Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “frameshift mutation”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 469 records · Page 26Linked to original sources
PubMed2006

A frameshift mutation in RPGR exon ORF15 causes photoreceptor degeneration and inner retina remodeling in a model of X-linked retinitis pigmentosa.

PURPOSE: To characterize the course of retinal disease in X-linked progressive retinal atrophy 2 (XLPRA2), a canine model of early onset X-linked retinitis pigmentosa (XLRP) caused by a two-nucleotide microdeletion in RPGR ORF15. METHODS: The retinas of 25 XLPRA2-affected dogs (age range, 2-40.6 weeks) and age-matched control subjects were collected, fixed, and embedded in epoxy resin for morphologic evaluation or in optimal cutting temperature (OCT) medium for TUNEL assay and immunohistochemistry. Cell-specific antibodies were used to examine changes in rods and cones and to evaluate the effects of the primary photoreceptor degeneration on inner retinal cells. RESULTS: Abnormal development of photoreceptors was recognizable as early as 3.9 weeks of age. Outer segment (OS) misalignment was followed by their disorganization and fragmentation. Reduction in length and broadening of rod and cone inner segments (IS) was next observed, followed by the focal loss of rod and cone IS at later time points. The proportion of dying photoreceptors peaked at approximately 6 to 7 weeks of age and was significantly reduced after 12 weeks. In addition to rod and cone opsin mislocalization, there was early rod neurite sprouting, retraction of rod bipolar cell dendrites, and increased Müller cell reactivity. Later in the course of the disease, changes were also noted in horizontal cells and amacrine cells. CONCLUSIONS: XLPRA2 is an early-onset model of XLRP that is morphologically characterized by abnormal photoreceptor maturation followed by progressive rod-cone degeneration and early inner retina remodeling. The results suggest that therapeutic strategies for this retinal degeneration should target not solely photoreceptor cells but also inner retinal neurons.

Animals↗
PubMed2001

A frameshift mutation in exon 28 of the OPA1 gene explains the high prevalence of dominant optic atrophy in the Danish population: evidence for a founder effect.

Dominant optic atrophy (DOA) is a hereditary optic neuropathy characterised by decreased visual acuity, colour vision deficits, centro-coecal scotoma and optic nerve pallor. The gene OPA1, encoding a dynamin-related GTPase, has recently been identified within the genetic linkage interval for the major locus for DOA on chromosome 3q28 and shown to harbour genetic aberrations segregating with disease in DOA families. The prevalence of the disorder in Denmark is reported to be the highest of any geographical location, suggestive of a founder effect. In order to establish the genetic basis of disease in a sample of 33 apparently unrelated Danish families, we screened DNA from affected members for OPA1 gene mutations by heteroduplex analysis and direct sequencing. A novel identical mutation in exon 28 (2826delT) was associated with DOA in 14 pedigrees and led to a frameshift and abnormal OPA1 protein -COOH terminus. Haplotype analysis of a region of approximately 1 Mb flanking the OPA1 gene using eight polymorphic markers revealed a common haplotype shared by all 14 patients; this haplotype was markedly over-represented compared with ethnically matched controls. Statistical analysis confirmed significant linkage disequilibrium with DOA over approximately 600 kb encompassing the disease mutation. We have therefore demonstrated that the relatively high frequency of DOA in Denmark is attributable to a founder mutation responsible for approximately 42% of the examined families and suggest that presymptomatic screening for the (2826delT) mutation may facilitate diagnosis and genetic counselling in a significant proportion of DOA patients of Danish ancestry.

Alleles↗
PubMed1995

A frameshift mutation in the gene for PAX3 in a girl with spina bifida and mild signs of Waardenburg syndrome.

Neural tube defects (NTD) are among the most prevalent congenital malformations in man. Based on the molecular defect of Splotch, an established mouse model for NTD, and on the clinical association between NTD and Waardenburg syndrome (WS), mutations in the PAX3 gene can be expected to act as factors predisposing to human NTD. To test this hypothesis, 39 patients with familial NTD were screened by SSC analysis for mutations in exons 2 to 6 of the human PAX3 gene. One patient with lumbosacral meningomyelocele was identified with a 5 bp deletion in exon 5 approximately 55 bp upstream of the conserved homeodomain. The deletion causes a frameshift with a stop codon almost immediately after the mutated site. Clinical investigation of the index patient indicated mild signs of WS type I. Varying signs of this syndrome were found to cosegregate with the mutation in the family. Our results support the hypothesis that mutations in the gene for PAX3 can predispose to NTD, but also show that, in general, mutations within or near the conserved domains of the PAX3 protein are only very infrequently involved in familial NTD.

Amino Acid Sequence↗
PubMed1999

A heterozygous frameshift mutation in the endothelin-3 (EDN-3) gene in isolated Hirschsprung's disease.

Hirschsprung's disease, affecting one in 5000 live newborns, is the most common cause of neonatal intestinal obstruction. The obstruction or, later in life, constipation arises from the lack of enteric ganglia in the hindgut, thus resulting in poor coordination of peristalsis. Mutations in Hirschsprung patients have so far been reported in five genes associated in two different receptor-ligand systems, RET-GDNF/NTN and EDNRB-EDN-3, and an additional gene with yet unknown precise function, SOX10. We report the results of single-stranded conformation polymorphism screening of the endothelin-3 gene in a Swedish population-based material of 66 sporadic and nine familial Hirschsprung's disease cases. We have found a novel heterozygous mutation in exon 2, c.262insG, in a patient with sporadic short segment Hirschsprung's disease without any Waardenburg features. This frameshift results in a premature stop two codons further on. Because this stop is introduced 5' of the biologically active protein, this mutation can hence be predicted to result in haplo-insufficiency.

Amino Acid Sequence↗
PubMed1996

An Iranian-Armenian LDLR frameshift mutation causing familial hypercholesterolemia.

We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) analysis to detect a mutation in the low density lipoprotein receptor (LDLR) gene in a family of Iranian-Armenian origin. The mutation, designated FH Yrmeih, deletes two nucleotides from exon 10 of the LDLR gene, which causes a translational frameshift, whereby a truncated LDLR protein of the first 471 residues of the LDLR with an additional 41 abnormal residues and a premature stop codon would be created. The deletion was detected in a father and son with clinical features of heterozygous FH. To our knowledge this is the first pathogenetic LDLR mutation identified in FH patients of Iranian-Armenian ancestry.

Adolescent↗
PubMed1990

Expression analysis of a pseudogene in transgenic tobacco: a frameshift mutation prevents mRNA accumulation.

Seeds of the Pinto cultivar of the common bean, Phaseolus vulgaris, are deficient in phytohemagglutinin (PHA), a lectin normally composed of two different polypeptides (PHA-E and PHA-L). In Pinto seeds, there is no PHA-E and only small amounts of PHA-L. The gene coding for the Pinto PHA-E, Pdlec1, is a pseudogene as a result of a single base pair deletion in codon 11, causing a frameshift and premature termination of translation. This mutation explains the absence of the PHA-E polypeptide but not the several-hundredfold reduction of the cytoplasmic Pdlec1 mRNA in developing seeds when compared with a normal PHA-E gene. To find the cause for this reduction in mRNA levels, we swapped gene fragments of Pdlec1 with the homologous parts of a normal PHA gene from the cultivar Greensleeves and introduced these fusions into tobacco. Analysis of the transgenic seeds showed that the Pdlec1 promoter is fully functional. We also repaired the Pdlec1 coding frame in vitro and inserted the repaired and unrepaired versions into a PHA gene expression cassette. In transgenic tobacco, both constructs showed Pdlec1 transcript accumulation in the second half of seed maturation. The single-base frame repair boosted the peak transcript levels by a factor of 40 and resulted in the synthesis of PHA-E at normal levels. We propose that the premature translational stop caused by the frameshift leads to a faster breakdown of the Pdlec1 mRNA, thereby preventing this transcript from accumulating to high levels.

Cloning, Molecular↗
PubMed2002

De novo MECP2 frameshift mutation in a boy with moderate mental retardation, obesity and gynaecomastia.

Rett syndrome (RTT) is an X-linked neurodevelopmental disorder caused by mutations in the MECP2 gene, with apparent lethality in male embryos. However, recent studies indicate that mutations in the MECP2 gene can cause congenital encephalopathy, an Angelman-like phenotype and even nonspecific mental retardation in males. We report on a 10-year-old boy with moderate mental retardation, hypotonia, obesity and gynaecomastia and a de novo 2-bp deletion in the MECP2 gene that resulted in a frameshift and premature stop codon. As some of the clinical features were suggestive of the Prader-Willi syndrome, it might be worthwhile screening for MECP2 mutations in patients with an atypical Prader-Willi phenotype but without the characteristic abnormalities on chromosome 15q. This report contributes to the phenotypic knowledge of male patients with MECP2 mutations. Moreover, this is the first reported male case of a de novo MECP2 mutation.

Child↗
PubMed1998

A frameshift mutation at Gly975 in the transmembrane domain of GPIIb prevents GPIIb-IIIa expression--analysis of two novel mutations in a kindred with type I glanzmann thrombasthenia.

Two Hispanic siblings presenting with lifelong mucocutaneous bleeding were diagnosed clinically with Glanzmann thrombasthenia on the basis of a normal platelet count, prolonged bleeding time and absent platelet aggregation in response to multiple agonists. Quantitative analysis of the probands' platelets by flow cytometry showed a complete absence of GPIIb-IIIa, consistent with Type I thrombasthenia. Genetic analysis showed the probands to be compound heterozygotes for two novel mutations of GPIIb: a C1414>G mutation in exon 14, resulting in a premature termination codon replacing residue Tyr440, and the insertion of a G at position 3016 in exon 29, leading to a frameshift affecting the C-terminal half of the transmembrane domain and the cytoplasmic tail. The frameshifted sequence alters residues from Gly975 onwards and is predicted to significantly alter the hydropathy and charge profiles of the GPIIb transmembrane domain. The Type I phenotype associated with this mutation suggests that GPIIb residues 975-1008 contain critical structural motifs for heterodimer assembly, membrane retention, export from the ER and surface expression.

Amino Acid Sequence↗
PubMed2002

Intron retention and frameshift mutations result in severe pyruvate carboxylase deficiency in two male siblings.

This paper describes the molecular characterization of two male siblings displaying the complex (Type B) form of pyruvate carboxylase (PC) deficiency in which severe neonatal lactic acidosis and redox abnormalities results in death within the first few weeks of life. The two male siblings were found to be compound heterozygous for a TAGG deletion at the exon15/intron15 splice site (IVS15+2-5delTAGG) and a dinucleotide deletion in exon 16 (2491-2492delGT) of the PC gene. We also demonstrate through RT-PCR and sequencing of aberrant transcripts that the IVS15+2-5delTAGG results in the retention of intron 15 during pre-mRNA splicing. In addition, both deletions are predicted to result in a frameshift to generate a premature termination codon such that the encoded mRNA could be subject to nonsense mediated decay.

Alternative Splicing↗
PubMed1969

Nature of the hisD3018 frameshift mutation in Salmonella typhimurium.

Histidinol dehydrogenase from three differing revertants of ICR-191A-induced frameshift hisD3018 has been purified and examined for amino acid replacements. The enzyme from one spontaneously arising revertant, R7, contains an extra proline residue, whereas that from another, R5, contains an extensive frameshifted sequence, four amino acid residues of which have been identified to date. The amino acid replacement data are in agreement with the in vitro code word assignments and allow the characterization of the hisD3018 frameshift as an addition of one nucleotide pair, most likely guanine plus cytosine. Enzymatic data for those ICR-191A-induced revertants of hisD3018 arising within the hisD gene indicate that the enzyme is wild type and, therefore, that ICR-191A can cause deletions as well as additions of single base pairs. The wild-type amino acid sequence is restored in enzyme from an N-methyl-N'-nitro-N-nitrosoguanidine (NG)-induced revertant, R29, suggesting that NG is a base-deleting as well as a base-substituting mutagen. The unusual response of hisD3018 to external suppressors is considered in terms of reinitiation of protein synthesis out of phase, coupled with suppression of a nonpermissive missense codon so generated, and of an alternative hypothesis invoking a true frameshift suppressor transfer ribonucleic acid with an extended or deleted anticodon.

Acridines↗
PubMed1998

C1 inhibitor gene sequence facilitates frameshift mutations.

Mutations disrupting the function or production of C1 inhibitor cause the disease hereditary angioneurotic edema. Patient mutations identified an imperfect inverted repeat sequence that was postulated to play a mechanistic role in the mutations. To test this hypothesis, the inverted repeat was cloned into the chloramphenicol acetyltransferase gene in pBR325 and its mutation rate was studied in four bacterial strains. These strains were selected to assay the effects of recombination and superhelical tension on mutation frequency. Mutations that revert bacteria to chloramphenicol resistance (Cmr) were scored. Both pairs of isogenic strains had reversion frequencies of approximately 10(-8). These rare reversion events in bacteria were most often a frameshift that involved the imperfect inverted repeat with a deletion or a tandem duplication, an event very similar to the human mutations. Increased DNA superhelical tension, which would be expected to enhance cruciform extrusion, did not accentuate mutagenesis. This finding suggests that the imperfect inverted repeat may form a stem-loop structure in the single-stranded DNA created by the duplex DNA melting prior to replication. Models explaining the slippage can be drawn using the lagging strand of the replication fork. In this model, the formation of a stem-loop structure is responsible for bringing the end of the deletion or duplication into close proximity.

Angioedema↗
PubMed2003

Frameshift mutation of the zinc finger homeo box 1 B gene in syndromic corpus callosum agenesis (Mowat-Wilson syndrome).

We report a girl who had Hirschsprung disease in association with distinct facial appearance, microcephaly, agenesis of the corpus callosum and mental retardation (Mowat-Wilson syndrome). Mutation analysis of the zinc finger homeo box 1 B (ZFHX1 B) gene revealed a de novo 7 bp deletion (TGGCCCC) at nucleotide 1773 (1773 delTGGCCCC) resulting in a frameshift and leading to a termination codon at amino acid residue 604 (604 X) in exon 8 C. The zinc finger homeo box 1 B (Smad interacting protein-1) is a transcription corepressor of Smad target genes with functions in the patterning of neural crest derived cells, CNS, and midline structures. Mutations in ZFHX1 B can lead to neurological disorders in addition to dysmorphic features, megacolon, and other malformations.

Abnormalities, Multiple↗
PubMed2002

Autosomal dominant stapes ankylosis with broad thumbs and toes, hyperopia, and skeletal anomalies is caused by heterozygous nonsense and frameshift mutations in NOG, the gene encoding noggin.

Although fixation of the stapes is usually progressive and secondary to otosclerosis, it may present congenitally, with other skeletal manifestations, as an autosomal dominant syndrome-such as proximal symphalangism (SYM1) or multiple-synostoses syndrome (SYNS1), both of which are caused by mutations in NOG, the gene encoding noggin. We describe a family that was ascertained to have nonsyndromic otosclerosis but was subsequently found to have a congenital stapes ankylosis syndrome that included hyperopia, a hemicylindrical nose, broad thumbs and great toes, and other minor skeletal anomalies but lacked symphalangism. A heterozygous nonsense NOG mutation-c.328C-->T (Q110X), predicted to truncate the latter half of the protein-was identified, and a heterozygous insertion in NOG-c.252-253insC, in which the frameshift is predicted to result in 96 novel amino acids before premature truncation-was identified in a previously described second family with a similar phenotype. In contrast to most NOG mutations that have been reported in kindreds with SYM1 and SYNS1, the mutations observed in these families with stapes ankylosis without symphalangism are predicted to disrupt the cysteine-rich C-terminal domain. These clinical and molecular findings suggest that (1) a broader range of conductive hearing-loss phenotypes are associated with NOG mutations than had previously been recognized, (2) patients with sporadic or familial nonsyndromic otosclerosis should be evaluated for mild features of this syndrome, and (3) NOG alterations should be considered in conductive hearing loss with subtle clinical and skeletal features, even in the absence of symphalangism.

Abnormalities, Multiple↗
PubMed2004

A form of albinism in cattle is caused by a tyrosinase frameshift mutation.

We used PCR amplification of cDNA prepared from skin biopsies to determine the full-length protein-coding sequence of tyrosinase ( TYR) in cattle of several coat colors. An insertion of a cytosine was detected in an albino Braunvieh calf, which resulted in a frameshift which caused a premature stop codon at residue 316. This insertion was found in the homozygous state in this calf and the genomic DNA of two related albino calves. All six parents of these calves were heterozygous for this insertion. However, an albino Holstein calf did not have this insertion, nor was any other mutation detected in the partial TYR sequence obtained from the genomic DNA available. Diagnostic genotyping tests were developed to detect this mutation in Braunvieh cattle.

Albinism↗
PubMed2005

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Blotting, Southern↗
PubMed1999

A novel frameshift mutation in the first exon of the 21-OH gene found in homozygosity in an apparently nonconsanguineous family.

Congenital adrenal hyperplasia is most frequently due to steroid 21-hydroxylase (21-OH) deficiency. Due to the existence of a pseudogene in tandem duplicated with the 21-OH gene, asymmetric recombination causes the majority of the molecular defects underlying this deficiency: gene conversions and deletions of the functional gene. Screening for a small array of mutations, those existing in the pseudogene together with deletions, allows the characterization of most mutated alleles, 91% in the Spanish population. We report the case of a boy from a nonconsanguineous family, diagnosed during the neonatal period of a salt-wasting form of the deficiency, in which this screening did not allow the characterization of the paternal or the maternal allele. This infrequent finding in a nonconsanguineous family was further investigated. Single-strand conformation polymorphism screening for new mutations revealed an abnormally migrating pattern when polymerase chain reaction fragments from 21-OH gene exon 1 of the patient and relatives were analyzed. Upon direct sequencing, the insertion of a T at position 64 (64insT, frameshift generating a stop codon at exon 2) was found in homozygosity in the patient. Microsatellite typing in the HLA region revealed the patient to be homozygous for five markers (heterozygosities 0.62 to 0.74). Apparently this new mutation was generated several generations ago and has been preserved for years. Consanguinity had been discarded for several generations, although both families could be traced back to a small rural area in Navarra (Spain).

Amino Acid Sequence↗
PubMed1984

UV-induced reversion of his4 frameshift mutations in rad6, rev1, and rev3 mutants of yeast.

The UV-induced reversion of two his4 frameshift alleles was much reduced in rad6 mutants of Saccharomyces cerevisiae, an observation that is consistent with the hypothesis that RAD6 function is required for the induction of all types of genetic alteration in misrepair mutagenesis. The reversion of these his4 alleles, together with two others of the same type, was also reduced in rev1 and rev3 mutant strains; in these, however, the extent of the reduction varied considerably with test allele used, in a manner analogous to the results in these strains for base repair substitution test alleles. The general features of UV-induced frameshift and substitution mutagenesis therefore appear quite similar, indicating that they may depend on related processes. If this conclusion is correct, greater attention must be given to integrating models which account for the production of nucleotide additions and deletions into those concerning misrepair mutagenesis.

Base Composition↗
PubMed1996

The dnrM gene in Streptomyces peucetius contains a naturally occurring frameshift mutation that is suppressed by another locus outside of the daunorubicin-production gene cluster.

A 2 center dot 7 kb BamHI fragment of the daunorubicin biosynthetic cluster in Streptomyces peucetius ATCC 29050 was shown to contain two ORFs, dnrL and dnrM, whose deduced products exhibit a high sequence similarity to a number of glucose-1-phosphate thymidylyl transferases and TDP-D-glucose dehydratases, respectively. Although these genes were believed to be necessary for the synthesis of the deoxyaminosugar, daunosamine, a constituent of daunorubicin, the dnrM gene contains a frameshift in the DNA sequence that causes the premature termination of translation. A gene encoding another TDP-glucose 4,6-dehydratase, previously isolated from S. peucetius, was identified by PCR amplification of genomic DNA. The presence of this gene explains why a dnrM::aphll mutation did not block daunorubicin production.

Amino Acid Sequence↗