Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Bread”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 469 records · Page 26Linked to original sources
PubMed1987

Relative nutritional availability to rats of selenium in Finnish spring wheat (Triticum aestivum L.) fertilized or sprayed with sodium selenate and in an American winter bread wheat naturally high in Se.

A Finnish national programme to fertilize crops with sodium selenate led us to compare the nutritional availability to rats of selenium in two Finnish spring wheats (Triticum aestivum L.), either fertilized or sprayed with sodium selenate, with that in an American winter bread wheat naturally high in Se. Weanling male rats were given a Se-deficient Torula yeast diet for 4 weeks followed by either continued depletion or repletion for 4 weeks with graded levels of Se as sodium selenite (standard) or wheat (test food). Plasma and liver Se levels and plasma and liver glutathione peroxidase (EC 1.11.1.9; GSH-Px) activities were used as criteria of body Se status. The availability of Se under these conditions was calculated with the point-slope technique at two dietary levels of Se (Expt 1) and with the slope-ratio method (Expt 2). In the point-slope assay, the level of dietary Se fed had a considerable effect on the apparent availability values obtained which made interpretation of the results difficult. In the slope-ratio assay, no difference in the availability of Se from the various wheats was observed when plasma or liver Se levels were used as the response criteria. The Se in the fertilized wheat was somewhat more available than that in the sprayed wheat when plasma or liver GSH-Px activities were the response criteria. Overall, availability values (%) derived by averaging all four response criteria were 86, 77 and 73 for the fertilized and sprayed Finnish wheats and the American wheat respectively (sodium selenite 100). These results show that wheat is a relatively available source of Se to rats regardless of whether its Se content is naturally high or is increased by fertilization or spraying.

Animals↗
PubMed2006

Postprandial serum folic acid response to multiple doses of folic acid in fortified bread.

The benefit of the introduction of mandatory folic acid fortification of all flour products in the USA in 1998 has been amply demonstrated in a reduction of neural tube defect births. Doubt has been cast on the actual level of fortification and recent calculations have shown that the level of folic acid fortification is likely to have been over twice the amount mandated. The implication of this is that a greater proportion of the population are likely to have consumed folic acid at >1 mg/d, the Food and Drug Administration safe upper level of intake. Using the criteria of appearance of synthetic folic acid in serum, the objective of this pilot study was to investigate the consequences of consumption of baked bread preparations containing 1 mg folic acid. Four healthy adult volunteers undertook each dosing schedule 2 weeks apart. This consisted of a single dose of 1000 microg, two doses of 500 microg, three doses of 333 microg, five doses of 200 microg and, finally, ten doses of 100 microg. Serum was collected pre- and postprandially and analysed for synthetic folic acid by a combined HPLC-microbiological assay for folic acid. Folic acid appeared in all subjects at all test doses, with the effect more pronounced as the standard dose was administered in smaller amounts over the test period. Approaches to optimise folic acid intake in target populations as part of a universal fortification strategy should take into consideration the potential hazard of over-exposure in groups consuming high amounts of flour-based products.

Adult↗
PubMedDate not supplied

A survey of ethyl carbamate in beverages, bread and acidified milks sold in Denmark.

A sensitive gas-chromatographic method of analysis using mass specific detection has been applied to a study of ethyl carbamate in the Danish diet. Beverages and foods which were assumed to give a major contribution to the exposure of the Danish population to this potentially carcinogenic compound were investigated. Average values, ranges obtained for concentrations of ethyl carbamate and the number of analyses were 534 micrograms/l (< 5-5000 micrograms/l, n = 22) in spirits, 30 micrograms/l (7-61 micrograms/l, n = 14) in fortified wines, 7 micrograms/l (< 3-29 micrograms/l, n = 57) in wine, 3 micrograms/l (0.2-6.6 micrograms/l, n = 50) in beer, 3.5 micrograms/kg (0.8-12 micrograms/kg, n = 33) in bread and 0.2 microgram/kg (< 0.1-0.3 microgram/kg, n = 19) in yogurts and other acidified milk products. It is estimated that the average daily intake of ethyl carbamate is approximately 2 micrograms per person. The 5% of Danish males who have the highest alcohol intake probably consume more than 7 micrograms of ethyl carbamate per day.

Animals↗
PubMedDate not supplied

Use of low-glycaemic index bread to reduce 24-h blood glucose: implications for dietary advice to non-diabetic and diabetic subjects.

The present study investigated the effect of a simple dietary change on 24-h blood glucose. In a randomized cross-over design, 10 healthy subjects were prescribed a low-glycaemic-index (LGI) diet and a high-glycaemic-index (HGI) diet. The diets were identical with the exception of the type of bread consumed (LGI or HGI). Glucose concentrations over 24 h were measured using a continuous glucose monitoring system. The LGI diet resulted in a lower mean glucose response compared with the HGI diet over 24 h (P=0.135), during the day (P=0.171) and at night (P=0.100). Similarly, the 24-h, daytime and overnight incremental area under the curve for glucose following the LGI diet was consistently lower than following the HGI diet (P=0.093, P=0.132 and P=0.061, respectively). The results demonstrate how a very simple dietary change can favourably alter overall blood glucose concentrations. Such small modifications to the diet, if adopted in the long term, could improve glucose control and consequently reduce the risk of chronic disease in both diabetic and non-diabetic individuals.

Adolescent↗
PubMed1985

Effects of supplementation with high-selenium wheat bread on selenium, glutathione peroxidase and related enzymes in blood components of New Zealand residents.

The effects of supplementation with high-Se wheat bread on selenium (Se) concentrations, glutathione peroxidase (EC 1.11.1.9, GSHPx) activities and related enzymes in the prevention of lipid peroxidation were studied. Four New Zealand women were supplemented with 200 micrograms Se daily for 8-13 weeks followed by a post-dosing period of 9-12 weeks. GSHPx activities increased in whole blood, erythrocytes, plasma and platelets of all subjects but increases were considerably less than those of Se concentrations in whole blood, plasma and erythrocytes. During the post-dosing period Se concentrations and GSHPx activities fell to levels which were in most cases somewhat higher than baseline values. Glutathione-S-transferase activities in erythrocytes, plasma and platelets did not change during the study, nor did superoxide dismutase in erythrocytes and platelets, erythrocyte catalase or plasma alpha-tocopherol. Thus Se supplementation of healthy New Zealand subjects increased GSHPx activities but did not produce any adaptive changes in other components of the lipid peroxidation defense mechanisms.

Adult↗
PubMed1993

A 1-y trial of the effect of high-selenium bread on selenium concentrations in blood and toenails.

The concentration of selenium in toenail clippings and blood reflects dietary intake better than does intake calculated from dietary data because of the highly variable selenium concentration in different samples of the same food. However, the time course of selenium intake in relation to subsequent concentrations in toenail clippings is unclear. Therefore, 12 males were fed high-dose (4.91 mumol Se/d), medium-dose (2.61 mumol Se/d), or control (0.41 mumol Se/d) whole-wheat-bread for 1 y and the concentration of selenium was measured in toenail clippings collected every 12 wk for 2 y. Toenail selenium concentration was unaffected by dietary intake in the previous 3 mo and appeared to provide a time-integrated measure of intake over a period of 26-52 wk. Use of selenium concentration in toenail clippings may be an alternative to blood when a measure of long-term average intake is desired. The absence of a short-term effect of diet on toenail selenium concentration also makes this a useful marker of intake in retrospective studies.

Adult↗
PubMed1980

Mutagenicity in Salmonella typhimurium of N-3-methylbutyl-N-1-methyl-acetonyl-nitrosamine and N-methyl-N-benzylnitrosamine, N-nitrosation products isolated from corn-bread contaminated with commonly occurring moulds in linshien county, a high incidence area for oesophageal cancer in Northern China.

Two synthetic N-nitrosamines (N-3-methylbutyl-N-1-methyl acetonylnitrosamine and N-methyl-N-benzylnitrosamine), previously isolated from corn-bread which had been inoculated with moulds occurring in Linshien county, Northern China and subsequent nitrosation by sodium nitrite, were tested in Salmonella typhimurium strains TA1535 and TA100 in the presence of a liver postmitochondrial supernatant from Aroclor-treated rats. A concentration-dependent increase in the number of mutant colonies in both bacterial strains was observed when N-3-methylbutyl-N-1-methylacetonyl-nitrosamine was assayed in liquid suspension and N-methyl-N-benzylnitrosamine in plate incorporation assays. Our finding that mutagenic N-nitrosamines are present in foodstuffs that may be consumed in Linshien county are discussed in relation to the possible etiological role of these compounds in cancer of the oesophagus in that area.

Animals↗
PubMed2003

Rye bread in the diet of pigs enhances the formation of enterolactone and increases its levels in plasma, urine and feces.

To obtain new insight into the quantitative and qualitative metabolism of rye and wheat lignans, we performed three series of experiments with catheterized pigs. Two diets with similar levels of dietary fiber and macronutrients but with contrasting levels of plant lignans (isolariciresinol, lariciresinol, matairesinol, pinoresinol, secoisolariciresinol and syringaresinol) were prepared from rye (high in lignans) and wheat (low in lignans) soft and crisp breads. In two series of experiments we quantified the uptake from the gut of enterolactone in four pigs fitted with catheters in the portal vein and mesenteric artery and with an ultrasonic flow probe attached to the portal vein to monitor the blood flow. In a third study with six pigs, we quantified the bioavailability of the plant lignans that can be converted to enterolactone (lariciresinol, matairesinol, pinoresinol, secoisolariciresinol and syringaresinol) and the concentration in the peripheral blood. Plant and mammalian lignans in diets and stool were analyzed by isotope dilution gas chromatography-mass spectrometry and enterolactone in plasma and urine determined by time-resolved fluoroimmunoassay. There was a significantly higher formation of enterolactone in pigs fed the rye diet, and higher fecal and urinary excretion and circulating levels of mammalian lignans than in pigs fed the wheat diet. The conversion of mammalian lignan precursors to enterolactone was 48% with the wheat diet and 60% with the rye diet. Mammalian lignans are absorbed by passive diffusion from the large intestine and a substantial fraction of the absorbed mammalian lignans undergoes enterohepatic circulation, resulting in low diurnal variation in plasma levels of enterolactone.

4-Butyrolactone↗
PubMed2005

Rye bread enhances the production and plasma concentration of butyrate but not the plasma concentrations of glucose and insulin in pigs.

The present investigation was undertaken to study the gastrointestinal and physiologic properties of diets based on soft and crisp wheat and rye breads similar in dietary fiber (DF; 230-235 g/kg dry matter) but with different proportions of the main DF polymers: in wheat, cellulose, and in rye, arabinoxylans (AX). The 2 diets provided all macronutrients; consequently, they had lower fat and sugar contents and a higher DF content than human mixed diets. The nutritional properties were studied in experiments in which pigs with cannulated ilea and catheterized portal veins and mesenteric arteries served as models for humans. The characteristics studied were degradation of nutrients, flow at the ileum, fecal output, absorption of nutrients deriving from the assimilation of cereal carbohydrates, and the insulin response. Apparent viscosity at the terminal small intestine, the ileal flow of water, flow and digestibility of noncarbohydrate constituents, but not of carbohydrates at the terminal ileum or the plasma concentrations of glucose and insulin, were higher when pigs consumed the rye compared with the wheat diet. The 2 diets provided approximately equal amounts of carbohydrates available for fermentation in the large intestine but because AX from the rye diet was more degradable than cellulose from the wheat diet, the quantitative degradation in the large intestine was more than twice as high when pigs consumed the former compared with the latter diet. The consequences included moister feces and significantly enhanced gut production and plasma concentrations of butyrate when pigs consumed the rye diet compared with the wheat diet.

Animal Feed↗
PubMedDate not supplied

Bread-making as a source of vaginal infection with Saccharomyces cerevisiae. Report of a case in a woman and apparent transmission to her partner.

We report the case of a woman, who baked her own bread, acquiring a vulvovaginal infection caused by saccharomyces cerevisiae, a yeast used extensively in the baking and brewing industries. Her partner was also infected, and the infections proved difficult to eradicate. Oral and topical treatment with nystatin along with disinfection of both patients' underwear produced clinical and microbiologic cure.

Adult↗
PubMed2004

Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat.

Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus-specific primers is an important step toward cloning specific LMW glutenin subunits (LMW-GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5' TTGTAGAAACTGCCATCCTT 3') and primer 4 (5' GTCACCGCTGCAT CGACATA 3') was designed and verified to specific for LMW-GS genes located on chromosome 1D in this study. The LMW-GS gene located at the Glu-D3 locus in bread wheat cultivar Xiaoyan 6 was cloned using this pair of primer. The clone designated as XYGluD3-LMWGS1 (AY263369), contains the endosperm-specific-expression promoter and the entire coding region. Nucleotide sequence comparison of the XYGluD3-LMWGS1 with other reported LMW-GS genes located at different Glu-3 loci showed the degree of identity among them ranged from 59.57% to 99.78%. The LMW-GS genes at the same locus showed more similar to each other than to the gene at different locus. Comparison of the deduced amino acid sequence of the XYGluD3-LMWGS1 with the sequences of 12 group LMW-GSs of wheat cultivar Norin 61 showed that the deduced amino acid sequence was nearly the same to LMW-GS group 10 (identity 99.67%). The deduced LMW-GS contains nine cystine residues, which contained one more cystine residue in the C-terminal conserved domain than previous reported. This was the first LMW-GS gene encoding for a LMW-GS with 9 cystine residues that has been discovered so far.

Amino Acid Sequence↗
PubMed1971

Microorganisms of the San Francisco sour dough bread process. I. Yeasts responsible for the leavening action.

Two hundred isolates from San Francisco sour dough French bread fermentations (40 from each of five different bakeries) were screened by fermentation tests and for their ability to grow in the presence of cycloheximide (Actidione). All of the isolates from four of the bakeries and 70% of those from the fifth were unable to utilize maltose but grew well on other sugars, even in the presence of cycloheximide. The remaining few isolates from the fifth bakery utilized maltose but not galactose and were inhibited by cycloheximide. No bakers' yeast types were found. Sixteen of the maltose-negative and five of the galactose-negative isolates were subjected to more rigorous taxonomic procedures. All of the maltose-negative isolates were identified as asporogenous strains of Saccharomyces exiguus (Torulopsis holmii) and the galactose-negative ones, as S. inusitatus. The predominance of S. exiguus, its vigor in the particular acidic environment of the sour dough, and the correlation of its numbers with the leavening function constitute strong evidence on the role of this organism in the sour dough system.

Bread↗
PubMed1971

Microorganisms of the San Francisco sour dough bread process. II. Isolation and characterization of undescribed bacterial species responsible for the souring activity.

A medium was developed which permitted isolation, apparently for the first time, of the bacteria responsible for the acid production in the 100-year-old San Francisco sour dough French bread process. Some of the essential ingredients of this medium included a specific requirement for maltose at a high level, Tween 80, freshly prepared yeast extractives, and an initial pH of not over 6.0. The bacteria were gram-positive, nonmotile, catalase-negative, short to medium slender rods, indifferent to oxygen, and producers of lactic and acetic acids with the latter varying from 3 to 26% of the total. Carbon dioxide was also produced. Their requirement for maltose for rapid and heavy growth and a proclivity for forming involuted, filamentous, and pleomorphic forms raises a question as to whether they should be properly grouped with the heterofermentative lactobacilli.

Acetates↗
PubMed1993

Replacement of margarine on bread by rapeseed and olive oils: effects on plasma fatty acid composition and serum cholesterol.

The effects of zero erucic acid rapeseed oil and olive oil on plasma fatty acid composition and serum cholesterol were studied in margarine users (n = 46). The replacement of margarine on bread by these oils accounted, on average, for 16% of the total fat and 7% of the total energy intake. Fatty acid analysis of total plasma indicated a dose-dependent rise in alpha-linolenic (alpha-LLA) and oleic acid (OA) levels during rapeseed and olive oil substitutions, respectively. Rapeseed oil substitution increased the proportion of eicosapentaenoic acid (0.4%- units, on average) in plasma phospholipids. A slight decrease in low-density lipoprotein cholesterol (LDL-C) and an increase in high-density lipoprotein cholesterol (HDL-C, 4.5%, p < 0.01) led to a significantly higher HDL-C/total cholesterol (TC) ratio (1.9%-units). The results suggest a marked competitive effect for alpha-LLA, not only among plasma phospholipid fatty acids, but also in the relationships with serum lipids, since the changes in alpha-LLA, rather than in OA, were associated with those in LDL-C and the HDL-C/TC ratio. No competitive action of polyunsaturated acids comparable to rapeseed oil was found during olive oil substitution. In contrast to the rapeseed oil diet, the reduced proportion of linoleic acid (LA) in plasma phospholipids was not restored; this may be unfavorable if the habitual intake of LA is low. However, the effects on LDL-C levels were beneficial: the concentration decreased by 5.9% (p < 0.01), correlating inversely with the increase in OA. In addition, the concentration of HDL-C remained unchanged during olive oil substitution.

Adult↗
PubMed1988

Cariogenicity of traditional African foodstuffs (maize, beans, sorghum, brown bread) on rat caries.

The cariogenicity of the following traditional African foods was tested in a rat model system: cooked maize and beans, cooked maize and spinach, uncooked and cooked sorghum, both plus 20% sucrose and brown bread, as well as a control (wheat starch plus 50% sucrose). Plaque extent was low in all the test groups and caries incidence was almost zero in all groups except for the cooked wheat starch and 50% sucrose group. Comparison to earlier results suggests a possible cariostatic effect of sorghum but not for the other traditional foods.

Animals↗
PubMed1996

Modification of wheat flour with bromelain and baking hypoallergenic bread with added ingredients.

Based on the wheat glutenin IgE-binding epitope, Gln-Gln-Gln-Pro-Pro, a practical method is proposed for the production of hypoallergenic wheat flour. Bromelain was found effective for decomposing the epitope structure. In practice, soft flour was mixed with water dissolving bromelain and the mixture was incubated at 37 degrees C for 4 h. The result of IgE-ELISA (enzyme-linked immunosorbent assay) suggested negative allergenicity. A mixture of bromelain-modified flour, glucose, citric, acid, a surfactant and sodium hydrogen carbonate was baked to produce hypoallergenic bread, resembling English muffins.

Amino Acid Sequence↗
PubMed2006

Bread wheat varieties as influenced by different nitrogen levels.

Experiment was conducted to determine the effect of different nitrogen levels on four bread wheat varieties (Triticum aestivum L.) viz. Inqilab-91, Daman-98, Dera-98 and Punjab-96 at Gomal University, Dera Ismail Khan (NWFP), Pakistan during 2000 approximatey 2001. The experiment was laid out in split plot design having four replications using a net plot size of 2 m x 5 m. Nitrogen doses used were 0, 50, 100, 150 and 200 kg/ha. The results showed that different nitrogen levels had significant effects on plant height, total number of plants/m(2), number of grains/spike, number of spike/m(2), spike weight, biological yield, grain yield and grain protein content. Maximum plant height, total number of plants/m(2), number of spikes/m(2), spike weight, biological yield and grain protein content were observed at 200 kg N/ha. Among wheat varieties Daman-98 had maximum plant height, spike weight, grains/spike, 1000-grain weight, biological yield and grain yield. Inqilab-91 had heavier grains and the most grain protein content, while Dera-98 had the maximum plant population and spikes/m(2). Grain yield and biological yield were statistically similar at doses of 150 kg N/ha and 200 kg N/ha. However, dose of 200 kg N/ha, compared to dose of 150 Kg N/ha, significantly increased the protein content.

Agriculture↗
PubMed1997

Effects of microcapsulated docosahexaenoic acid preparation on properties of dough and bread.

The effects of microcapsulated docosahexaenoic acid powder (hereinafter DHA powder) on some viscoelastic properties of wheat flour dough and loaf volume were studied. The addition of DHA powder in the range of 0.1 to 0.3% caused a significant increase in the loaf volume of bread after baking. Dough containing 0.2 or 0.3% DHA powder had greater modulus of elasticity, viscosity coefficient and relaxation time than that not containing DHA powder (control). Farinography revealed that DHA powder alone did not decrease the arrival and development times more than those of the control, but increased the stability time significantly. There was no considerable change in the gelatinization temperature or enthalpy of starch in the dough. The size of gas cells in crumbs backed with the DHA powder increased slightly. DHA powder suspension did not appreciably decompose on heating at 120 degrees C for 30 min, nor in the fermentation or backing processes in a home baker.

Bread↗