Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “peanut”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 433 records · Page 24Linked to original sources
PubMed1995

Localization of peanut (Arachis hypogaea) root lectin (PRA II) on root surface and its biological significance.

The glucose-specific peanut root lectin, PRA II, is localized on the surface of 7-day-old peanut seedling root and in root cortical parenchymatous cells. The lectin is eluted from intact roots upon washing with buffer containing glucose. Rabbit erythrocytes bind to the root surface and the cortical cells; the binding is inhibited by antibodies raised against PRA II, peanut-specific Rhizobium cells and by glucose. Lipopolysaccharides isolated from host-specific Rhizobium strain inhibit the haemagglutinating activity of PRA II and are precipitated by the lectin. Our results suggest that PRA II might be involved in recognition of Rhizobium by peanut roots.

Animals↗
PubMed1992

Diagnosis of peanut inhalation by MRI.

A peanut is a commonly inhaled foreign body during childhood. Some cases are difficult to diagnose especially in cases without a clear history of inhalation. We describe a 16-month-old boy presenting with stridor and fever. The chest x-ray suggested inhalation of a foreign body but there was no history of this. A high spot on a T1-weighted chest MRI was due to a peanut which was seen to have moved from the right main bronchus to the left inferior bronchus, between the two MRI studies. MRI can provide information on position and size of the peanut, the conditions of the surrounding tissues and may be also useful in treatment. We consider MRI to be a valuable new method for the diagnosis of peanut inhalation.

Arachis↗
PubMed1987

Chemical composition and protein properties of peanuts.

Because of the shortage of food proteins throughout the world, peanut has attracted the interest as potential source of protein for human as well as animal consumption. It was shown that peanut from the four different sources contained fair amounts of protein and its products. Mineral elements analysis revealed that K, Mg, Cu, Mn, Fe and P were present in nutritionally significant amounts in all samples. Moreover, K was found in high level. The nutritional value of protein is considered by its content of essential amino acids. Peanuts contained high levels of arginine and histidine. The remaining amino acids were present in substantial quantities except methionine, tryptophan and cystine were considered low. Peanut proteins were extracted from defatted flour by different solvents: deionized water, sodium chloride and calcium chloride solutions at different pH-values. The extracting ability at pH from 1-4 was decreased and increased at pH 4-5 by raising the concentration of sodium chloride solutions, respectively. Whereas on using sodium chloride solutions at pH 6-10, the percentage of extracted protein decreased again. Calcium chloride solutions suppressed protein extractability at all pH-values tested. Both mono and divalent salts increased protein extractability at pH 4-5.5 and the extraction increased with higher salt concentrations.

Amino Acids↗
PubMed1990

Processing of commercial peanut cake into food-grade meal and its utilization in preparation of cookies.

The commercial cake produced during expeller pressing of peanuts was extracted with n-hexane, and 80% ethanol followed by sieving through 80 mesh, to remove residual oil, pigments, bitter taste and fibrous material. The processed meal exhibited comparable composition with defatted peanut flour prepared in the laboratory by solvent extraction of full-fat peanut meal. However, the processed cake meal exhibited low methionine content and in vitro protein digestibility as compared with defatted peanut flour. The processed cake meal can be blended with wheat flour to the extent of 10% (w/w) to prepare acceptable cookies with improved protein and mineral contents.

Arachis↗
PubMed1984

N-malonyltransferases from peanut.

Three distinct N-malonyltransferases were purified from peanut seedlings, accepting either anthranilic acid, D-tryptophan, or 3,4-dichloroaniline, respectively, as a substrate. Partially purified malonyl-CoA:D-tryptophan malonyltransferase also catalyzed the formation of the corresponding malonic acid conjugate when 1-aminocyclopropane-1-carboxylic acid was employed as a substrate. These N-malonyltransferases were clearly distinguished from several O-malonyltransferase activities also present in the same seedlings. N-Malonic acid conjugates have been previously isolated from peanut either as a natural constituent or after feeding with xenobiotics. By analogy to the results reported with cultured parsley cells, multiple malonyltransferases in peanut may have a role in vacuolar transport. Crude extracts of young peanut seedlings were incapable of hydrolyzing the respective N-malonic acid conjugates. However, dialyzed extracts of older plants released malonic acid from malonyl-1-aminocyclopropane-1-carboxylic acid but not from malonyl-3,4-dichloroaniline, suggesting that some N-malonic acid conjugates may be metabolized in plants which are approaching senescence.

Acyltransferases↗
PubMed1990

Characterization and behaviour of 15-lipoxygenase during peanut cotyledonary senescence.

Lipoxygenase (EC 1.13.11.12) (LOX), a ubiquitous plant enzyme which catalyzes the hydroperoxidation of unsaturated fatty acids (PUFA), plays an important role during the course of leaf and cotyledonary senescence. In the present study, senescence related changes in chlorophyll and protein content and lipoxygenase activity have been examined in peanut cotyledons. The chlorophyll content of the cotyledons increased from the 2nd to 8th day followed by a steady decline. In contrast, protein content of peanut cotyledons decreased continuously during senescence. Lipoxygenase activity, on the other hand, increased in early stages of germination followed by a decrease in the later course of senescing peanut cotyledons. Analysis of the product profile, the lipoxygenase with arachidonic acid as the substrate on HPLC, has shown a single peak comigrating with standard 15-Hydroperoxyeicosatetraenoic acid. The results on peanut cotyledonary 15-lipoxygenase activity in relation to abscisic acid and kinetin are discussed.

Arachidonate 15-Lipoxygenase↗
PubMed1980

Aortic collagen, elastin and non-fibrous protein synthesis in rabbits red cholesterol and peanut oil.

Alteration of the fatty acid composition of atherogenic test diets has been a widely recognized method for influencing the character and severity of atherosclerotic lesions. The addition of peanut oil or coconut oil to cholesterol-supplemented diets has been shown to produce lesions of a fibrous nature in several species. In the present study, addition of 8% peanut oil to a 2% cholesterol diet accelerated the formation of atherosclerotic lesions which were more fibrous after only 90 days than those previously seen in rabbits even after 6 months on a diet supplemented with cholesterol alone. Collagen, elastin and non-fibrous protein synthesis were all increased over control values, as previously seen in aortas from rabbits given cholesterol supplementation alone. However, the addition of peanut oil to the 2% cholesterol diet produced a preferential increase in the rate of aortic collagen synthesis per unit dry, defatted weight compared with the increases seen in elastin, non-fibrous protein or total protein synthesis. Collagen deposition in proliferative intimal plaques was evident by histological examination. These focal accumulations, however, did not result in significant increases in either total collagen content of the whole descending thoracic aorta or in collagen concentration expressed per unit of dry, defatted weight. These data suggest that, while a portion of the increased synthetic rates may be a direct result of aortic hyperplasia, the proportionally greater increase in collagen synthesis in these lesions is attributable to the addition of peanut oil to the atherogenic diet. Although the lesions produced in this experiment lacked the overt fibrosis seen in man and in some forms of experimentally induced atherosclerosis, the relative synthetic rates of collagen, elastin and nonfibrous protein described here suggest that even a small preferential increase in collagen synthesis compared with non-collagen protein synthesis may gradually lead to a more fibrous lesion.

Animals↗
PubMed1991

Changes in chemical composition and sensory qualities of peanut milk fermented with lactic acid bacteria.

The effects of fermentation of aqueous extracts of peanuts (peanut milk) with Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus salivarius ssp. thermophilus, separately and in combination, on selected chemical and sensory qualities were investigated. Changes in pH, titratable acidity and viable cell populations indicated that there was a synergistic interaction between L. delbrueckii ssp. bulgaricus and S. salivarius ssp. thermophilus during fermentation. Analysis of headspace volatiles revealed that hexanal, which is one of the compounds responsible for undesirable green/beany flavor in peanut milk, completely disappeared as a result of fermentation. S. salivarius ssp. thermophilus was more effective than L. delbrueckii ssp. bulgaricus in reducing the hexanal content. The acetaldehyde content of peanut milk increased during fermentation. Changes in concentrations of these volatile compounds were correlated with sensory evaluation scores which showed that a significant (P less than or equal to 0.05) decrease in green/beany flavor and a significant increase in creamy flavor occurred as a result of fermentation.

Acetaldehyde↗
PubMed2006

Regulation of ABA level and water-stress tolerance of Arabidopsis by ectopic expression of a peanut 9-cis-epoxycarotenoid dioxygenase gene.

The oxidative cleavage of cis-epoxycarotenoids catalyzed by 9-cis-epoxycarotenoid dioxygenase (NCED) is considered to be the rate-limiting step in abscisic acid (ABA) biosynthesis. Here we demonstrate that the expression of AhNCED1 gene in peanut plants is significantly up-regulated by dehydration and high salinity. The AhNCED1 transcript and endogenous ABA both accumulate predominantly in leaves and stems of peanut in response to dehydration. The considerable up-regulation of AhNCED1 expression by exogenous application of ABA suggests a positive feedback control of ABA biosynthesis in peanut. NAA at high concentration increases ABA biosynthesis in peanut plants through up-regulation of the AhNCED1 gene expression. The constitutive expression of the AhNCED1 gene in wild-type Arabidopsis results in an increase of ABA accumulation in transgenic plants in response to drought stress. Ectopic expression of AhNCED1 gene in 129B08/nced3 mutant Arabidopsis (with impaired AtNCED3 gene involved in ABA biosynthesis under water stress) driven by the AtNCED3 promoter restores its ability to accumulate ABA during drought stress, and reverts its hypersensitivity to nonionic osmotic stress and soil drought. These results indicate that the expression of AhNCED1 gene plays an important role in the regulation of ABA level during water stress, and that water-stress tolerance of Arabidopsis plants can be improved by ectopic expression of the AhNCED1 gene causing accumulation of endogenous ABA.

Abscisic Acid↗
PubMed2003

Structure and organization of the genomic clone of a major peanut allergen gene, Ara h 1.

Peanut is one of the most allergenic foods. It contains multiple seed storage proteins identified as allergens, which are responsible for triggering IgE-mediated allergic reactions. Ara h 1 is a major peanut allergen recognized by over 90% of peanut sensitive population. The objectives of this study were to isolate, sequence, and determine the structure and organization of at least one genomic clone encoding Ara h 1. Two 100 bp oligonucleotides were synthesized and used as probes to screen a peanut genomic library constructed in a Lambda FIX II vector. After three rounds of screening, four putative positive clones were selected and their DNA digested with SacI. A unique 12-13 kb insert fragment was released, confirmed positive by Southern hybridization, subcloned into a pBluescript vector, and sequenced. Sequence analysis revealed a full-length Ara h 1 gene of 4447 bp with four exons of 721, 176, 81 and 903 bp and three introns of 71, 249 and 74 bp. The deduced amino acid encodes a protein of 626 residues that is identical to the Ara h 1 cDNA clone P41b. Several well characterized elements for promoter strength were found in the promoter region of Ara h 1 and include two TATA-boxes (TATATAAATA and TTATATATAT) at positions -89 and -348, respectively; a CAAT-box (CAAT) at position -133, a GC-box (CGGGACCGGGCCGG GCCTTCGGGCCGGGCCGGGT) at position -475, two G-boxes (TAACACGTACAC and ATGGACGTGAAA) at positions -264 and -1808, respectively; two RY elements (CATGCAC and CATGCAT) at positions -235 and -278, respectively; and other cis-element sequences. In the 3' UTR, a poly-A signal (AATAAA) was found at +2350, two additional stop codons (TAA) at +2303 and +2306, and TTTG/CTA/G motifs. Three introns and a potentially strong promoter could explain the high expression of the Ara h 1 gene. Amino acid sequence comparisons revealed high sequence similarity with other plant vicilins, member of the cupin superfamily.

Allergens↗
PubMed2005

Expression in Escherichia coli and disulfide bridge mapping of PSC33, an allergenic 2S albumin from peanut.

In this work, we describe the expression, purification, and disulfide mapping of the named 'peanut seed cDNA 33' (PSC33) peanut allergen. A variant of PSC33 (with N(63), E(64), Q(69) instead of D(63), Q(64), E(69)) has been identified in peanut by proteomic analysis of a highly IgE immunoreactive purification fraction. It is 92% homologous to Ara h 6. We raised monoclonal antibodies against PSC33 and amplified it by PCR from peanut leaf genomic DNA. PSC33 was intron-less and the two NEQ and DQE variants of PSC33 were equally amplified. Since expression of the natural PSC33 (DQE) gene was very low in Escherichia coli even with supplementation of rare codon tRNAs, a synthetic gene optimized for expression in E. coli of PSC33 (DQE) was introduced into a pET9-c vector. A high production of protein occurred in the inclusion bodies that was submitted to refolding using an additive-introduced stepwise dialysis protocol which consists in the gradual removal of the denaturing agent guanidine-HCl with controlled introduction of oxidized and reduced glutathione and l-arginine as a chemical chaperone. After reverse phase HPLC purification, 1mg of pure refolded protein (as assayed by MALDI-TOF mass spectrometry, mouse IgG immunoreactivity and circular dichroism) were obtained with every 100ml of bacterial culture. Trypsin and CNBr hydrolysis of the protein combined with MALDI-TOF mass spectrometry allowed us to assign disulfide bridges and show that the native and refolded proteins were identical. The four disulfides of canonical 2S albumins were conserved and the two supplementary cysteines of PSC33 were paired together.

2S Albumins, Plant↗
PubMed2005

Peanut nodulation kinetics in response to low pH.

In this work, the peanut nodulation kinetics by acid-sensitive and tolerant isolates under acid stress condition was analyzed. The results demonstrated that the acid pH produced a decrease in the number of nodules formed only when peanut plants were inoculated with acid-sensitive isolates but increased steadily by the addition of 10 mM Ca2+, reaching higher values than those obtained at pH 7.0. On the contrary, the peanut nodulation by acid-tolerant isolates was not affected by this stressing condition. These data suggest that acid-tolerant isolates could be used as a potential source of strains for preparing highly effective inoculants for peanut plants growing in acid soils.

Arachis↗
PubMed2004

Systemic and oral immunogenicity of hemagglutinin protein of rinderpest virus expressed by transgenic peanut plants in a mouse model.

Rinderpest causes a devastating disease, often fatal, in wild and domestic ruminants. It has been eradicated successfully using a live, attenuated vaccine from most part of the world leaving a few foci of disease in parts of Africa, the Middle East, and South Asia. We have developed transgenic peanut (Arachis hypogaea L.) plants expressing hemagglutinin (H) protein of rinderpest virus (RPV), which is antigenically authentic. In this work, we have evaluated the immunogenicity of peanut-expressed H protein using mouse model, administered parenterally as well as orally. Intraperitoneal immunization of mice with the transgenic peanut extract elicited antibody response specific to H. These antibodies neutralized virus infectivity in vitro. Oral immunization of mice with transgenic peanut induced H-specific serum IgG and IgA antibodies. The systemic and oral immunogenicity of plant-derived H in absence of any adjuvant indicates the potential of edible vaccine for rinderpest.

Administration, Oral↗
PubMed1976

Immunochemical studies on the specificity of the peanut (Arachis hypogaea) agglutinin.

The specificity of purified, peanut agglutinin has been studied immunochemically by quantitative precipitin and inhibition assays. The lectin showed substantial differences in precipitating with blood-group substances of the same specificity. Of the B substances tested, horse 4 25% completely precipitated the lectin, Beach phenol insoluble failed to interact, and PM phenol insoluble gave an intermediate reaction. The lectin did not precipitate with A1 substances, with hog gastric mucin A + H substance, or with A2 substance WG phenol insoluble. Another A2 substance, cyst 14 phenol insoluble, precipitated approximately 2/3 of the lectin. Of the H substances, Tighe phenol insoluble was inactive, JS phenol insoluble precipitated poorly, and morgan standard H precipitated about 80% of the lectin. However, first stage of Smith degradation, as well as Pl fractions obtained by mild acid hydrolysis of blood-group substances, gave products which precipitated strongly. The lectin was also completely precipitated by all precursor blood-group substances, as well as by cows 21 and 26, all having strong I-Ma, I-Ort, I-Step, and I-Da activities. Cow 18, which does not possess significant blood-group I activity, precipitated very slightly. Fractions of blood-group substances N-1 (Lea) and Tij (B) obtained by precipitation from 90 percent phenol at higher concentrations of ethanol interacted better with peanut agglutinin. These differences in activity are ascribable to a heterogeneity resulting from incomplete biosynthesis of carbohydrate side-chains of blood-group substances, particularly resulting in variations in the numbers of DGalbeta1 leads to 3DGalNAc or DGalbeta1 leads to 4DGlcNAc determinants. The agglutinin reacted with the hydatid cyst P1 glycoprotein, as well as with the previously studied antifreeze and sialic acid-free alpha1 acid glycoproteins, but not with pneumococcus type XIV polysaccharide. Inhibition of precipitation showed the lectin to be most specific for the disaccharide DGalbeta1 leads to 3DGalNAc, which is 14, 55, and 90 times as active as DGalbeta1 leads to 4DGlcNAc, DGal, and DGalbeta1 leads to 3DGlcNAc, respectively. DGalbeta1 leads to 3N-acetyl-D-galactosaminitol has approximately 1/25th the activity of DGalbeta1 leads to 3DGalNAc. Substitutions of DGlcNAc or LFuc on the DGal of active inhibitors completely blocked the activity, in line with the assumption that the combining site of the peanut lectin is a partial cavity. The oligosaccharides DGalbeta1 leads to 4DGlcNAcbeta1 leads to 6-hexane-1,2,4,5,6-pentol(s) and DGalbeta1 leads to 3[DGalbeta1 leads to 4DGlcNAcbeta1 leads to 6]N-acetyl-D-galactosaminitol showed the same inhibitory activity as DGalbeta1 leads to 4DGlcNAc, suggesting that the combining site of the peanut agglutinin may not be complementary to more than a disaccharide...

Animals↗
PubMed1995

Comparison of commercial peanut skin test extracts.

BACKGROUND: Skin prick testing is a major tool for diagnosing food allergy. Food allergen extracts have not been standardized; this may lead to great variability in the predictive accuracy of skin prick tests. METHODS: Six commercial peanut skin test extracts were compared in vitro with RAST inhibition assays, ELISA, and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by immunoblotting with sera from peanut-allergic adults and in vivo by skin prick testing. RESULTS: ELISA showed that the content of peanut allergens Ara h I and Ara h II in the extracts ranged from 0.0015 to 0.0236 and 0.0001 to 0.0164 mg Eq/ml, respectively. RAST inhibition studies showed that the extracts produced curves of similar slope, suggesting conservation of allergenic epitopes. SDS-PAGE revealed differences in protein profiles because roasted extracts generally possessed the same number and proportion of major protein bands but raw extracts varied more in both respects. SDS-PAGE and immunoblotting showed that two of the extracts contained major IgE-binding protein bands that did not appear in the others. One roasted extract gave little protein banding and consequently little IgE binding. CONCLUSIONS: Skin testing results showed no differences in the ability of the extracts to provoke a positive skin test response in peanut-sensitive subjects.

Arachis↗
PubMed2001

Detection of moulds producing aflatoxins in maize and peanuts by an immunoassay.

An enzyme-linked immunosorbent assay (ELISA) was developed to detect moulds producing aflatoxins in maize and peanuts by an antibody produced to extracellular antigen from Aspergillus parasiticus. This antibody recognized species with phenotypic similarities to A. parasiticus, A. flavus and the domesticated species A. sojae and A. oryzae. For maize samples that were naturally contaminated with aflatoxins, low and high levels of aflatoxin corresponded with low and high ELISA readings for mould antigens, respectively. Maize and peanuts inoculated with 10(2) spores ml(-1) of A. parasiticus and incubated at 15 degrees C for 18 days or 21 degrees C for 7 days were analyzed for mould antigens and aflatoxin levels. At 15 degrees C, mould antigens were detected by day 4 in maize when 0.16 ng g(-1) of aflatoxin was detected by ELISA but not by thin layer chromatography (TLC). Antigens were detected in peanuts by day 4 before aflatoxin was found. Likewise, at 21 degrees C, antigens were detected by day 4 in maize when less than 1 ng g(-1) of aflatoxin was detected by ELISA but not by TLC, but by day 2 in peanuts when no aflatoxin was detected. A. parasiticus could be detected before it could produce aflatoxins. Therefore, this ELISA shows potential as an early detection method for moulds that produce aflatoxins.

Aflatoxins↗
PubMed2000

An efficient method for the production of transgenic plants of peanut (Arachis hypogaea L.) through Agrobacterium tumefaciens-mediated genetic transformation.

Cotyledon explants from mature peanut seeds (Arachis hypogaea L.) were optimized to obtain adventitious shoot buds with high frequencies (>90%). Efficient transformation of these cotyledons by using Agrobacterium tumefaciens strain C58 carrying neomycin phosphotransferase II (nptII) and ß-glucuronidase (GUS; uidA), or coat protein gene of the Indian peanut clump virus (IPCVcp) and nptII on binary vectors (pBI121; pROKII:IPCVcp) led to the production of a large percentage (55%) of transgenic plants. Transformed individuals were obtained through selection on medium containing 125 mg l(-1) kanamycin. A large number of independently transformed plants (over 75) were successfully transplanted to the glasshouse. Integration of the transgenes and stable genetic transformants in the progeny were assessed by PCR amplification of 700-bp fragment of nptII and 585-bp of IPCVcp genes, and Southern blot hybridizations in the T1 generation of transgenic plants. Analysis of 35 transgenic plants of T1 generation from the progeny of a single transformation event suggested the segregation of a single copy insert in a 3:1 Mendelian ratio. On an average, 120-150 days were required between the initiation of explant transformation and transfer of rooted plants to the greenhouse. The cotyledon regeneration system proved to be an excellent vehicle for the production of a large number of independently transformed peanut plants. Shoot formation was rapid and prolific, and a large proportion of these shoots developed into fertile plants. The method reported here provides new opportunities for the crop improvement of peanut via genetic transformation.

Journal Article↗
PubMed1994

Definitive diagnosis and location of peanuts in the airways using magnetic resonance imaging techniques.

A 14-month-old boy suspected to have aspirated peanut fragments into the airways was transferred to our hospital. His chest radiographs revealed Holzknecht's sign, which indicated left mainstem bronchial obstruction. Magnetic resonance imaging with T1-weighted images clearly showed a high-intensity signal of peanut fragments in the left mainstem bronchus. Removal was performed by bronchoscopy in a shorter time under general anesthesia. Magnetic resonance imaging with T1-weighted images (T1WI) is useful for definitive diagnosis and location of peanut fragments in the lower airway because the peanut material appears as a high-intensity signal surrounded by the low-intensity lung tissue. Various slice orientations of T1WI provide accurate information concerning anatomic location of such fragments, thus facilitating removal by bronchoscopy.

Arachis↗