Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “quadruplex”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 433 records · Page 24Linked to original sources
PubMed2000

Structure-activity relationships among guanine-quadruplex telomerase inhibitors.

The ribonucleoprotein telomerase is responsible for maintaining the length of telomeric ends of chromosomes in tumour cells. It is activated in over 85% of the tumour cells, and is emerging as a major target for cancer chemotherapy. A range of molecules containing tricyclic and tetracyclic aromatic chromophores has been shown to inhibit the telomerase enzyme system at the micromolar level. There is evidence that they do so via stabilisation of a guanine-quadruplex structure, which provides a stop signal for further telomere elongation. The known structure-activity relationships for these compounds are summarised, and pointers for the development of future molecules with enhanced selectivity are described.

Binding Sites↗
PubMed2000

Biologically active oligodeoxyribonucleotides. Part 12: N2-methylation of 2'-deoxyguanosines enhances stability of parallel G-quadruplex and anti-HIV-1 activity.

2'-Deoxyguanosine residues of a 3',5'-end-modified hexadeoxyribonucleotide (R-95288) with anti-HIV-1 activity were substituted with N2-methyl-2'-deoxyguanosine (m2dG). These modified oligodeoxyribonucleotides (ODNs) showed a 2-fold higher activity than R-95288. Also, the CD spectra of these ODNs indicated that the m2dG modification stabilized the tertiary structure of the G-quadruplex.

Anti-HIV Agents↗
PubMed2001

G-quadruplex DNA binding by a series of carbocyanine dyes.

We have examined a number of carbocyanine dyes for their ability to bind intramolecular G-quadruplex DNA structures (G4'-DNA) using a Taq polymerase stop assay. Of the five dyes examined, only one, N,N'-diethylthiacarbocyanine iodide (DTC), was found to bind to G4'-DNA. DTC was also the only dye found to inhibit human telomerase at 50 microM concentration.

Binding Sites↗
PubMed1995

Self-association of a DNA loop creates a quadruplex: crystal structure of d(GCATGCT) at 1.8 A resolution.

BACKGROUND: The flexibility of DNA enables it to adopt three interconvertible types of duplex termed the A-, B- and Z-forms. It can also produce hairpin loops, triplex structures and guanine-rich quadruplex structures. Conformational flexibility assists in the tight packaging of DNA, for example in chromosomes. This is important given the large quantity of genetic information that must be packaged efficiently. Moreover, the ability of DNA to specifically self-associate or interact with complementary sequences is fundamental to many biological processes. Structural studies provide information about DNA conformation and DNA-DNA interactions and suggest features that might be relevant to how the molecule performs its biological role. RESULTS: We have characterized the structure of a synthetic heptanucleotide that folds into a novel loop structure. The loop is stabilized by association with a cation, by intra-strand hydrogen bonds between guanine and cytosine that are distinct from the normal Watson-Crick hydrogen bonds, and by van der Waals interactions. Two loops associate through the formation of four G.C pairs that exhibit pronounced base-stacking interactions. The formation of a symmetric A.A base pair further stabilizes loop dimerization. Stacking of the A.A pair on a symmetry-related A.A pairing assists the formation of a four-stranded assembly. A T.T pairing is also observed between symmetry-related loops. CONCLUSIONS: This analysis provides a rare example of an experimentally determined non-duplex DNA structure. It provides conformational detail relevant to the tight packaging or folding of a DNA strand and illustrates how a cation might modulate phosphate-phosphate repulsion in a tightly packed structure. The observation of base quartets involving G.C base pairs suggests a further structure to be considered in DNA-DNA interactions. The structure also provides detailed geometries for A.A and T.T base pairs.

Base Composition↗
PubMed1991

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.

Base Composition↗
PubMed1996

The selectivity for K+ versus Na+ in DNA quadruplexes is dominated by relative free energies of hydration: a thermodynamic analysis by 1H NMR.

We have studied the competition between Na+ and K+ for coordination by G quartets using the oligonucleotide d(G3T4G3) as a model system. d(G3T4G3) forms a dimeric foldback structure containing three G quartets in the presence of either NaCl or KCl. Proton chemical shifts, which are particular to the species of coordinated ion, have been used to monitor the conversion between the sodium and potassium forms under equilibrium conditions. Analysis of titration experiments indicates that at least two K+ are coordinated by the three quartets of the dimeric molecule, and perfect fits of the data are obtained for two Na+ being displaced by two K+. Our results also indicate that the conversion of [d(G3T4G3)]2 from the sodium to the potassium form is associated with a net free energy change (delta G degrees) of -1.7 +/- 0.15 kcal/mol. It has long been suggested that the greater thermal stability of DNA quadruplex structures in the presence of K+ is primarily a result of the optimal fit of this ion in the coordination sites formed by G quartets. However, a consideration of the relatively small change in free energy associated with the conversion from the sodium to the potassium form and the relatively large difference between the free energy of hydration for Na+ and K+ indicates that this cannot be correct. Rather, the preferred coordination of K+ over Na+ is actually driven by the greater energetic cost of Na+ dehydration with respect to K+ dehydration.

DNA↗
PubMed2003

Activity of a novel G-quadruplex-interactive telomerase inhibitor, telomestatin (SOT-095), against human leukemia cells: involvement of ATM-dependent DNA damage response pathways.

The telomerase complex is responsible for telomere maintenance and represents a promising neoplasia therapeutic target. In order to determine whether G-quadruplex-interactive telomerase inhibitor, telomestatin (SOT-095), might have effects on telomere dynamics and to evaluate the clinical utility, we assessed the effects of telomestatin on BCR-ABL-positive human leukemia cells. We found that treatment with telomestatin reproducibly inhibited telomerase activity in the BCR-ABL-positive leukemic cell lines OM9;22 and K562, resulting in telomere shortening. Inhibition of telomerase activity by telomestatin disrupts telomere maintenance and ultimately results in telomere dysfunction. Telomestatin completely suppressed the plating efficiency of K562 cells at 1 microM; however, telomestatin had less effects on BFU-Es and CFU-GMs colony formation from normal bone marrow CD34-positive cells. Enhanced chemosensitivity toward imatinib and chemotherapeutic agents was also observed in telomestatin-treated K562 cells. Further, the combination of telomestatin plus imatinib more effectively inhibited hematopoietic colony formation by primary human chronic myelogenous leukemia cells. Last, telomestatin induced the activation of ATM and Chk2, and subsequently increased the expression of p21(CIP1) and p27(KIP1). These results demonstrate that telomere dysfunction induced by telomestatin activates the ATM-dependent DNA damage response. We conclude that telomerase inhibitors combined with the use of imatinib and other chemotherapeutic agents may be very useful for the treatment of human leukemia.

Apoptosis↗
PubMed2006

Telomerase inhibition with a novel G-quadruplex-interactive agent, telomestatin: in vitro and in vivo studies in acute leukemia.

The telomerase complex is responsible for telomere maintenance and represents a promising neoplasia therapeutic target. Recently, we have demonstrated that treatment with a G-quadruplex-interactive agent, telomestatin reproducibly inhibited telomerase activity in the BCR-ABL-positive leukemic cell lines. In the present study, we investigated the mechanisms of apoptosis induced by telomerase inhibition in acute leukemia. We have found the activation of caspase-3 and poly-(ADP-ribose) polymerase in telomestatin-treated U937 cells (PD20) and dominant-negative DN-hTERT-expressing U937 cells (PD25). Activation of p38 mitogen-activated protein (MAP) kinase and MKK3/6 was also found in telomestatin-treated U937 cells (PD20) and dominant-negative DN-hTERT-expressing U937 cells (PD25); however, activation of JNK and ASK1 was not detected in these cells. To examine the effect of p38 MAP kinase inhibition on growth properties and apoptosis in telomerase-inhibited cells, we cultured DN-hTERT-expressing U937 cells with or without SB203580. Dominant-negative-hTERT-expressing U937 cells stopped proliferation on PD25; however, a significant increase in growth rate was observed in the presence of SB203580. Treatment of SB203580 also reduced the induction of apoptosis in DN-hTERT-expressing U937 cells (PD25). These results suggest that p38 MAP kinase has a critical role for the induction of apoptosis in telomerase-inhibited leukemia cells. Further, we evaluated the effect of telomestatin on the growth of U937 cells in xenograft mouse model. Systemic intraperitoneal administration of telomestatin in U937 xenografts decreased tumor telomerase levels and reduced tumor volumes. Tumor tissue from telomestatin-treated animals exhibited marked apoptosis. None of the mice treated with telomestatin displayed any signs of toxicity. Taken together, these results lay the foundations for a program of drug development to achieve the dual aims of efficacy and selectivity in vivo.

Acute Disease↗
PubMed2026

Symmetric and near-symmetric cyanine probes for G-quadruplexes: molecular recognition, signal transduction, and biological applications.

G-quadruplexes (G4s) are dynamic noncanonical nucleic-acid structures involved in genome maintenance, transcription, RNA metabolism, and mitochondrial function, and are implicated in disease-associated processes. Symmetric and near-symmetric cyanines are versatile platforms for G4 recognition because their polymethine length, terminal heterocycles, charge distribution, conformational freedom, and supramolecular organization can be systematically tuned within related scaffolds. This review discusses how these structural features control G4 recognition and optical signal transduction through terminal G-tetrad stacking, loop and groove contacts, restriction of molecular motion, and aggregate reorganization. We first summarize in vitro recognition, structural discrimination, and G4-mediated sensing, and then discuss DNA and RNA G4 imaging, G4-associated biological processes, and emerging in vivo applications. Particular attention is given to several distinctions that are essential for interpreting probe performance: binding affinity versus fluorescence activation, topology preference versus DNA/RNA selectivity, organelle accumulation versus molecular targeting, and imaging contrast versus biological validation. Overall, molecular symmetry is considered a tunable design variable rather than a direct predictor of performance. Future studies should emphasize matched structural series, reversible and minimally perturbing probes, optical readouts that are less dependent on probe concentration, clear separation of DNA and RNA contributions, and standardized validation across solution, cellular, and whole-organism studies.

Journal Article↗
PubMed2026

Identification of a G-quadruplex-forming cell-free DNA fragment as a biomarker for the precise diagnosis of hepatocellular carcinoma.

Early detection of hepatocellular carcinoma (HCC) remains challenging, as the currently recommended surveillance strategy based on ultrasound combined with alpha-fetoprotein (AFP) is limited by suboptimal sensitivity and accessibility. Cell-free DNA (cfDNA) provides a minimally invasive avenue for cancer detection. However, most existing cfDNA-based approaches either perform unreliably in low-input samples or require analytically complex workflows. Here, we systematically profiled serum cfDNA from individuals with HCC and without HCC and identified a high-abundance tumor-associated single cfDNA fragment at the FAM230F genomic region. Integrative analysis of liver assay for transposase-accessible chromatin with sequencing (ATAC-seq) data revealed consistent tumor-specific chromatin accessibility at this locus, suggesting a tumor-derived origin. Structural characterization further demonstrated enrichment of G-quadruplex (G4) features within the target sequence, which may increase resistance to serum nuclease degradation and promote its preferential retention in circulation. Based on these properties, we established a qPCR-based detection workflow with clinical accessibility. In a validation cohort independent of the discovery cohort, a ΔC t cutoff of 2 was selected by maximizing the Youden index within the same cohort. The assay showed a sensitivity of 94.5% and a specificity of 90.5% for distinguishing HCC from non-HCC. Collectively, our study identifies FAM230F as a structurally stable tumor-associated cfDNA fragment and establishes a simple and scalable qPCR-based assay for HCC detection, providing a practical framework for translating cfDNA fragment analysis into clinical biomarkers.

Journal Article↗
PubMed2003

DNA duplex-quadruplex exchange as the basis for a nanomolecular machine.

There is currently great interest in the design of nanodevices that are capable of performing linear or rotary movements. Protein molecular machines are abundant in biology but it has recently been proposed that nucleic acids could also act as nanomolecular machines in model systems. Several types of movements have been described with DNA machines: rotation and "scissors-like" opening and closing. Here we show a nanomachine that is capable of an extension-contraction movement. The simple and robust device described here is composed of a single 21-base oligonucleotide and relies on a duplex-quadruplex equilibrium that may be fueled by the sequential addition of DNA single strands, generating a DNA duplex as a by-product. The interconversion between two well defined topological states induces a 5-nm two-stroke, linear motor-type movement, which is detected by fluorescence resonance energy transfer spectroscopy.

Base Sequence↗
PubMed1993

Thrombin-binding DNA aptamer forms a unimolecular quadruplex structure in solution.

We have used two-dimensional 1H NMR spectroscopy to study the conformation of the thrombin-binding aptamer d(GGTTGGTGTGGTTGG) in solution. This is one of a series of thrombin-binding DNA aptamers with a consensus 15-base sequence that was recently isolated and shown to inhibit thrombin-catalyzed fibrin clot formation in vitro [Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H. & Toole, J. J. (1992) Nature (London) 355, 564-566]. The oligonucleotide forms a unimolecular DNA quadruplex consisting of two G-quartets connected by two TT loops and one TGT loop. A potential T.T bp is formed between the two TT loops across the diagonal of the top G-quartet. Thus, all of the invariant bases in the consensus sequence are base-paired. This aptamer structure was determined by NMR and illustrates that this molecule forms a specific folded structure. Knowledge of this structure may be used in the further development of oligonucleotide-based thrombin inhibitors.

Base Sequence↗
PubMed1995

A yeast gene product, G4p2, with a specific affinity for quadruplex nucleic acids.

G4 nucleic acids are quadruplex structures involving guanine-rich sequences that form in vitro under moderate conditions. Experimental evidence exists supporting biological functions for these elements; however, direct demonstration of G4 nucleic acids in vivo has not yet been achieved. Here we purify and characterize a yeast protein, G4p2, which has a specific affinity for G4 nucleic acids. G4p2 binds equivalently to RNA and DNA in G4 form. The Keq for G4p2 binding to a G4 DNA oligomer is 2.2 x 10(8) M-1 under near physiological conditions. We have cloned and sequenced the gene encoding G4p2 and have shown it to be identical to MPT4 and STO1. MPT4 was isolated in a screen for multicopy suppressors of staurosporine sensitivity in POP2 cells. Pop2 is a complex regulatory factor that participates, in part, in the repression of certain genes in the absence of glucose (Sakai, A., Chibazakura, T., Shimizu, Y., and Hishinuma, F. (1992) Nucleic Acids Res. 20, 6227-6233). STO1 was isolated as a multicopy suppressor of TOM1, an uncharacterized mutation that leads to temperature-sensitive cell cycle arrest at the G2/M boundary. Suppression of these mutations by G4p2 indicate this G4 nucleic acid binding protein may function in signal transduction pathways regulated by protein kinases, which control carbon source utilization, and in cell cycle progression.

Amino Acid Sequence↗
PubMed2004

Stm1p, a G4 quadruplex and purine motif triplex nucleic acid-binding protein, interacts with ribosomes and subtelomeric Y' DNA in Saccharomyces cerevisiae.

The Saccharomyces cerevisiae protein Stm1 was originally identified as a G4 quadruplex and purine motif triplex nucleic acid-binding protein. However, more recent studies have suggested a role for Stm1p in processes ranging from antiapoptosis to telomere maintenance. To better understand the biological role of Stm1p and its potential for G(*)G multiplex binding, we used epitope-tagged protein and immunological methods to identify the subcellular localization and protein and nucleic acid partners of Stm1p in vivo. Indirect immunofluorescence microscopy indicated that Stm1p is primarily a cytoplasmic protein, although a small percentage is also present in the nucleus. Conventional immunoprecipitation found that Stm1p is associated with ribosomal proteins and rRNA. This association was verified by rate zonal separation through sucrose gradients, which showed that Stm1p binds exclusively to mature 80 S ribosomes and polysomes. Chromatin immunoprecipitation experiments found that Stm1p preferentially binds telomere-proximal Y' element DNA sequences. Taken together, our data suggest that Stm1p is primarily a ribosome-associated protein, but one that can also interact with DNA, especially subtelomeric sequences. We discuss the implications of our findings in relation to prior genetic, genomic, and proteomic studies that have identified STM1 and/or Stm1p as well as the possible biological role of Stm1p.

Amino Acid Motifs↗