Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “quadruplex”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 451 records · Page 25Linked to original sources
PubMed1996

A resonance Raman spectroscopic study of the quadruplex form of polyriboinosinic acid.

The four stranded form of polyriboinosinic acid, or poly(rl), formed under conditions of high ionic strength, has been studied principally by resonance Raman spectroscopy excited in the ultraviolet absorbent band of the hypoxanthine residues. UV Absorption and circular dichroism studies were made, principally in order to verify the presence of the quadruplex form at the low concentrations of poly(rl) used, and a trial experiment with the structural probe Tb3+ was also performed. Experimental evidence is found for highly stacked metastable forms present at low concentrations of polynucleotide, which are destroyed by heating in favor of the two well known forms.

Circular Dichroism↗
PubMedDate not supplied

Molecular recognition of quadruplex DNA by quinacridine derivatives.

The interaction of monomeric and dimeric quinacridines with quadruplex DNA has been investigated using a variety of biophysical methods. Both series of compounds were shown to exhibit a high affinity for the G4 conformation with two equivalent binding sites. As shown from the SPR and dialysis experiments the macrocyclic dimer appears more selective than its monomeric counterpart.

Base Sequence↗
PubMed2005

Interaction of porphyrin with G-quadruplex structures.

Isothermal titration calorimetry (ITC) is a sensitive technique for probing bimolecular processes and can provide direct information about the binding affinity and stoichiometry and the key thermodynamic parameters involved. ITC has been used to investigate the interaction of the ligand H2TMPyP to the two DNA quadruplexes, [d(AGGGT)]4 and [d(TGGGGT)]. Analysis of the ITC data reveals that porphyrin/quadruplex binding stoichiometry under saturating conditions is 1:2 for [d(AGGGT)]4 and 2:1 for [d(TGGGGT)], respectively.

Biophysical Phenomena↗
PubMed1994

A guanosine quadruplex and two stable hairpins flank a major cleavage site in insulin-like growth factor II mRNA.

Insulin-like growth factor II (IGF-II) mRNAs are cleaved by an endonucleolytic event in a conserved part of their 3' untranslated region that is predicted to exhibit a complex higher-order RNA structure. In the present study, we have examined the putative secondary structures of in vitro transcripts from the conserved part of human and rat mRNAs by enzymatic and chemical probing. The results show that the cleavage site is situated between two highly structured domains. The upstream domain consists of two large hairpins, whereas the downstream domain is guanosine-rich. The guanosine-rich domain adopts a compact unimolecular conformation in Na+ or K+ but not in Li+, and it completely arrests reverse transcription in K+ but only partially in Na+, indicating the presence of an intramolecular guanosine quadruplex. The flanking higher-order structures may ensure that the cleavage site is not sequestered in stable RNA structures, thus allowing interactions with RNA or proteins at posttranscriptional stages of IGF-II expression.

Animals↗
PubMed2005

Overexpression of Bcl-2 is associated with apoptotic resistance to the G-quadruplex ligand 12459 but is not sufficient to confer resistance to long-term senescence.

The triazine derivative 12459 is a potent G-quadruplex interacting agent that inhibits telomerase activity. This agent induces time- and dose-dependent telomere shortening, senescence-like growth arrest and apoptosis in the human A549 tumour cell line. We show here that 12459 induces a delayed apoptosis that activates the mitochondrial pathway. A549 cell lines selected for resistance to 12459 and previously characterized for an altered hTERT expression also showed Bcl-2 overexpression. Transfection of Bcl-2 into A549 cells induced a resistance to the short-term apoptotic effect triggered by 12459, suggesting that Bcl-2 is an important determinant for the activity of 12459. In sharp contrast, the Bcl-2 overexpression was not sufficient to confer resistance to the senescence-like growth arrest induced by prolonged treatment with 12459. We also show that 12459 provokes a rapid degradation of the telomeric G-overhang in conditions that paralleled the apoptosis induction. In contrast, the G-overhang degradation was not observed when apoptosis was induced by camptothecin. Bcl-2 overexpression did not modify the G-overhang degradation, suggesting that this event is an early process uncoupled from the final apoptotic pathway.

Antineoplastic Agents↗
PubMed2002

Inhibition of human immunodeficiency virus type 1 activity in vitro by a new self-stabilized oligonucleotide with guanosine-thymidine quadruplex motifs.

An oligonucleotide with a dimeric hairpin guanosine quadruplex (basket type structure) (dG3T4G3-s), containing phosphorothioate groups, was able to inhibit human immunodeficiency virus type 1 (HIV-1)-induced syncytium formation and virus production (as measured by p24 core antigen expression) in peripheral blood mononuclear cells. This oligonucleotide lacks primary sequence homology with the complementary (antisense) sequences to the HIV-1 genome. Furthermore, this oligonucleotide may have increased nuclease resistance. The activity of this oligonucleotide was increased when the phosphodiester backbone was replaced with a phosphorothioate backbone. In vivo results showed that dG3T4G3-s was capable of blocking the interaction between gp120 and CD4. We also found that dG3T4G3-s specifically inhibits the entry of T-cell line-tropic HIV-1 into cells. This compound is a viable candidate for evaluation as a therapeutic agent against HIV-1 in humans.

Giant Cells↗
PubMed2004

Molecular dynamics simulations of Guanine quadruplex loops: advances and force field limitations.

A computational analysis of d(GGGGTTTTGGGG)(2) guanine quadruplexes containing either lateral or diagonal four-thymidine loops was carried out using molecular dynamics (MD) simulations in explicit solvent, locally enhanced sampling (LES) simulations, systematic conformational search, and free energy molecular-mechanics, Poisson Boltzmann, surface area (MM-PBSA) calculations with explicit inclusion of structural monovalent cations. The study provides, within the approximations of the applied all-atom additive force field, a qualitatively complete analysis of the available loop conformational space. The results are independent of the starting structures. Major conformational transitions not seen in conventional MD simulations are observed when LES is applied. The favored LES structures consistently provide lower free energies (as estimated by molecular-mechanics, Poisson Boltzmann, surface area) than other structures. Unfortunately, the predicted optimal structure for the diagonal loop arrangement differs substantially from the atomic resolution experiments. This result is attributed to force field deficiencies, such as the potential misbalance between solute-cation and solvent-cation terms. The MD simulations are unable to maintain the stable coordination of the monovalent cations inside the diagonal loops as reported in a recent x-ray study. The optimal diagonal and lateral loop arrangements appear to be close in energy although a proper inclusion of the loop monovalent cations could stabilize the diagonal architecture.

Computer Simulation↗
PubMed2003

A novel fluorescent quadruplex STR typing system and the allele frequency distributions in a Thai population.

We have previously reported a new triplex amplification and typing system by silver staining for three short tandem repeat (STR) loci, 9q2h2 (D2S3020), D15S233, and D14S299 without "microvariant" alleles such as .1, .2, and, .3 alleles in the Japanese population. In the present study, we established a new quadruplex system with an additional locus D7S809 using primer sets labeled with fluorescent multi-color dyes. Using this system, we genotyped 183 Thai people, found only one "microvariant" allele (allele 20.2) at D7S809, and calculated allele frequencies and some statistical properties at these four STR loci. From these allele frequencies at four STR loci, we performed three statistical analyses including a homozygosity test, a likelihood ratio test, and an exact test for Hardy-Weinberg equilibrium (HWE). Deviations from HWE (p < 0.05) were observed only in the two tests at the locus D7S809. In the present study, we compared the allele frequencies at these four loci in the Thai population to those in the Japanese population described previously. Consequently, all observed heterozygosities and power of discrimination (PD) at those loci in the Thai population were higher than 0.8 and 0.9, respectively, and all statistical values for discriminating power in the Thai population were slightly higher than those in the Japanese population. The combined paternity exclusion rate (combined PE) in the Thai population (0.978) was almost the same as that in the Japanese population (0.971). Therefore, this novel PCR amplification and typing system for four STR loci would be a convenient and informative DNA profiling system in the forensic field.

DNA Fingerprinting↗
PubMed1993

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.

Animals↗
PubMed1995

RNA quadruplex containing G and A.

The CD study of r(GGAGGAA) has indicated that it forms a higher order structure upon either increase of the strand concentration or addition of K+. Gel electrophoresis showed that a high molecular weight species is formed in the presence of K+. The NMR study revealed a nearly 1:1 equilibrium of two kinds of higher order structures at the strand concentration of 2.1 mM and 100 mM Na+. This equilibrium shifted drastically upon addition of K+, and only one structure remained at 40 mM K+. It is suggested that the structure formed by r(GGAGGAA) in the presence of K+ is a new type of RNA quadruplex, where an A-quartet stabilized by mutual hydrogen bonding among the four adenine bases is sandwiched by conventional G-quartets.

Adenine↗
PubMed1997

Quadruplex formation of oligonucleotides containing G clusters and their nuclease resistance.

Oligoribonucleotides containing four G clusters, (UGnU)4 (n = 3-5), were synthesized and characterized by electrophoretic analysis and resistance to nucleases. Electrophoretic analyses indicate that the oligomers except for (UG3U)4 can form antiparallel-stranded monomeric quadruplexes in the presence of potassium cation. The oligomers used in this study are protected from endonuclease P1 and venom phosphodiesterase degradation. In addition, the oligomers indicate resistance to nucleases in human serum and E. coli S-100 fraction.

Base Composition↗