Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Calbindin 2”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 451 records · Page 25Linked to original sources
PubMed1997

Expression of calretinin in diverse neuronal populations during development of rat hippocampus.

The prenatal and postnatal expression of calretinin was studied in hippocampus of the rat using immunohistochemical procedures. Calretinin was detected as early as embryonic day 15 in the primordial hippocampus where calretinin-containing neurons and fibres were localized to the primitive plexiform layer. Upon emergence of the hippocampal plate (the prospective stratum pyramidale), large numbers of immunopositive multipolar cells were observed in the marginal zone. Fewer cells with fusiform cell bodies were observed bordering the hippocampal plate and subplate. During the perinatal period (embryonic day 20 to postnatal day 0), large numbers of immunoreactive pyramidal-like neurons were observed at the margin of the hippocampal plate with the subplate. At this same time, many calretinin-containing neurons with irregularly shaped dendrites were observed in stratum radiatum. Soon after birth (postnatal day 3), the calretinin immunoreactivity of both these later cell types rapidly declined and a new population of calretinin-immunopositive cells emerged, the Cajal-Retzius cells of stratum lacunosum-moleculare and the dentate gyrus. The Cajal-Retzius cells rapidly matured but disappeared by the second postnatal week. During the second postnatal week, calretinin interneurons of the adult hippocampal formation began to appear. Their immunoreactivity increased by postnatal day 15, when the number of calretinin-immunopositive interneurons in area CA1 and stratum radiatum of CA3 exceeded that of the adult. At this time, the soma and proximal dendrites of many calretinin interneurons were found to contact each other. The frequency of such cellular appositions decreased in adulthood. The results presented here show that calretinin immunohistochemistry can be very useful in recording the development of subpopulations of hippocampal neurons that are present during distinct embryonic and postnatal periods. Although some neuronal types may exist only briefly during hippocampal development, others appear to express calretinin transiently during restricted phases of neuronal differentiation. Surprisingly, this includes some hippocampal pyramidal cells. However, even as the adult pattern of immunostaining emerges in week 2, morphological refinement of interneurons continues to take place, which eventually leads to the population of calretinin-containing interneurons of the mature hippocampus.

Animals↗
PubMed1998

Specialized distributions of mitochondria and endoplasmic reticulum proteins define Ca2+ wave amplification sites in cultured astrocytes.

This study was undertaken to examine the expression and role of the endoplasmic reticulum (ER) proteins calreticulin and ryanodine receptors, and mitochondria, in cultured astrocytes. Using several lines of investigation, we have identified a key role for mitochondria in astrocyte Ca2+ signalling: (1) a significant correlation was found between sites of regenerative Ca2+ wave amplification (possessing high amplitude ER Ca2+ release) and the location of mitochondria in the cell; (2) norepinephrine (2 microM) caused a rapid-onset increase in rhod 2 fluorescence in 34% of astrocyte mitochondria, indicating that cytosolic Ca2+ responses result in mitochondrial Ca2+ elevation; and (3) pretreatment with the protonophore carbonyl cyanide p-(trifluoromethoxy)phenylhydrazone to inhibit mitochondrial activity markedly reduced the amplitude of subsequent norepinephrine-evoked cytosolic Ca2+ responses. We then investigated the roles of several ER proteins in Ca2+ signalling by immunocytochemistry. Ryanodine receptors and calreticulin were found to be expressed in heterogeneous patterns in astrocytes. The expression pattern of calreticulin corresponded closely with the distribution of mitochondria, whereas the expression of ryanodine receptors was not similar to that of either of these cellular factors. We measured Ca2+ wave kinetics in a single astrocyte, then assessed protein distribution by immunocytochemistry in the same cell. Cross-correlation between norepinephrine-evoked Ca2+ wave amplitude and calreticulin distribution indicated a close spatial relationship between this Ca2+-binding protein and sites of regenerative wave amplification. These results demonstrate that amplification sites for Ca2+ waves in astrocytes are identifiable by accumulations of calreticulin (and type 2 InsP3Rs), and by the presence of mitochondria, which may regulate the ER Ca2+ release process.

Animals↗
PubMed2004

A novel population of calretinin-positive neurons comprises reelin-positive Cajal-Retzius cells in the hippocampal formation of the adult domestic pig.

Calretinin-containing neurons in the hippocampal formation, including the subiculum, presubiculum, parasubiculum, and entorhinal cortex, were visualized with immunocytochemistry. Calretinin immunoreactivity was present exclusively in non-principal cells. The largest immunoreactive cell population was found in the outer half of the molecular layer of the dentate gyrus and in the stratum lacunosum-moleculare of Ammon's horn. A proportion of these cells were also immunoreactive for reelin, a Cajal-Retzius cell marker. Similar calretinin-positive cells were found in the molecular layer of the subicular complex and entorhinal cortex. In the parasubiculum, a few immunoreactive bipolar and multipolar cells could be observed in the superficial and deep pyramidal cell layers. In the entorhinal cortex, bipolar and multipolar calretinin-positive cells were frequent in layer II, and large numbers of multipolar cells in layer V were immunoreactive. Electron microscopic analysis showed that somata of calretinin-positive cells contained either round nuclei with smooth nuclear envelopes or nuclei with multiple deep infoldings. Immunoreactive dendrites were smooth varicose, and the apposing axon terminals formed both symmetric and asymmetric synapses. Zonula adherentia were observed between calretinin-positive dendrites. Calretinin-positive axon terminals formed two types of synapses. Axon terminals with asymmetric synapses were found close to the hippocampal fissure, whereas axon terminals forming symmetric synapses innervated spiny dendrites in both the molecular layer of the dentate gyrus and in stratum lacunosum-moleculare of Ammon's horn. Calretinin-positive axon terminals formed both symmetric and asymmetric synapses with calretinin-positive dendrites. In conclusion, calretinin-positive neurons form two major subpopulations in the adult domestic pig hippocampus: (1) a gamma-aminobutyric acid (GABA)ergic subpopulation of local circuit neurons that innervates distal dendrites of principal cells in both the dentate gyrus and in Ammon's horn; and (2) Cajal-Retzius type cells close to the hippocampal fissure, as well as in the molecular layer of the subicular complex and entorhinal cortex.

Animals↗
PubMed1991

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.

Base Sequence↗
PubMed2005

Unilateral cochlear ablation in adult ferrets results in upregulation in calretinin immunostaining in the central nucleus of the inferior colliculus.

In the present study, unilateral cochlear ablations were performed in adult ferrets in order to determine whether an upregulation of the calretinin immunostained plexus in the central nucleus of the inferior colliculus occurs and if so, what the time course of this upregulation is. Accordingly, the mean gray level and the calretinin-immunostained area of the axonal plexus in the central nucleus of the inferior colliculus were evaluated at 1, 20 and 90 days after cochlear ablation. In unoperated animals, the calretinin-immunostained plexus was bilaterally symmetric. In ablated animals, both the mean gray level and the immunostained area of the plexus increased in the central nucleus of the inferior colliculus contralateral to the lesion compared with both the ipsilateral side and unoperated animals. This upregulation was present 24 h after the ablation and did not change at the two subsequent time points. In a previous study in young ferrets, the immunostained area of the plexus in the central nucleus of the inferior colliculus contralateral to the lesion increased 200% compared with control ferrets [J Comp Neurol 460 (2003) 585], whereas it increased only 33% in adult ferrets. These findings suggest that 1) calretinin upregulation in the contralateral central nucleus of the inferior colliculus following cochlear ablation occurs by 24 h after cochlear ablation and 2) there is an age-related decline in the magnitude of this upregulation after cochlear ablation.

Animals↗
PubMed1994

Dietary calcium deficiency causes a reduction in calretinin mRNA in the substantia nigra compacta-ventral tegmental area of rat brain.

Dietary calcium deprivation (3 weeks) affected neuronal gene expression of calretinin. Calcium deprived rats exhibited calcium appetite, weight loss, and a 28% decrease in calretinin mRNA in the substantia nigra compacta-ventral tegmental area, compared to controls. No changes were detected in 2 other mRNAs (tyrosine hydroxylase, beta-actin) and 5 other brain regions examined. This region-specific reduction of calretinin mRNA may relate to the altered physiology or behavior.

Actins↗
PubMed2000

Association between the calcium-binding protein calretinin and cytoskeletal components in the human colon adenocarcinoma cell line WiDr.

Calretinin (CR) is a Ca(2+)-binding protein (CaBP) of the EF-hand family expressed in a cell-type-specific manner and thought to act as a Ca(2+) buffer. Based upon previous studies, CR can undergo Ca(2+)-induced conformational changes, suggesting that it may also belong to the subfamily of Ca(2+)-sensor proteins that are characterized by their ability to interact with target ligands. To elucidate the role of CR, we used the undifferentiated colon adenocarcinoma cell line WiDr, which expresses significant amounts of CR. It has been shown previously that combined treatment with an inducer of differentiation sodium butyrate (NaBt) and a cell growth inhibitor hexamethylene bisacetamide (HMBA) or treatment with CR antisense oligonucleotides is down-regulating CR in parallel with a decrease of cell growth, suggesting a possible involvement of CR in maintaining the undifferentiated phenotype of WiDr cells. Furthermore, CR is absent from normal colon cells and from well-differentiated colon adenocarcinoma cell lines (e.g., Caco-2). Since members of the EF-hand family of proteins are interacting with cytoskeletal components, we investigated the possible association of CR with the cytoskeleton in WiDr cells. With double immunofluorescence stainings and immunoprecipitation experiments, we show close association of CR with intermediate filaments or microtubules in WiDr cells. Treatment with NaBt either disrupted or strongly diminished this interaction, respectively. The same effect was observed after elevation of [Ca(2+)](i) by applying the ionophore A-23187. These data suggest that CR may contribute to the transformation of enterocytes by interfering with the differentiation process, i.e., acting at both levels: cell shape dynamics and mitosis.

Adenocarcinoma↗
PubMed1992

Age-related changes in galanin- and calretinin-immunoreactive nerves of guinea-pig gallbladder.

Age-related changes in the expression of galanin- and calretinin-like immunoreactivity in the ganglionated plexus of 2-4 day, 6 month and 2 year old guinea-pig gallbladder were investigated. The ganglionated plexus was studied using immunohistochemical labelling techniques on whole mount stretch preparations of the gallbladders. Galanin- and calretinin-like immunoreactivity did not differ significantly between age groups of the 2-4 day and 6 month olds except for some reduction of calretinin-immunofluorescent nerves in the 6 month old preparations. However, in the ganglionated plexus of the 2 year old guinea-pig gallbladders, neither galanin- nor calretinin-like immunoreactivity could be detected. The implication of these findings, in relation to the physiological activity of the gallbladder is discussed.

Aging↗
PubMed1994

Ca(2+)-dependent and independent interactions of calretinin with hydrophobic resins.

The ability of rat calretinin to bind to hydrophobic resins in a Ca(2+)-dependent manner was examined. Both native calretinin present in cerebellum extract and purified recombinant calretinin bound similarly to hydrophobic resins such as phenyl-, hexyl-, octyl-, and W7-agarose. Hydrophobic interactions of calretinin were partially Ca(2+)-dependent since 1/3 of bound protein was released from the resins by EGTA under varied conditions. Some calretinin tryptic fragments bound to octyl-agarose in a manner similar to uncleaved calretinin, while others bound to the resin in a Ca(2+)-independent manner. These and other results suggest that calretinin has several hydrophobic regions of varied strength and sensitivity to Ca2+. It is proposed that the local changes in hydrophobicity induced by Ca2+ binding might be relevant for calretinin functions.

Animals↗
PubMed1998

Morphological organization of the globus pallidus-subthalamic nucleus system studied in organotypic cultures.

The morphological organization of the globus pallidus (GP), the subthalamic nucleus (STN), and the pallidosubthalamic projection was studied in organotypic cultures. Coronal slices from the GP, the STN, the striatum (CPu), and the cortex (Cx) were taken from the rat after postnatal days 0-2 and grown for 2 or 5-6 weeks. For analysis, immunocytochemistry against glutamate (GLU), parvalbumin (PV), and calretinin (CR) was combined with confocal microscopy. After 2 weeks in vitro, the STN showed a densely packed, homogeneous GLU-immunoreactive (ir) cell population. Pallidal GLU-ir neurons were heterogeneous, consisting of large-sized weakly GLU-ir neurons and small-sized intensively GLU-ir neurons. After 5-6 weeks in vitro, pallidal axons had radiated from numerous large-sized PV-ir cells and selectively innervated the STN, where they heavily ramified. Cultured STN neurons were not stained for PV; however, multipolar intensely PV-ir neurons were located at the border of the STN with their dendrites oriented towards the STN. Double labeling for PV and CR in both mature cultures and in the adult rat revealed that the culture CR-ir neurons from the GP, the Cpu, and from areas adjacent to the STN were different from cultured PV-ir neurons and their morphologies and distribution corresponded to that in vivo. These results demonstrate that 1) cultured CP and STN neurons display similar morphologies found in in vivo, 2) PV-ir pallidal neurons heavily and selectively innervate the STN; 3) there is a specific class of STN border neurons; and 4) in contrast to the in vivo situation, most cultured STN neurons are PV-negative.

Animals↗
PubMed2005

Quantitative changes in calretinin immunostaining in the cochlear nuclei after unilateral cochlear removal in young ferrets.

Neurons of the cochlear nuclei receive axosomatic endings from primary afferent fibers from the cochlea and have projections that diverge to form parallel ascending auditory pathways. These cells are characterized by neurochemical phenotypes such as levels of calretinin. To test whether or not early deafferentation results in changes in calretinin immunostaining in the cochlear nucleus, unilateral cochlear ablations were performed in ferrets soon after hearing onset (postnatal day [P]30-P40). Two months later, changes in calretinin immunostaining as well as cell size, volume, and synaptophysin immunostaining were assessed in the anteroventral (AVCN), posteroventral (PVCN), and dorsal cochlear nucleus (DCN). A decrease in calretinin immunostaining was evident ipsilaterally within the AVCN and PVCN but not in the DCN. Further analysis revealed a decrease both in the calretinin-immunostained neuropil and in the calretinin-immunostained area within AVCN and PVCN neurons. These declines were accompanied by significant ipsilateral decreases in volume as well as neuron area in the AVCN and PVCN compared with the contralateral cochlear nucleus and unoperated animals, but not compared with the DCN. In addition, there was a significant contralateral increase in calretinin-immunostained area within AVCN and PVCN neurons compared with control animals. Finally, a decrease in area of synaptophysin immunostaining in both the ipsilateral AVCN and PVCN without changes in the number of boutons was found. The present data demonstrate that unilateral cochlear ablation leads to 1) decreased immunostaining of the neuropil in the AVCN and PVCN ipsilaterally, 2) decreased calretinin immunostaining within AVCN and PVCN neurons ipsilaterally, 3) synaptogenesis in the AVCN and PVCN ipsilaterally, and 4) increased calretinin immunostaining within AVCN and PVCN neurons contralaterally.

Animals↗
PubMed1992

Calretinin-immunoreactivity in the oro-facial and pharyngeal regions of the rat.

Calretinin-immunoreactivity (CR-ir) was examined in the rat oro-facial and pharyngeal tissues using an immunofluorescence method. CR-ir was distributed in the entire size range of trigeminal ganglion neurons. CR-ir was also observed in nerve fibers surrounding neuronal cell bodies in autonomic ganglia, and in nerve endings in the lip, tongue, incisal papilla, soft palate, pharynx and epiglottis. CR-immunoreactive nerve endings were all in close proximity to the epithelium, and classified into 2 types; simple (free nerve ending) and taste-bud-related types. In the salivary gland, positive nerve fibers were seen around large excretory ducts. The present study indicates that viscerosensory (probably including gustatory) nerve fibers innervating the oral and pharyngeal tissues contain CR, while somotosensory nerve fibers innervating the facial skin are devoid of CR.

Animals↗
PubMed2005

Adenomatoid tumor of the adrenal gland: a clinicopathologic study of 3 cases.

Adenomatoid tumors are relatively uncommon benign neoplasms of mesothelial origin, usually occurring in the male and female genital tracts. Rare extragenital adenomatoid tumors have been identified in the adrenal glands, heart, mesentery, pleura, and lymph nodes. In the adrenal gland, adenomatoid tumors may pose a diagnostic challenge. The differential diagnosis includes adrenocortical carcinoma and metastatic carcinoma, especially signet ring cell carcinoma. Because of its glandular pattern, an adenomatoid tumor may be confused with an adenocarcinoma. We present 3 cases of adrenal adenomatoid tumors, including one with a concurrent large hemorrhagic vascular adrenal cyst. The adenomatoid tumors were unilateral, appeared solid and white, and varied from 1.7 to 4.2 cm in diameter. They occurred in 3 male patients aged 33, 33, and 46 years. One patient presented with abdominal pain due to the presence of a concurrent large adrenal cyst. The tumor was an incidental radiological finding in another case and was discovered during the course of a workup for hypertension in the third case. The light microscopic appearances were consistent with those of typical adenomatoid tumors. Immunohistochemical stains for calretinin and cytokeratin 5/6 were positive, confirming the tumors' mesothelial origin. Ultrastructural studies performed in 2 cases revealed microvilli and desmosomes. Follow-up showed no evidence of recurrence or metastasis. In our experience, the key to the diagnosis of this rare benign tumor is to consider adenomatoid tumor in the differential diagnosis of any glandular tumor occurring in the adrenal gland.

Adenocarcinoma↗
PubMed2001

Immunohistochemical analysis still has a limited role in the diagnosis of malignant mesothelioma. A study of thirteen antibodies.

To identify the most accurate and useful panel to diagnose mesothelioma, we immunostained sections from 112 mesotheliomas, 18 adenocarcinomas, and 11 reactive pleural specimens with 13 antibodies. Positive results for mesotheliomas, adenocarcinomas, and reactive pleura, respectively, were CAM5.2, 111, 18, and 11; vimentin, 30, 3, and 3; HBME-1, 75, 10, and 8; thrombomodulin, 31, 2, and 2; calretinin, 43, 6, and 11; and CD44H, 68, 10, and 4. Positive results for adenocarcinoma markers in mesotheliomas and adenocarcinomas, respectively, were carcinoembryonic antigen, 1 and 15; LeuM1, 7 and 9; and Ber-EP4, 5 and 12. All reactive pleura were negative. Positive results for markers to help distinguish mesothelioma from reactive pleura in mesotheliomas, adenocarcinomas, and reactive pleura, respectively, were epithelial membrane antigen, 76, 17, and 6; p53, 78, 16, and 9; P-170 glycoprotein, 37, 4, and 2; and platelet-derived growth factor receptor beta, 31, 1, and 2. The differential diagnosis of mesothelioma from adenocarcinoma is based on negative markers. Individual mesothelial markers are of low sensitivity and specificity for mesothelioma. However, diagnostic accuracy is improved by the use of antibody panels. To date there are no antibodies that help distinguish mesothelioma from reactive pleura.

ATP Binding Cassette Transporter, Subfamily B↗
PubMed2005

Expression of A-type K channel alpha subunits Kv 4.2 and Kv 4.3 in rat spinal lamina II excitatory interneurons and colocalization with pain-modulating molecules.

Voltage-gated K(+) channel alpha subunits Kv 4.2 and Kv 4.3 are the major contributors of somatodendritic A-type K(+) currents in many CNS neurons. A recent hypothesis suggests that Kv 4 subunits may be involved in pain modulation in dorsal horn neurons. However, whether Kv 4 subunits are expressed in dorsal horn neurons remains unknown. Using immunohistochemistry, we found that Kv 4.2 and Kv 4.3 immunoreactivity was concentrated in the superficial dorsal horn, mainly in lamina II. Both Kv 4.2 and Kv 4.3 appeared on many rostrocaudally orientated dendrites, whereas Kv 4.3 could be also detected from certain neuronal somata. Kv 4.3(+) neurons were a subset of excitatory inerneurons with calretinin(+)/calbindin(-)/PKCgamma(-) markers, and a fraction of them expressed micro-opioid receptors. Kv 4.3(+) neurons also expressed ERK 2 and mGluR 5, which are molecules related to the induction of central sensitization, a mechanism mediating nociceptive plasticity. Together with the expression of Kv 4.3 in VR 1(+) DRG neurons, our data suggest that Kv C4 subunits could be involved in pain modulation.

Animals↗
PubMed2000

Value of the mesothelium-associated antibodies thrombomodulin, cytokeratin 5/6, calretinin, and CD44H in distinguishing epithelioid pleural mesothelioma from adenocarcinoma metastatic to the pleura.

Until recently, the standard approach of most laboratories in distinguishing epithelioid pleural mesothelioma from metastatic adenocarcinoma has been a negative result from a panel of adenocarcinoma-associated antibodies. However, several "mesothelium-associated" antibodies have been proposed as useful in this situation, and we have applied four of these putative mesothelioma markers--thrombomodulin, cytokeratin 5/6, calretinin, and CD44H--to a series of 61 epithelioid pleural mesotheliomas and 63 metastatic adenocarcinomas with known primary sites (lung = 19; breast = 21; ovary = 6; colon = 10; kidney = 4; uterus, epididymis, pancreas = 1 case each). Of the mesotheliomas, 55 of 61 (90%) stained for thrombomodulin, 56 of 61 (92%) for cytokeratin 5/6, 47 of 51 cases (92%) were positive for calretinin, and 39 of 43 (91%) were positive for CD44H. Of the metastatic adenocarcinomas, 12 of 63 (19%) cases were positive for thrombomodulin, 9 of 63 (14%) were positive for CK5/6, and 27 of 60 (45%) were positive for CD44H. With calretinin, only 1 case of 59 (2%) showed positive nuclear staining. All four antibodies stained reactive mesothelium; thrombomodulin also stained endothelium; and CD44H variably stained lymphocytes, macrophages, and fibroblasts. We conclude that all four antibodies show high sensitivity for epithelioid mesothelioma, but only calretinin (98%), cytokeratin 5/6 (86%), and thrombomodulin (81%) show sufficient specificity for practical use in this situation.

Adenocarcinoma↗
PubMed2006

Use of mesothelin as a marker for mesothelial cells in cytologic specimens.

Immunocytochemistry is often employed for the distinction between mesothelial cells and adenocarcinoma. Mesothelin has recently been reported to be expressed in reactive mesothelial cells and epithelioid mesotheliomas. The objective of this study is to determine the utility of mesothelin as marker for mesothelial cells in cytologic preparations. Thirty cell blocks were retrieved from the archives and immunostained with monoclonal antibody directed against mesothelin and calretinin. Heat-induced epitope retrieval technique was employed, and the immunostaining was accomplished using an automated stainer. These tissue blocks were from 35 patients (17 females and 18 males) with a median age of 64 years. Nine were benign effusions, 11 mesotheliomas, and 18 metastatic adenocarcinomas. The presence of any immunoreactivity, irrespective of level of intensity or percentage of cells, was considered positive for mesothelin expression. Follow up included correlation with pathology materials obtained at surgery and review of medical records. Mesothelin staining was positive in 7/9 benign cases, 8/11 mesotheliomas, and 8/18 adenocarcinomas. The difference of mesothelin expression between mesothelial cells and adenocarcinoma was statistically significant. For calretinin, all cases, except 2 malignant mesotheliomas and 3 adenocarcinomas, showed positive staining with calretinin. As a marker for mesothelial cells, the sensitivity and specificity of mesothelin were 73% and 55%, respectively, and the sensitivity and specificity of calretinin were 95% and 86%, respectively. Therefore, mesothelin is not a sensitive or a specific marker for mesothelial cells in cytologic specimens when compared with calretinin.

Adenocarcinoma↗
PubMed1995

Up-regulation of calretinin in the supraoptic nucleus of the rat after chronic salt loading.

We immunocytochemically examined the effect of chronic salt loading on the content of calretinin, a calcium-binding protein, in both the supraoptic nucleus and the magnocellular parts of the hypothalamic paraventricular nucleus. In control rats that were given water for drinking, the supraoptic nucleus contained a cluster of calretinin-stained cells. Drinking 2% sodium chloride solution for 7 days resulted in an increase of the staining intensity of calretinin in cells of the suprasoptic nucleus. In both the control and salt-loaded rats, the magnocellular parts of the paraventricular nucleus were almost devoid of calretinin-labeled cells. It is suggested that expression of calretinin in cells of the supraoptic nucleus is up regulated by chronic salt loading.

Animals↗