Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “repetitive elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 451 records · Page 25Linked to original sources
PubMed2006

Mammalian monogamy is not controlled by a single gene.

Complex social behavior in Microtus voles and other mammals has been postulated to be under the direct genetic control of a single locus: the arginine vasopressin 1a receptor (avpr1a) gene. Using a phylogenetic approach, we show that a repetitive element in the promoter region of avpr1a, which reportedly causes social monogamy, is actually widespread in nonmonogamous Microtus and other rodents. There was no evidence for intraspecific polymorphism in regard to the presence or absence of the repetitive element. Among 25 rodent species studied, the element was absent in only two closely related nonmonogamous species, indicating that this absence is certainly the result of an evolutionarily recent loss. Our analyses further demonstrate that the repetitive structures upstream of the avpr1a gene in humans and primates, which have been associated with social bonding, are evolutionarily distinct from those in rodents. Our evolutionary approach reveals that monogamy in rodents is not controlled by a single polymorphism in the promoter region of the avpr1a gene. We thus resolve the contradiction between the claims for an evolutionarily conserved genetic programming of social behavior in mammals and the vast evidence for highly complex and flexible mating systems.

Animals↗
PubMed2002

Mining putative regulatory elements in promoter regions of Saccharomyces cerevisiae.

The availability of genome-wide gene expression data provides a unique set of genes from which we can decipher the mechanisms underlying the common transcriptional response. Transcription factors, which can bind to specific DNA sites, cooperatively regulate the transcription of genes. This study attempts to mine putative binding sites to investigate how combinations of the sites predicted from known sites and over-represented repetitive elements are distributed in the promoter regions of groups of functionally related genes. The over-represented repetitive elements appearing in the associations are possible transcription factor binding sites. The deduced association rules would facilitate to predict putative regulatory elements and to identify genes which are potentially co-regulated by the putative regulatory elements. Our proposed approach is applied to Saccharomyces cerevisiae and the promoter regions of yeast ORFs.

Base Sequence↗
PubMed2001

BRCA1 and BRCA2 and the genetics of breast and ovarian cancer.

Germline mutations in the tumor suppressor genes BRCA1 and BRCA2 predispose individuals to breast and ovarian cancers. Progress in determining the function of BRCA1 and BRCA2 suggests that they are involved in two fundamental cellular processes: DNA damage repair and transcriptional regulation. We evaluate current knowledge of BRCA1 and BRCA2 functions to explain why mutations in BRCA1 and BRCA2 lead specifically to breast and ovarian cancer. The BRCA1 and BRCA2 genes contain unusually high densities of repetitive elements. These features of the BRCAs genomic regions contribute to chromosomal instability of these genes. We propose that somatic alterations of BRCA1 and BRCA2 are common and driven by rearrangements between repetitive elements. Inherited and somatic mutations occur in BRCA1 and BRCA2; virtually all somatic mutations are the result of large genomic rearrangements. What are the consequences of such large somatic mutations of BRCA1 and BRCA2 in women with or without inherited mutations? The breast and ovary are estrogen-responsive tissues. Beginning in puberty, the breast epithelium proliferates rapidly in response to fluctuating levels of estrogen. We present a genetic model outlining how BRCA-deficient cells may gain uncontrolled proliferation leading to tumor formation. Central to this model of BRCA-mediated tumorigenesis are estrogen-mediated proliferation of breast and ovarian epithelium and the distinctive genomic context of the BRCA genes.

BRCA2 Protein↗
PubMed2006

Comparison of dot chromosome sequences from D. melanogaster and D. virilis reveals an enrichment of DNA transposon sequences in heterochromatic domains.

BACKGROUND: Chromosome four of Drosophila melanogaster, known as the dot chromosome, is largely heterochromatic, as shown by immunofluorescent staining with antibodies to heterochromatin protein 1 (HP1) and histone H3K9me. In contrast, the absence of HP1 and H3K9me from the dot chromosome in D. virilis suggests that this region is euchromatic. D. virilis diverged from D. melanogaster 40 to 60 million years ago. RESULTS: Here we describe finished sequencing and analysis of 11 fosmids hybridizing to the dot chromosome of D. virilis (372,650 base-pairs) and seven fosmids from major euchromatic chromosome arms (273,110 base-pairs). Most genes from the dot chromosome of D. melanogaster remain on the dot chromosome in D. virilis, but many inversions have occurred. The dot chromosomes of both species are similar to the major chromosome arms in gene density and coding density, but the dot chromosome genes of both species have larger introns. The D. virilis dot chromosome fosmids have a high repeat density (22.8%), similar to homologous regions of D. melanogaster (26.5%). There are, however, major differences in the representation of repetitive elements. Remnants of DNA transposons make up only 6.3% of the D. virilis dot chromosome fosmids, but 18.4% of the homologous regions from D. melanogaster; DINE-1 and 1360 elements are particularly enriched in D. melanogaster. Euchromatic domains on the major chromosomes in both species have very few DNA transposons (less than 0.4 %). CONCLUSION: Combining these results with recent findings about RNAi, we suggest that specific repetitive elements, as well as density, play a role in determining higher-order chromatin packaging.

Animals↗
PubMed2000

CetSINEs and AREs are not SINEs but are parts of cetartiodactyl L1.

Short interspersed repetitive elements (SINEs) are widely distributed among the genomes of eukaryotes. We proposed previously that a SINE should be defined by the presence of a region homologous to a tRNA or to 7SL RNA, together with A-box and B-box promoter sequences, in order to distinguish SINEs from other short repetitive sequences, such as short segments of LINEs (long interspersed repetitive elements; Okada et al. Gene 205, 229-243, 1997). Numerous SINE sequences have been deposited to date in DNA databases. In some cases, however, designation of a particular sequence is problematic when the short repetitive sequence has been defined as a SINE without reference to the presence or absence of promoter elements specific for RNA polymerase III. We demonstrate here that four different sequences, namely, ARE1p, ARE2p, CetSINE1, and CetSINE2, each of which has been reported as a SINE, are, in fact, only partial sequences of members of a new subfamily of L1. We also demonstrate that members of this subfamily are distributed specifically among the genomes of cetartiodactyls.

3' Untranslated Regions↗
PubMed1994

Molecular characterization and clinical use of a polymorphic tandem repeat in an intron of the human alanine:glyoxylate aminotransferase gene.

The autosomal recessive disease primary hyperoxaluria type 1 (PH1) is caused by a deficiency of the liver-specific peroxisomal enzyme alanine:glyoxylate amino-transferase (AGT). This paper concerns the identification, characterization and clinical use of an unusual discretely polymorphic tandem repeat sequence in the fourth intron of the human AGT gene (gene locus designation AGXT). In a random Caucasian population, three alleles could be clearly recognized that consisted of either 12 (type III), 17 (type II) or approximately 38 (type I) tandemly repeated copies of a highly conserved 29/32-bp sequence with frequencies of 33%, 7% and 60%, respectively. In a random Japanese population, the allelic frequencies were markedly different (i.e. 31%, 45% and 19%, respectively). In addition, a fourth allele was identified, consisting of approximately 32 repeats (type IV), with an allelic frequency of approximately 5% in Japanese. The repetitive sequence was similar to previously identified mammalian sequences with homology to the Epstein-Barr virus IR3 repetitive element involving a 12/15-bp region GCA(GGN)GGAGGAGGG within the repeat unit. This IR3-like sequence was interspersed with a 17-bp sequence with no similarity to any currently known repetitive element. The type I and type III alleles were judged to be equivalent to a previously identified TaqI polymorphism. Two polymorphisms previously shown to be associated with the peroxisome-to-mitochondrion mistargeting of AGT in PH1 (a C154-->T point substitution in exon 1 and a 74-bp duplication in intron 1) were found to segregate exclusively with the type I intron 4 polymorphism in Caucasians, but not in Japanese. The polymorphic nature of the intron 4 tandem repeats makes them of potential use in the prenatal diagnosis of PH1, especially when coupled with the exon 1 C154-->T substitution or intron 1 duplication polymorphisms. A PH1 family, in which a fetus had been predicted previously to be either normal or a carrier by AGT enzymic analysis of a fetal liver biopsy, but who had been shown to be only partially informative with respect to the C154-->T/intron 1 polymorphisms, was analysed retrospectively. The family was completely informative for the intron 4 tandem repeat polymorphism and the carrier status of the fetus was confirmed.

Alanine Transaminase↗
PubMed1999

Two SINE families associated with equine microsatellite loci.

BLAST searches of 61 equine microsatellite sequences revealed two related families of retroposons. The first family included seven markers, all of which showed significant homology to the Equine Repetitive Element-1 (ERE-1) Short Interspersed Nucleotide Element (SINE) sequence. Length of homology ranged from 76 to 171 bases with identities to the ERE-1 consensus sequence ranging from 71% to 83%. The second family referred to as Equine Repetitive Element-2 (ERE-2) has a consensus sequence that showed homology to ERE-1 over approximately 60 bases. These 60 bases comprised subunit I. Sequence comparisons for the two retroposons led to the identification of a subunit II, subunit III, as well as the tRNAser subunit. The subunit structure of ERE-1 was tRNAser-I-II. By contrast, the subunit structure of ERE-2 was I-III-III. The nine markers related to ERE-2 showed homology lengths ranging from 84 to 163 bases with identities ranging from 75% to 99%. In addition to being present in microsatellites, ERE-2 appeared in three separate equine genes. It occurred in an intron of DNA-PK, in an untranslated region as well as in the promoter of PGHS, and in the coding region of PAM. The amino acids corresponding to the ERE-2 sequence in PAM were not present in the human or mouse PAM homologs. These amino acids associated with the ERE-2 sequence were present on the cytosolic side of the transmembrane domain of the PAM enzyme. Microsatellite markers in the ERE-1 and ERE-2 families were found throughout the genus equus and also for rhinoceros, indicating that the appearance of both retroposons predates the divergence of equids from the other perissodactyls. The markers did not amplify in human or bovine DNA. This indicated that ERE-1 and ERE-2 are, at least, perissodactyl specific.

Amidine-Lyases↗
PubMed1993

Highly identical cassettes of gene regulatory elements, genomically repetitive and present in RNA.

A region in the first intron of a metallothionein-encoding gene of the sea urchin Strongylocentrotus purpuratus (SpMTA gene) regulates its 5' promoter activity. Within this region is a 290-bp cassette of six sequence motifs that are present in other genes in this species and posited to operate as regulatory elements. The cassette, present at high multiplicity in the genome, was used to screen genomic DNA clones. Of these, six diverse individuals were partially sequenced and found to have segments 94% identical to the 290-bp cassette in the SpMTA gene. Their next 80 bp diverged from the SpMTA sequence but were highly identical among the six non-SpMTA clones and contained an additional regulatory motif. These diverse clones thus contained 370-bp cassettes of an overall 94% sequence identity and an apparent content of seven regulatory elements. The regulatory cassettes were transposon-like, insofar as the termini of the highly identical regions consisted of 24- to 25-bp inverted repeats, bracketed by 6- to 9-bp direct repeats in the divergent regions. In addition to being in transcripts of the SpMTA intron, the cassette was found in other sea urchin embryo poly(A)+ RNAs, in eggs and embryos, and enriched in pluteus ectoderm. The cassette sequence was present in moderate abundance in transcripts in both sense and antisense orientation. We report the presence of a transposon-like cassette of regulatory elements that is also represented in RNA, which potentially could function differently from previously described transposons.

Animals↗
PubMed2001

Crypt1, an active Ac-like transposon from the chestnut blight fungus, Cryphonectria parasitica.

A moderately repetitive element was identified previously in the nuclear genome of the chestnut blight fungus, Cryphonectria parasitica, and has been used as a probe for population studies of the fungus. We report here that the repetitive element is a class II transposon of the hAT family of Activator (Ac)-like transposable elements. The element, named Crypt1, has a size of 3563 bp, including 21-bp terminal inverted repeats. A unique 8-bp direct repeat sequence flanking Crypt1 was identified in each of three clones examined. A single large ORF with the potential to encode a putative transposase of 946 amino acid residues was deduced from the sequence of Crypt1. Based on amino acid sequence alignments, Crypt1 is most closely related to other Ac-like transposons of filamentous ascomycetes. A single transcript of approximately 3.0 kb was identified by Northern hybridization experiments from Crypt1-containing isolates, suggesting that Crypt1 is an active element. An isolate containing a single, possibly defective, copy of Crypt1 was identified in C. parasitica isolates from China; no Crypt1 transcript was identified in this isolate. Transposition of Crypt1 was inferred from Southern and inverse PCR analyses of C. parasitica isolates maintained in the laboratory, but transposition appears to be a rare event.

Amino Acid Sequence↗
PubMed1990

Intramolecular DNA triplexes, bent DNA and DNA unwinding elements in the initiation region of an amplified dihydrofolate reductase replicon.

The nucleotide sequence of 6.2 kb (1 kb = 10(3) base-pairs) of DNA that encompasses the earliest replicating portion of the amplified dihydrofolate reductase domains of CHOC 400 cells has been determined. Origin region DNA contains two AluI family repeats, a novel repetitive element (termed ORR-1), a TGGGT-rich region, and several homopurine/homopyrimidine and alternating purine/pyrimidine tracts, including an unusual cluster of simple repeating sequences composed of (G-C)5, (A-C)18, (A-G)21, (G)9, (CAGA)4, GAGGGAGAGAGGCAGAGAGGG, (A-G)27. Recombinant plasmids containing origin region sequences were examined for DNA structural conformations previously implicated in origin activation. Mung bean nuclease sensitivity assays for DNA unwinding elements show the preferred order of nuclease cleavage at neutral pH in supercoiled origin plasmids to be: (A-T)23 much greater than the (A-G) cluster much greater than (A)38 much greater than vector = (AATT)n. At acid pH, the hierarchy of cleavage preferences changes to: the (A-G) cluster much greater than (A-T)23 much greater than (AATT)n greater than vector = (A)38. A region of stably bent DNA was identified and shown not to be reactive in the mung bean nuclease unwinding assay at either acid or neutral pH. Intermolecular hybridization studies show that, in the presence of torsional stress at pH 5.2, the (A-G) cluster forms triple-stranded DNA. These results show that the origin region of an amplified chromosomal replicon contains a novel repetitive element and multiple sequence elements that facilitate DNA bending, DNA unwinding and the formation of intramolecular triple-stranded DNA.

Animals↗
PubMed2004

i-Genome: a database to summarize oligonucleotide data in genomes.

BACKGROUND: Information on the occurrence of sequence features in genomes is crucial to comparative genomics, evolutionary analysis, the analyses of regulatory sequences and the quantitative evaluation of sequences. Computing the frequencies and the occurrences of a pattern in complete genomes is time-consuming. RESULTS: The proposed database provides information about sequence features generated by exhaustively computing the sequences of the complete genome. The repetitive elements in the eukaryotic genomes, such as LINEs, SINEs, Alu and LTR, are obtained from Repbase. The database supports various complete genomes including human, yeast, worm, and 128 microbial genomes. CONCLUSIONS: This investigation presents and implements an efficiently computational approach to accumulate the occurrences of the oligonucleotides or patterns in complete genomes. A database is established to maintain the information of the sequence features, including the distributions of oligonucleotide, the gene distribution, the distribution of repetitive elements in genomes and the occurrences of the oligonucleotides. The database can provide more effective and efficient way to access the repetitive features in genomes.

Alu Elements↗