Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Oligonucleotide Array Sequence Analysis”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 469 records · Page 26Linked to original sources
PubMed2006

Reagentless ultrasensitive specific DNA array detection based on responsive polymeric biochips.

Self-assembled molecular structures immobilized on solid substrates and composed of fluorophore-tagged oligonucleotide probes and an optical polymeric transducer were investigated for the trace level detection of DNA target molecules. Rapid and efficient energy transfer between the polymeric transducer and fluorophores within the molecular aggregates leads to a massive intrinsic amplification of the fluorescence signal and to the label-free detection of as little as 300 DNA molecules, with the specificity required for the detection of single-nucleotide mismatches. This capacity for attomolar detection levels while the sensing structures are attached onto solid supports could lead to the development of biochip platforms for fast and simple PCR-free multitarget DNA detection.

Base Pair Mismatch↗
PubMedDate not supplied

Alpha-oxo semicarbazone peptide or oligodeoxynucleotide microarrays.

We describe in this paper the preparation and characterization of semicarbazide glass slides and their use for the fabrication of microarrays using site-specific alpha-oxo semicarbazone ligation. The functional density and homogeneity of the semicarbazide glass slides were optimized by analyzing the reactivity of the layer toward a synthetic glyoxylyl fluorescent probe. Oligonucleotide microarrays were prepared by site-specific immobilization of glyoxylyl oligodeoxynucleotides. The slides were directly used in the hybridization assays using fluorescence detection and displayed a significant gain in sensibility as compared to the aldehyde glass slide/amino oligodeoxynucleotide chemistry. Semicarbazide slides were also used for the immobilization of a biotinylated peptide alpha-oxo aldehyde. The peptide microarrays allowed model interaction studies with streptavidin or an anti-biotin antibody.

Aldehydes↗
PubMedDate not supplied

A rapid method for the construction of oligonucleotide arrays.

A simple method has been devised to construct oligonucleotide array on a variety of surfaces using commonly available reagents and chemistry with good efficiency and accuracy. The method involves the generation of hydroxyl functionalities on glass, polypropylene, polyethylene, and commonly used surfaces for construction of oligonucleotide arrays followed by their activation with trifluoroethanesulfonyl chloride (tresyl chloride). The activated surface in the subsequent reaction is used to covalently immobilize oligonucleotides in regioselective fashion to create an oligonucleotide array. The surface bound tresyl sulfonate esters allow the immobilization of oligonucleotides specifically via their 3'- or 5'-end having mercaptohexyl- or aminohexyl functionalities. The constructed oligonucleotide arrays were successfully used to analyze oligonucleotides by hybridization technique.

Hydroxyl Radical↗
PubMedDate not supplied

Polymer-oligonucleotide conjugate synthesis from an amphiphilic block copolymer. Applications to DNA detection on microarray.

An amphiphilic block copolymer poly(tert-butylacrylamide-b-(N-acryloylmorpholine-N-acryloxysuccinimide)) (poly(TBAm-b-(NAM/NAS)) and a random copolymer poly(NAM/NAS), synthesized by the reversible addition-fragmentation chain transfer (RAFT) polymerization process, have been used as support for oligonucleotide (ODN) synthesis, to elaborate polymer-oligonucleotide conjugates. In a first step, starters of ODN solid-phase synthesis were coupled to activated ester functions of polymers, and second, resulting functionalized polymers were covalently grafted onto hydroxylated controlled pore glass (CPG) support to further accomplish ODN synthesis. An efficient capping of residual hydroxyl functions of CPG was performed before synthesis, with both acetic anhydride and diethoxy-N,N-diisopropyl-phosphoramidite reagents, to suppress parasite-free ODN population present in conjugate crude material and resulting from syntheses directly initiated on silica beads. After purification, conjugates were evaluated in a DNA hybridization assay on a microarray, as macromolecules being able to favor capture of the target. Conjugate coating conditions were studied on the dT25/dA25 model. The role of the hydrophobic part (poly(TBAm)) of the conjugate synthesized with the block copolymer in the orientation of the conjugate after coating was revealed by spotting experiments achieved in a mixed solvent (DMF/H(2)O). The use of block copolymer-dT25 conjugate afforded a significant sensitivity improvement of the hybridization assay.

Amides↗
PubMedDate not supplied

Microstructured liposome array.

Conversion of a DNA chip to a nanocapsule array was performed by grafting on a liposome an oligonucleotide complementary to an oligonucleotide bound to the array. Each liposome may be loaded by a soluble molecule or may present a hydrophobic or amphiphilic molecule inserted in its wall. To detect liposomes on the chip, we used fluorescent dyes encapsulated in the liposome internal volume or fluorescent lipids. We observed that an oligonucleotide-grafted liposome containing a defined dye specifically accumulated on the area where its complementary oligonucleotide had been spotted on the array. The virtually unlimited amount of addresses allows the specific binding of large amounts of liposomes in one single batch.

Liposomes↗
PubMedDate not supplied

A structured chitosan-based platform for biomolecule attachment to solid surfaces: application to DNA microarray preparation.

A structured chemical platform based on chitosan, an amine-rich polysaccharide, is presented as an alternative chemistry to functionalize solid support (in this case, glass slides) for grafting biomolecules. This approach has been adopted for generating arrays using amino-modified oligonucleotides with two different lengths (25-mer and 70-mer) for different purposes. Results using these chitosan-activated surfaces indicate high oligonucleotide loading capacity, good availability to hybridization against targets, and effectiveness in enzyme-mediated single nucleotide polymorphism (SNP) detection procedures by DNA polymerase and DNA ligase enzymes with low background. Universal arrays have been prepared and extensively used with excellent results in different applications. The chitosan-treated surfaces were also evaluated for their performance in a gene expression experiment.

Chitosan↗
PubMedDate not supplied

Oligonucleotide microarrays: immobilization of phosphorylated oligonucleotides on epoxylated surface.

A facile and efficient method for direct immobilization of phosphorylated oligonucleotides on an epoxy-activated glass surface is described. The new immobilization strategy has been analyzed for its performance in DNA microarray under both microwave and thermal conditions. It reflects high immobilization efficiency ( approximately 23%), and signal-to-noise ratio ( approximately 98) and resulted in high hybridization efficiency ( approximately 36%) in comparison to those obtained with standard methods, viz., NTMTA ( approximately 9.76%) and epoxide-amine ( approximately 9.82%). The probes immobilized through the new strategy were found to be heat-stable, since the performance of microarray decreased by only approximately 7% after subjecting it to 20 PCR-like heat cycles, suggesting that the chemistry could be used in integrated PCR/microarray devices. The immobilization of probes following the proposed chemistry resulted in spots of superior quality in terms of spot morphology, spot homogeneity, and signal reproducibility. The constructed microarrays have been successfully used for the discrimination of nucleotide mismatches. In conclusion, these features make the new immobilization strategy ideal for facile, efficient, and cost-effective manufacturing of DNA microarrays.

Epoxy Compounds↗
PubMedDate not supplied

Photoimmobilization for microarrays.

A photoimmobilization method has been developed for the preparation of microarray biochips. This photoimmobilization method makes it possible to easily covalently immobilize various types of organic molecules and cells on a chip. In addition, by using hydrophilic polymers as matrixes, it is possible to reduce nonspecific interactions with biological components. Various proteins, antibodies, and cells have been microarrayed using this technique, and interactions between these proteins, antibodies, and cells have been investigated. This type of microarray biochip will be important for academic applications such as genomics, proteomics, and cellomics, and clinical analyses.

Animals↗
PubMed2003

Combinatorial decoding: an approach for universal DNA array fabrication.

A fiber optic microsphere-based oligonucleotide array is described that employs the sequence of the oligonucleotide probe attached to each microsphere as positional identifiers. Each microsphere serves as an immobilized array feature, functionalized with a unique single-stranded oligonucleotide sequence and randomly distributed into an array of microwells. To determine the sequences attached to individual microspheres, a series of fluorescently labeled combinatorial-pooled oligonucleotide target solutions was designed. Each combinatorial decoding solution is intended to identify the nucleotide at a particular position on every microsphere in the array. The combinatorial target solutions were synthesized by linking the four possible nucleotides at each position to four different fluorescent reporter dyes. As such, when the solutions were hybridized to the array, one of four possible fluorescent responses was generated for each position on a microsphere probe sequence. Adjusting the stringency of hybridization enabled single-base mismatch discrimination, and the signal with the highest intensity corresponded to the perfect nucleotide match. By consecutively exposing the array to a series of combinatorial decoding pool solutions, it was possible to simultaneously determine the sequence of every randomly positioned oligonucleotide-functionalized microsphere in the array. Once mapped, the microsphere array can be used for any typical genomic microarray experiment.

Base Sequence↗
PubMed2004

New approach to oligonucleotide microarrays using zirconium phosphonate-modified surfaces.

A new approach to oligonucleotide arrays is demonstrated that utilizes zirconium phosphonate-derivatized glass slides. The active slides are prepared by binding Zr(4+) to surfaces terminated with organophosphonate groups previously deposited using either Langmuir-Blodgett or self-assembled monolayer methods. Oligonucleotide probes modified with a terminal phosphate bind strongly to the active zirconium phosphonate monolayer, and arrays for detecting fluorescent targets have been prepared using commercial spotting and scanning instruments. Preferred binding to the surface of the terminal phosphate of the modified probes instead of the internal phosphate diester groups is demonstrated and shown to yield increased fluorescence intensity after hybridization with labeled targets. A significant decrease in background signal is achieved by treating the slides with bovine serum albumin after spotting and before hybridization. A further increase in fluorescence after hybridization is observed when using a poly-guanine spacer between the probe oligomer and the terminal phosphate. Combining these modifications, an intensity ratio of nearly 1000 is achieved when comparing 5'-phosphate-modified 33-mer probes with unmodified probes upon hybridization with fluorescent targets.

Glass↗
PubMed2004

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.

Chromatography, High Pressure Liquid↗
PubMed2006

Rewritable DNA microarrays.

Thiol-terminated single-stranded deoxyribonucleic acids (ssDNA) can be immobilized onto pulsed plasma deposited poly(allylmercaptan) surfaces via disulfide bridge chemistry and are found to readily undergo nucleic acid hybridization. Unlike other methods for oligonucleotide attachment to solid surfaces, this approach is shown to be independent of substrate material or geometry, and amenable to highly efficient rewriting.

DNA, Single-Stranded↗
PubMed2006

Replication of DNA microarrays from zip code masters.

This report describes a mechanical method for efficient and accurate replication of DNA microarrays from a zip code master. The zip code master is a DNA array that defines the location of oligonucleotides consisting of two parts: a code sequence, which is complementary to one or more of the zip codes, and the functional sequence, which is terminated with biotin. Following hybridization of the zip code to the code sequence, a replica surface functionalized with streptavidin is brought into conformal contact with the surface of the master. When the two surfaces are separated, the functional and code sequences are transferred to the replica, and the zip code remains on the surface of the master. Using this approach it is possible to prepare replica arrays having any configuration from a single, universal master array. Here we demonstrate that this approach can be used to replicate master arrays having up to three different sequences, that feature sizes as small as 100 microm can be replicated, and that master arrays can be used to prepare multiple replicas.

Biotin↗
PubMed2005

Development of a peptide nucleic acid array platform for the detection of genetically modified organisms in food.

Two previously developed platforms, a multiplex polymerase chain reaction (PCR) and a peptide nucleic acid (PNA) array, the former allowing for the simultaneous detection of five transgenes and two endogenous controls in food and feed matrices and the latter for the assessment of the identity of amplified PCR products, were combined in order to develop a PNA array device for the screening of genetically modified organisms (GMOs) in food. PNA probes were opportunely designed, synthesized, and deposited on commercial slides. The length of the probes as well as the distance of the probes from the surface were evaluated and found to be critical points. The most suitable probes were found to be 15-mer PNAs linked to the slide surface by means of two 2-(2-aminoethoxy)ethoxyacetic acids as spacers. The device was tested on a model system constituted by flour samples containing a mixture of standards at known concentrations of transgenic material, in particular Roundup Ready soybean and Bt11, Bt176, Mon810, and GA21 maize: The DNA was amplified using the specific multiplex PCR method and tested on the PNA array. The method proposed was found to be able to correctly identify every GMO present in the tested samples.

DNA, Plant↗
PubMed2006

Characterization of DNA hybridization on partially aminated diamond by aromatic compounds.

Here, we report a novel method of micropatterning oligonucleotides via aromatic groups as linkers on partially amino-terminated diamond and the inherence on subsequent hybridization. The covalent immobilization of probe oligonucleotides and characterization of immobilized probe oligonucleotides with carboxylic compounds were investigated by X-ray photoelectron spectroscopy (XPS). To confirm the effects of linker flexibility in a low amino group on diamond for probe oligonucleotides, three kinds of dicarboxylic compound--adipic acid, terephthalic acid, and trimesic acid--were used for immobilization of probe oligonucleotides, like linkers; and these oligonucleotides were hybridized with target oligonucleotides labeled with Cy 5 on the micropatterned diamond surface. The hybridization intensities determined by epifluorescence microscopy were compared and analyzed.

Carbocyanines↗
PubMed2006

Hybridization at a surface: the role of spacers in DNA microarrays.

Flexible spacer chains are utilized to enhance the hybridization of terminally anchored oligonucleotide probes of DNA microarrays. A polymer physics approach identifies an underlying mechanism and yields guidelines for the optimal spacer length in terms of the effect on the equilibrium state. For low grafting densities, the dominant effect arises because of the decimation in the number of accessible chain configurations due to the impenetrable surface. Opposing trends are found for long targets and for short targets. At higher grafting densities, different brush regimes introduce an extra hybridization penalty. A novel brush regime is obtained for long neutral spacers and short targets at intermediate ionic strength where the chain stretching is due to the electrostatic interactions between the probes.

Models, Chemical↗
PubMed2006

Hybridization of DNA to bead-immobilized probes confined within a microfluidic channel.

We report the factors influencing the capture of DNA by DNA-modified microbeads confined within a microfluidic channel. Quantitative correlation of target capture efficiency to probe surface concentration, solution flow rate, and target concentration are discussed. The results indicate that the microfluidic system exhibits a limit of detection of approximately 10(-10) M (approximately 10(-16) mol) DNA and a selectivity factor of approximately 8 x 10(3). Typical hybridization times are on the order of minutes.

Biotinylation↗