Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “SULFATASES”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 451 records · Page 25Linked to original sources
PubMed1981

The correction of Hunter fibroblasts by exogenous iduronate sulfate sulfatase: biochemical and ultrastructural studies.

The exogenous addition of iduronate sulfate sulfatase to cultured fibroblasts of Hunter patients resulted in a full correction of the metabolic defect as demonstrated by chemical and ultrastructural analyses. As little as 25% of the normal fibroblasts' enzyme levels were sufficient for this correction. The half-disappearance time of the internalized enzyme was 3-4 days. Prolonged incubation of corrected cells resulted in a gradual reaccumulation of mucopolysaccharides.

Cells, Cultured↗
PubMed1997

X-linked ichthyosis in Mexico: high frequency of deletions in the steroid sulfatase encoding gene.

The present study analyzes the frequency of molecular deletions in the steroid sulfatase (STS) encoding gene in a sample of 50 Mexican subjects with biochemical diagnosis of X-linked ichthyosis (XLI). To establish the correct diagnosis, STS activity was determined in leukocytes using 7-(3)H-dehydroepiandrosterone sulfate as the substrate. No amplification of the 3' and 5' ends of the STS gene by PCR was detected in the DNA of 49 patients, whereas only one sample of 50 presented a normal amplification. This report shows a very high frequency of deletions in the human STS encoding gene in a representative sample of the Mexican population, and it defines the characteristics of XLI in patients whose STS gene has a complete deletion as a major molecular defect.

Arylsulfatases↗
PubMed1998

DNA deletion confined to the iduronate-2-sulfatase promoter abolishes IDS gene expression.

Deficiency of the enzyme iduronate-2-sulfatase (IDS) results in Hunter syndrome, an X-linked recessive lysosomal storage disorder. In this study, analysis of a patient with features of moderate to severe Hunter syndrome identified a 178-bp deletion upstream of IDS exon 1 spanning a predicted promoter element. Sequencing of all nine IDS exons from this patient failed to identify any additional mutations within the coding regions or in intron-exon boundaries. The 178-bp deletion is flanked by two 13-bp direct repeats and potential DNA topoisomerase II recognition sites. These findings point toward nonhomologous recombination as a possible mechanism for this mutation. Expression studies on this patient do not detect any IDS transcripts, indicating that the deletion spans sequences essential for IDS expression. Complete lack of expression of IDS is consistent with the moderate to severe phenotype observed in this patient.

Base Sequence↗
PubMed1998

A novel missense mutation Ile538Val in the fibroblast growth factor receptor 3 in hypochondroplasia. Mutations in brief no. 122. Online.

Hypochondroplasia and achondroplasia are skeletal dysplasias, characterized by autosomal dominant inheritance and disproportionate short stature, which occurs mainly due to growth failure of the extremities. Both dysplasias have been mapped to fibroblast growth factor receptor 3 (FGFR3) gene. For hypochondroplasia, two point mutations, both responsible for the Asn540Lys substitution in the region coding the tyrosine kinase domain have been reported. Here we report an A to G transition at position 1651, predicting an Ile538Val substitution in the FGFR3, in hypochondroplasia. The substitution is found in a swedish family with three affected members. The criteria for hypochondroplasia were disproportionate short stature and radiological evidence of shortened long bones and decrease or absence of normal increase in interpedicular distances of the lumbar column. The mutation was detected by direct sequencing and restriction enzyme Tai I digestion. The base change was not found in the FGFR3 genes of unaffected members of the family nor in seventy-five unrelated unaffected individuals, suggesting that it was not a polymorphism. The Ile538Val substitution is a conservative amino acid change (a hydrophobic amino acid incorporated for another hydrophobic amino acid). Nevertheless, it is located in the stretch of nine amino acids, which is highly conserved among all the human fibroblast growth factor receptors. Considering the location of this substitution and the segregation with the phenotype in this family, we propose that it is a causative mutation of hypochondroplasia. It is difficult to establish whether the Ile538Val substitution is rare in hypochondroplasia patients or whether the individuals, who have a moderate degree of short stature, rarely seek medical help for the short stature and consequently are rarely diagnosed as affected by hypochondroplasia.

Achondroplasia↗
PubMed1999

Novel type of genetic rearrangement in the iduronate-2-sulfatase (IDS) gene involving deletion, duplications, and inversions.

We describe a novel type of complex genetic rearrangement in the iduronate-2-sulfatase (IDS) gene of a severely affected MPSII patient. Southern blot analysis indicated an intragenic deletion of exons 5 and 6. The deletion spans 5,581 bp. Sequencing of the deletion junctions revealed a complex rearrangement involving duplications and inversions. A remaining 20 bp fragment (c) from the intron 6 sequence and two duplicated IDS gene fragments of 314 bp (a) from intron 6/exon 7 boundary and 23 bp (b) from exon 7 were found between the deletion breakpoints. Fragments a and c were placed in an inverted orientation. We suggest that the described rearrangement is a result of a nonhomologous recombination event at sites with little homology. The proposed model explaining this recombinational event involves the formation of "tetra-loop" single-stranded DNA structure during replication. The complexity of the described rearrangement and the lack of large homologous sequences at the mutational breakpoints suggest that complex molecular intermediates are formed during illegitimate recombination.

Base Sequence↗
PubMed2000

PCR diagnosis of X-linked ichthyosis: identification of a novel mutation (E560P) of the steroid sulfatase gene.

X-linked ichthyosis (XLI) is an inherited skin disorder due to deficiency of steroid sulfatase (STS) activity. XLI has been diagnosed by assaying STS activity in placenta or lymphocytes of patients after birth. Most patients have a large deletion of the STS gene, generated by inaccurate recombination at the STS locus. However, point mutations in the STS gene have been reported in some patients with complete STS deficiency. In a new case of STS deficiency, we identified an STS missense mutation, Glu560Pro or E560P. This new point mutation suggests that the C-terminal region of the STS enzyme is important for STS enzymatic function. Hum Mutat 15:296, 2000.

Amino Acid Substitution↗
PubMed1977

Morquio-like syndrome with beta galactosidase deficiency and normal hexosamine sulfatase activity: mucopolysacchariodosis IVB.

A 14-year-old white girl with mild dysostosis multiplex, odontoid hypoplasia, short stature, cloudy corneas, keratansulfaturia, but without detectable central nervous system abnormalities was referred with the diagnosis of Morquio syndrome. Clinical and roentgenographic findings were minimal compared to those of typical patients with the Morquio syndrome, MPS IV. Beta-Galactosidase activity in extracts of the patient's cultured fibroblasts was deficient, while that of galactosamine-6-sulfate sulfatase was normal. Conjunctival biopsy revealed intracytoplasmic vacuoles typical of lysosomal storage diseases. It is postulated that in this patient the deficiency of a beta-galactosidase is responsible for inadequate degradation of keratan sulfate and the appearance of a mild form of the Morquio syndrome (MPS IVB).

Adolescent↗
PubMed1991

Two cases of steroid sulfatase deficiency with complex phenotype due to contiguous gene deletions.

We report contiguous gene deletions in the distal short arm of the X chromosome in two patients with ichthyosis, due to steroid sulfatase deficiency, and other complex phenotypes. One patient had chondrodysplasia punctata (CDP) and ichthyosis with a normal chromosome constitution. Another patient had a CDP-like phenotype, ichthyosis, and hypogonadism. His karyotype was 46, -X,Y, +der(X)t(X;Y)(p22;q11). DNA from the two patients was analyzed by Southern blotting using cloned fragments mapped in the Xp21-Xpter region to investigate gene deletions. DNA from the patient with CDP showed a gene deletion of the STS, DXS31, and DXS89 loci, and DNA from the patient with X-Y translocation lacked fragments of the STS, DXS31, DXS89, and DXS143 loci. These findings suggest that the common deleted region involving the STS locus might have caused the similar phenotypes in both patients.

Abnormalities, Multiple↗
PubMed2001

Molecular analysis of 40 Italian patients with mucopolysaccharidosis type II: New mutations in the iduronate-2-sulfatase (IDS) gene.

Mucopolysaccharidosis type II (MPS2, or Hunter syndrome), rare X-linked lysosomal storage disorder, results from deleterious mutations in the iduronate-2-sulfatase (IDS) gene. We report here the mutational analysis of a total of 40 unrelated Italian MPS II patients ranging from mild to severe phenotype. We are able to assign the genotype to 29 of them (72.5%), identifying 22 different mutations, five of which are unpublished (c.533delTT, W12X, N265I, c.1131-1142del, c.1131-1305del). A total of 55.2% of the molecularly characterised patients resulted from missense mutations, 20.7% from nonsense mutations, and another 13.8% of patients from small deletions (<20pb) or splice mutations, whereas 10.3% of the cases carried major structural alterations such as large deletion and rearrangements. The results reported here support the evidence of the mutational heterogeneity of the IDS gene as well as the difficulty to correlate genotype and phenotype in the patients with MPSII. However, the molecular characterisation of the patients is advantageous, making the carrier detection feasible for the females in the family at risk and improving the reliability of prenatal diagnosis techniques. Moreover, it provides a good foundation for therapeutic strategies.

Cells, Cultured↗
PubMed2001

Mucopolysaccharidosis type VI: Structural and clinical implications of mutations in N-acetylgalactosamine-4-sulfatase.

Mucopolysaccharidosis type VI (MPS-VI) is an autosomal recessive lysosomal storage disorder caused by the deficiency of N-acetylgalactosamine-4-sulfatase (4S; or ARSB). Mutations in the 4S gene are responsible for 4S deficiency, which leads to the intralysosomal storage of partially degraded glycosaminoglycans, dermatan sulfate, and chondroitin 4-sulfate. To date, a total of 45 clinically relevant mutations have been identified in the human 4S gene. Missense mutations are the largest group, with 31 identified mutations. Nonsense mutations and small insertions or deletions comprise the remainder, with seven mutations each. Six polymorphisms have also been reported: two amino acid substitutions and four silent transitions. Mapping of the missense mutations onto the 4S structure shows that they are distributed throughout the three subunits of the mature 4S polypeptide. Mutations have been identified in active site residues, in residues adjacent to the active site, in potential substrate binding residues, in residues exposed on the surface, and in residues buried within the protein core. Missense mutations have also been identified in disulfide crosslinks. Molecular modeling of MPS-VI mutations onto the 4S structure suggests that the majority cause 4S deficiency via destabilization and the consequent reduction of 4S protein concentration. The vast majority of MPS-VI mutant alleles are either unique to a patient or are present in a small number of patients. So far, no common mutations have been described. Therefore, screening of the general population for MPS-VI alleles will be difficult.

Animals↗
PubMed1994

Mutations of the iduronate-2-sulfatase (IDS) gene in patients with Hunter syndrome (mucopolysaccharidosis II).

Genomic DNA and cDNA from fibroblasts from nine unrelated German patients with X-linked iduronate-2-sulfatase (IDS) deficiency showing variable clinical manifestation were screened for point mutations and small structural aberrations. Direct sequencing revealed a splice mutation skipping exon A, one nonsense mutation, and five missense mutations concerning the exons B, F and I of the IDS gene. Several novel missense mutations were found: A68E, S426X, I485R, Q293H, and D478G. One of the point mutations eliminating a recognition site for the restriction enzyme MspI was used as a direct marker for a prenatal diagnosis. A relationship between type of mutation and clinical picture could not be recognized.

Female↗
PubMed2004

General implications for CpG hot spot mutations: methylation patterns of the human iduronate-2-sulfatase gene locus.

The methylation pattern at CpG sites of a housekeeping gene correlates with the likelihood of mutation. Mucopolysaccharidosis (MPS) type II, an X-linked disorder, results from the deficiency of iduronate-2-sulfatase (IDS). In these patients, over 35% of independent point mutations at the IDS gene locus were found at CpG sites as transitional events. To gain insight into the relationship between methylation status and CpG hot spot mutations, we investigated patterns of cytosine methylation in the entire IDS gene, except for introns 4-8. Bisulfite genomic sequencing was performed on the normal leukocyte DNA. Our data show that: 1) cytosine methylation at the CpG sites was extensive, except for those present from the promoter region to a portion of intron 3; 2) a sharp boundary of methylated-nonmethylated regions was observed at the 5'-flanking region, whereas a gradual change in methylation was observed in the 2.0-kb segment in the 3'-flanking region; 3) the boundary of the 5'-flanking region contained multiple Sp1 sites and the TATA box; 4) the CpG sites in exons 1 and 2 were hypomethylated and were associated only with rare transitional mutations, while the CpG sites in exon 3 were also hypomethylated, yet were associated with a high rate of transitional mutations; 5) there was no striking sex difference in the methylation patterns in active alleles; and, 6) the methylation in both strands was symmetrical, except at the boundary of methylated-unmethylated regions.

Amino Acid Sequence↗
PubMed2003

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.

Adolescent↗
PubMedDate not supplied

Phenotypic rescue after adeno-associated virus-mediated delivery of 4-sulfatase to the retinal pigment epithelium of feline mucopolysaccharidosis VI.

BACKGROUND: Mucopolysaccharidosis VI (MPS VI), due to recessively inherited 4-sulfatase (4S) deficiency, results in lysosomal storage of dermatan sulfate in numerous tissues. Retinal involvement is limited to the retinal pigment epithelium (RPE). This study aimed to determine whether recombinant adeno-associated virus (AAV)-mediated delivery of 4S would reverse the RPE pathology seen in MPS VI cats. METHODS: AAV.f4S, containing the feline 4S cDNA, was delivered unilaterally to eyes of affected cats by subretinal or intravitreal injection. Contralateral eyes received AAV with the green fluorescent protein (GFP) reporter gene as control. At 2-11 months post-injection, the cats were sacrificed and the treatment effects were evaluated histologically. RESULTS: By ophthalmoscopy and histological analyses, GFP was evident as early as 4 weeks and persisted through the latest time point (11 months). Untreated and AAV.GFP-treated diseased retinas contained massively hypertrophied RPE cells secondary to accumulation of dilated lysosomal inclusions containing dermatan sulfate. MPS VI eyes treated subretinally with AAV.f4S had minimal RPE cell inclusions and, consequently, were not hypertrophied. CONCLUSIONS: AAV-mediated subretinal delivery of f4S provided correction of the disease phenotype in RPE cells of feline MPS VI, supporting the utility of AAV as a vector for the treatment of RPE-specific as well as lysosomal storage diseases.

Animals↗
PubMed2004

Steroid sulfatase inhibitors.

Steroid sulfatase (STS) regulates the local production of estrogens and androgens from systemic precursors in several tissues. The enzyme catalyzes the hydrolysis of the sulfate esters of 3-hydroxy steroids, which are inactive transport or precursor forms of the active 3-hydroxy steroids. STS inhibitors are expected to block the local production and, consequently, to reduce the local levels of the hormones. Therefore, they are considered as potential new therapeutic agents for the treatment of estrogen- and androgen-dependent disorders. Indications range from cancers of the breast, endometrium and prostate to androgenetic alopecia and acne. In this review, we give a comprehensive summary of the current knowledge and problems in the field of medicinal chemistry of STS inhibitors. The various types of inhibitors are presented and their structure-activity relationships are discussed. In addition to potent arylsulfamate-based, irreversible inhibitors, novel types of reversible inhibitors were recently discovered. The recent publication of the X-ray structure of STS will further boost research activities on this attractive target.

Binding Sites↗
PubMed2002

Low or absent unconjugated estriol in pregnancy: an indicator for steroid sulfatase deficiency detectable by fluorescence in situ hybridization and biochemical analysis.

It has been previously reported that a low or absent maternal serum unconjugated estriol (uE3) level is associated with placental steroid sulfatase (STS) deficiency. Here we report a correlation between patients who present with a very low or absent maternal serum uE3 and a deletion of the STS gene as assessed by fluorescence in situ hybridization (FISH). We studied nine prenatal cases that presented to the clinical laboratory with an abnormal triple screen, specifically low or absent maternal serum uE3 and a 46,XY karyotype. FISH analysis showed complete deletion of a probe containing the STS gene in six cases and one case had a partial deletion (reduced but not absent signal). The remaining two cases were not deleted for the STS probe. All mothers tested whose fetus showed a deletion were shown to be STS deletion carriers using FISH. Biochemical analysis was performed on 7/9 prenatal specimens. All fetuses deleted for the STS probe were also found to be deficient for STS by biochemical analysis of cultured amniotic fluid (5/5). Of the two fetuses not deleted for the STS probe, one was deficient for STS activity, while the other had a normal result. The abnormal result of enzyme deficiency by biochemical analysis in a non-deletion case likely represents a mutation in the STS gene, not detectable by this FISH assay. Postnatal FISH confirmation of the STS deletion was performed in 1/7 cases. Clinical follow-up was available for 4/9 cases following birth.

Adult↗
PubMed2006

Steroid sulfatase and estrogen sulfotransferase in human prostate cancer.

BACKGROUND: Estrogen sulfotransferase (EST) and steroid sulfatase (STS) are known to be involved in in situ estrogen production in estrogen dependent human cancer such as breast cancer, but unknown in prostate cancer. MATERIALS AND METHODS: We first examined whether these enzymes above were expressed and actually involved in estrogen production and metabolism in prostate cancer cell lines (LNCaP, DU-145, and PC-3). We than examined the expression of EST and STS in human prostate cancer tissues obtained from surgery (n = 52) using immunohistochemistry. RESULTS: mRNAs of both enzymes were detected in all prostate cancer cell lines examined, and the synthesis of estrone (E(1)) and estradiol (E(2)) was also confirmed in these cell lines. In addition, STS immunoreactivity was detected in 44 cases (85%) and EST in 39 cases (75%), respectively. CONCLUSIONS: STS and EST are expressed and may be involved in local production and metabolism of estrogens in human prostate cancers.

Cell Line, Tumor↗
PubMed1998

A quantitative mannose 6-phosphate receptor-based in vitro assay for recombinant human N-acetylgalactosamine-4-sulfatase.

An assay was developed, using two similar formats, to simultaneously measure both the lysosomal targeting receptor binding and enzyme activity of the recombinant human enzyme N-acetylgalactosamine-4-sulfatase. This assay also has potential application for all phosphorylated lysosomal enzymes that contain mannose-6-phosphate residues. The receptor was either purified from fetal bovine sera then adsorbed, or produced in situ by growing and fixing diploid human fibroblast-like cells, to a solid phase. The enzyme substrate was 4-methylumbelliferyl sulfate which fluoresces after cleavage of the sulfate moiety. Both the precursor and mature forms of the recombinant enzyme were used to demonstrate the specificity and usefulness of the assay. The assay is rapid and sensitive and has a wide dynamic range. Association between the receptor and the mannose-6-phosphate residues was abrogated in the presence of a competitive inhibitor, mannose 6-phosphate. However, partial activity was still measured when the mature enzyme was incubated in the presence of mannose 6-phosphate when using the fixed fibroblast format. This would indicate that the recombinant enzymes contain at least one terminal sugar moiety other than mannose 6-phosphate which can recognize receptors on the surface of human fibroblast-like cells. Other possible applications of this assay are also discussed.

Adsorption↗