions in CsCl. These compositional distributions reflect those of the isochores making up the corresponding genomes. A "general distribution" was found in species belonging to eight mammalian orders. A "myomorph distribution" was found in Myomorpha, but not in the other rodent infraorders Sciuromorpha and Histricomorpha, which share the general distribution. Two other distributions were found in a megachiropteran (but not in microchiropteran, which, again, shares the general distribution) and in pangolin (a species from the only genus of the order Pholidota), respectively. The main difference between the general distribution and all other distributions is that the former contains sizable amounts (6-10%) of GC-rich isochores (detected as DNA fragments equal to, or higher than, 1.710 g/cm3 in modal buoyant density), which are scarce, or absent, in the other distributions. This difference is remarkable because gene concentrations in mammalian genomes are paralleled by GC levels, the highest gene concentrations being present in the GC-richest isochores. The compositional distributions of mammalian genomes reported here shed light on mammalian phylogeny. Indeed, all orders investigated, with the exception of Pholidota, seem to share a common ancestor. The compositional patterns of the megachiropteran and of Myomorpha may be derived from the general pattern or have independent origins.

Animals↗

PubMed2004

Genome-wide linkage analysis of a composite index of neuroticism and mood-related scales in extreme selected sibships.

There is considerable evidence to suggest that the genetic vulnerabilities to depression and anxiety substantially overlap and quantitatively act to alter risk to both disorders. Continuous scales can be used to index this shared liability and are a complementary approach to the use of clinical phenotypes in the genetic analysis of depression and anxiety. The aim of this study (Genetic and Environmental Nature of Emotional States in Siblings) was to identify genetic variants for the liability to depression and anxiety after the application of quantitative genetic methodology to a large community-based sample (n = 34,371), using four well-validated questionnaires of depression and anxiety. Genetic model fitting was performed on 2658 unselected sibships, which provided evidence for a single common familial factor that accounted for a substantial proportion of the genetic variances and covariances of the four scales. Using the parameter estimates from this model, a composite index of liability (G) was constructed. This index was then used to select a smaller--but statistically powerful--sample for DNA collection (757 individuals, 297 sibships). These individuals were genotyped with more than 400 microsatellite markers. After the data were checked and cleaned, linkage analysis was performed on G and the personality scale of neuroticism using the regression-based linkage program MERLIN-REGRESS. The results indicated two potential quantitative trait loci (QTL): one on chromosome 1p (LOD 2.2) around 64 cM (43-70 cM) near marker D1S2892 and another on chromosome 6p (LOD 2.7) around 47 cM (34-63 cM) near marker D6S1610. Further exploratory sex-specific analyses suggested that these QTLs might have sex-limited effects.

Adolescent↗

PubMed2001

A novel application of gene arrays: Escherichia coli array provides insight into the biology of the obligate endosymbiont of tsetse flies.

Symbiotic associations with microorganisms are pivotal in many insects. Yet, the functional roles of obligate symbionts have been difficult to study because it has not been possible to cultivate these organisms in vitro. The medically important tsetse fly (Diptera: Glossinidae) relies on its obligate endosymbiont, Wigglesworthia glossinidia, a member of the Enterobacteriaceae, closely related to Escherichia coli, for fertility and possibly nutrition. We show here that the intracellular Wigglesworthia has a reduced genome size smaller than 770 kb. In an attempt to understand the composition of its genome, we used the gene arrays developed for E. coli. We were able to identify 650 orthologous genes in Wigglesworthia corresponding to approximately 85% of its genome. The arrays were also applied for expression analysis using Wigglesworthia cDNA and 61 gene products were detected, presumably coding for some of its most abundant products. Overall, genes involved in cell processes, DNA replication, transcription, and translation were found largely retained in the small genome of Wigglesworthia. In addition, genes coding for transport proteins, chaperones, biosynthesis of cofactors, and some amino acids were found to comprise a significant portion, suggesting an important role for these proteins in its symbiotic life. Based on its expression profile, we predict that Wigglesworthia may be a facultative anaerobic organism that utilizes ammonia as its major source of nitrogen. We present an application of E. coli gene arrays to obtain broad genome information for a closely related organism in the absence of complete genome sequence data.

Animals↗

PubMed1997

Compositional differences within and between eukaryotic genomes.

Eukaryotic genome similarity relationships are inferred using sequence information derived from large aggregates of genomic sequences. Comparisons within and between species sample sequences are based on the profile of dinucleotide relative abundance values (The profile is rho*XY = f*XY/f*Xf*Y for all XY, where f*X denotes the frequency of the nucleotide X and f*XY denotes the frequency of the dinucleotide XY, both computed from the sequence concatenated with its inverted complement). Previous studies with respect to prokaryotes and this study document that profiles of different DNA sequence samples (sample size >/=50 kb) from the same organism are generally much more similar to each other than they are to profiles from other organisms, and that closely related organisms generally have more similar profiles than do distantly related organisms. On this basis we refer to the collection (rho*XY) as the genome signature. This paper identifies rho*XY extremes and compares genome signature differences for a diverse range of eukaryotic species. Interpretations on the mechanisms maintaining these profile differences center on genome-wide replication, repair, DNA structures, and context-dependent mutational biases. It is also observed that mitochondrial genome signature differences between species parallel the corresponding nuclear genome signature differences despite large differences between corresponding mitochondrial and nuclear signatures. The genome signature differences also have implications for contrasts between rodents and other mammals, and between monocot and dicot plants, as well as providing evidence for similarities among fungi and the diversity of protists.

Animals↗

PubMed2003

A compositional segmentation of the human mitochondrial genome is related to heterogeneities in the guanine mutation rate.

We applied a hidden Markov model segmentation method to the human mitochondrial genome to identify patterns in the sequence, to compare these patterns to the gene structure of mtDNA and to see whether these patterns reveal additional characteristics important for our understanding of genome evolution, structure and function. Our analysis identified three segmentation categories based upon the sequence transition probabilities. Category 2 segments corresponded to the tRNA and rRNA genes, with a greater strand-symmetry in these segments. Category 1 and 3 segments covered the protein- coding genes and almost all of the non-coding D-loop. Compared to category 1, the mtDNA segments assigned to category 3 had much lower guanine abundance. A comparison to two independent databases of mitochondrial mutations and polymorphisms showed that the high substitution rate of guanine in human mtDNA is largest in the category 3 segments. Analysis of synonymous mutations showed the same pattern. This suggests that this heterogeneity in the mutation rate is partly independent of respiratory chain function and is a direct property of the genome sequence itself. This has important implications for our understanding of mtDNA evolution and its use as a 'molecular clock' to determine the rate of population and species divergence.

Algorithms↗

PubMed1981

The major components of the mouse and human genomes. 1. Preparation, basic properties and compositional heterogeneity.

Main-band DNA from mammals and birds can be resolved by density gradient centrifugation techniques into three or four families of fragments of different dG + dC contents. These major DNA components are similar in their buoyant densities and relative amounts in all species tested and are observed in DNA preparations ranging in Mr from 2 X 10(6) to over 200 X 10(6). In the present work, the four major components of mouse and human DNAs were prepared and characterized in several basic properties: relative amounts, dG + dC contents, buoyant densities and compositional heterogeneity. The results obtained lead to the following conclusions: (a) the major DNA components of mouse and man form at least 85% and possibly the totality of the main bands of these DNAs; (b) they have very low compositional heterogeneities over a wide molecular weight range; (c) they derive from very large chromosomal DNA segments of fairly homogeneous base composition, for which the name 'isochores' is proposed. A comparison of the compositional heterogeneity of main-band DNAs from warm-blooded and cold-blooded vertebrates confirms our previous conclusion that these DNAs are characterized by a different sequence organization.

Animals↗

PubMed2025

Analysis of targeted and whole genome sequencing of PacBio HiFi reads for a comprehensive genotyping of gene-proximal and phenotype-associated Variable Number Tandem Repeats.

Variable Number Tandem repeats (VNTRs) refer to repeating motifs of size greater than five bp. VNTRs are an important source of genetic variation, and have been associated with multiple Mendelian and complex phenotypes. However, the highly repetitive structures require reads to span the region for accurate genotyping. Pacific Biosciences HiFi sequencing spans large regions and is highly accurate but relatively expensive. Therefore, targeted sequencing approaches coupled with long-read sequencing have been proposed to improve efficiency and throughput. In this paper, we systematically explored the trade-off between targeted and whole genome HiFi sequencing for genotyping VNTRs. We curated a set of 10 , 787 gene-proximal (G-)VNTRs, and 48 phenotype-associated (P-)VNTRs of interest. Illumina reads only spanned 46% of the G-VNTRs and 71% of P-VNTRs, motivating the use of HiFi sequencing. We performed targeted sequencing with hybridization by designing custom probes for 9,999 VNTRs and sequenced 8 samples using HiFi and Illumina sequencing, followed by adVNTR genotyping. We compared these results against HiFi whole genome sequencing (WGS) data from 28 samples in the Human Pangenome Reference Consortium (HPRC). With the targeted approach only 4,091 (41%) G-VNTRs and only 4 (8%) of P-VNTRs were spanned with at least 15 reads. A smaller subset of 3,579 (36%) G-VNTRs had higher median coverage of at least 63 spanning reads. The spanning behavior was consistent across all 8 samples. Among 5,638 VNTRs with low-coverage ( < 15), 67% were located within GC-rich regions ( > 60%). In contrast, the 40X WGS HiFi dataset spanned 98% of all VNTRs and 49 (98%) of P-VNTRs with at least 15 spanning reads, albeit with lower coverage. Spanning reads were sufficient for accurate genotyping in both cases. Our findings demonstrate that targeted sequencing provides consistently high coverage for a small subset of low-GC VNTRs, but WGS is more effective for broad and sufficient sampling of a large number of VNTRs.

Minisatellite Repeats↗

PubMed1999

Gene transfer, speciation, and the evolution of bacterial genomes.

Studies in microbial evolution have focused on the origin and vertical transmission of genetic variation within populations experiencing limited recombination. Genomic analyses have highlighted the importance of horizontal genetic transfer in shaping the composition of microbial genomes, providing novel metabolic capabilities, and catalyzing the diversification of bacterial lineages.

Bacteria↗

PubMed1984

The isolation and functional characterization of autoimmune clones expressing inappropriate Ia.

The MRL/lpr mouse is an inbred strain widely accepted as a model for autoimmune disease both in murine and human systems. Developed from a series of crosses involving four strains of mice, the MRL/lpr (H-2k) genome is a composite estimated to contain approximately 75% of its parental LG/J (H-2d) genome. To explore the cellular mechanism underlying lymphoproliferation in the MRL/lpr mouse, we have isolated a series of clones from the lymph nodes of MRL/lpr mice with autoimmune disease. Extensive immunofluorescent analyses of these clones, designated the PAC series, reveal expression of IAk and IEk (beta-chain) cell surface antigens, as well as inappropriate expression of IAd, IEd (beta-chain), and H-2d. PAC cells also express MAC-1, MAC-2, RA3-2C2, and RA3-6B2 and contain esterase-positive cytoplasmic granules. The capacity of PAC cells to present antigen was investigated by co-culturing PAC with IA-restricted, antigen-specific T cell hybridomas +/- antigen. These assays demonstrated the PAC inability to present antigen to IAk-restricted T cell hybridomas, as well as their capacity to present antigen to IAd-restricted T cell hybridomas. In addition, activation of MRL/lpr peritoneal macrophages using gamma-interferon resulted in increased fluorescent staining for IAd and IEd concomitant with decreased fluorescent staining for IAk. Based on these findings, we propose a model of lymphoproliferation in which Ly-1+, H-2K+ T cells proliferate to inappropriate d haplotype antigens expressed by a small subset of monocytes in the MRL/lpr lymph node. The major genomic contribution of the LG/J (H-2d) mouse may be in part responsible for inappropriate antigen expression either by age-dependent expansion of d haplotype cells or by age-regulated expression of Iad and H-2d genes.

Animals↗

PubMedDate not supplied

The role of the codon first letter in the relationship between genomic GC content and protein amino acid composition.

Analysis of the statistical distribution of amino acid compositions within 22 protein families shows that a GC bias generally affects proteins with a variety of functions from the extreme thermophile Thermus. This results in evident enrichment in amino acids of the group L, V, A, P, R and G and underrepresentation of amino acids of the group I, M, F, S, T, C and W. The strong amino acid composition biases noted in Thermus proteins are not related to thermoadaptation; they were also found in mesophilic homologues encoded by GC-rich genes. The results of a comparative analysis on large samples of translated sequences from 30 organisms, representing the three major kingdoms of life and including extremophiles, indicate a universal correlation between the usage of particular amino acids and the genomic GC content. It is concluded that the codon first letter plays a dominant role in translating the genomic GC signature into protein amino acid composition and sequences.

Amino Acid Sequence↗

PubMed1995

The human genome: organization and evolutionary history.

This review outlines briefly the compositional properties of the vertebrate genome, namely its isochore organization, the compositional patterns of DNA molecules and of coding sequences, the compositional correlations between coding and noncoding sequences, and the relationships between isochores and chromosomal bands. It then deals with the fundamental properties of the vertebrate genome, namely the distribution of genes and its associated functional features. Finally, it considers how the structural and functional organization of the human genome (and of the genomes of warm-blooded vertebrates in general) arose in evolution.

Animals↗

PubMed2003

Detection of QTL affecting fatty acid composition in the pig.

We present a QTL genome scan for fatty acid composition in pigs. An F2 cross between Iberian x Landrace pigs and a regression approach fitting the carcass weight as a covariate for QTL identification was used. Chromosomes (Chrs) 4, 6, 8, 10, and 12 showed highly significant effects. The Chr 4 QTL influenced the linoleic content and both the fatty acid double-bond index and peroxidability index. In Chr 6 we found significant associations with the double-bond index and the unsaturated index of fatty acids. Chr 8 showed clear effects on the percentages of palmitic and palmitoleic fatty acids as well as the average chain length of fatty acids. In Chr 10 we detected a significant QTL for the percentage of myristic fatty acid, with an F value that was slightly above the genomewide threshold. The percentage of linolenic fatty acid was affected by a region on Chr 12. A nearly significant QTL for the content of gadoleic fatty acid was also detected in Chr 12. We also analyzed the genomic QTL distribution by a regression model that fits the backfat thickness as a covariate. Some of the QTL that were detected in our analysis could not be detected when the data were corrected by backfat thickness. This work shows how critical the selection of a covariate can be in the interpretation of results. This is the first report of a genome scan detection of QTL directly affecting fatty acid composition in pigs.

Animals↗

PubMed2005

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus.

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 +/- 50 nm long and 22 +/- 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.

Acidianus↗

PubMed2002

Codon usage by transposable elements and their host genes in five species.

We compared the codon usage of sequences of transposable elements (TEs) with that of host genes from the species Drosophila melanogaster, Arabidopsis thaliana, Caenorhabditis elegans, Saccharomyces cerevisiae, and Homo sapiens. Factorial correspondence analysis showed that, regardless of the base composition of the genome, the TEs differed from the genes of their host species by their AT-richness. In all species, the percentage of A + T on the third codon position of the TEs was higher than that on the first codon position and lower than that in the noncoding DNA of the genomes. This indicates that the codon choice is not simply the outcome of mutational bias but is also subject to selection constraints. A tendency toward higher A + T on the third position than on the first position was also found in the host genes of A. thaliana, C. elegans, and S. cerevisiae but not in those of D. melanogaster and H. sapiens. This strongly suggests that the AT choice is a host-independent characteristic common to all TEs. The codon usage of TEs generally appeared to be different from the mean of the host genes. In the AT-rich genomes of Arabidopsis thaliana, Caenorhabditis elegans, and Saccharomyces cerevisiae, the codon usage bias of TEs was similar to that of weakly expressed genes. In the GC-rich genome of D. melanogaster, however, the bias in codon usage of the TEs clearly differed from that of weakly expressed genes. These findings suggest that selection acts on TEs and that TEs may display specific behavior within the host genomes.

Animals↗

PubMed1986

Mechanisms of DNA sequence amplification and their evolutionary consequences.

DNA sequence amplification is a phenomenon that occurs predictably at defined stages during normal development in some organisms and has been shown to occur spontaneously, but sporadically, in a variety of cells, including mammalian cells, selected for overproduction of a gene product. Developmentally programmed gene amplification includes rDNA amplification during oögenesis in amphibia, chorion protein gene amplification in Drosophila and the chromosomal changes accompanying macronuclear formation in ciliates. Selected gene amplification is illustrated by mutant mammalian cells which have been selected in vitro or in vivo for the overproduction of a gene product. In these cells the unit of DNA that is amplified is much larger than the gene under selection, and appears to be formed by multiple recombination events, which bring together sequences not normally adjacent to each other. Often the product of amplification can be seen microscopically as aberrant chromosome forms. The vast majority of DNA amplification events occur in somatic nuclei, and thus would not have any direct effect on the evolution of a genome. However, the ability to amplify DNA in somatic cells does have consequences for the composition of the genomes of the organisms in which it can occur, and should DNA amplification occur, even sporadically, in germ-line cells the potential effect on evolution would be great.

Amphibians↗