Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Splicing”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 433 records · Page 24Linked to original sources
PubMed1989

Splicing of the U6 RNA precursor is impaired in fission yeast pre-mRNA splicing mutants.

U6 RNA is a member of a class of small abundant stable nuclear RNAs that are essential for splicing. In all species examined so far, the U6 RNA is a RNA polymerase III transcript. The U6 gene of the fission yeast Schizosaccharomyces pombe is unusual in that it is interrupted by an intron whose structure is similar to those found in pre-mRNAs. As part of our previous analysis of three S. pombe temperature sensitive pre-mRNA splicing mutants we examined their spliceosomal snRNA content. In contrast to the other snRNAs, the amount of U6 RNA is reduced at the restrictive temperature in all three of the mutants compared to the wild type. To investigate the cause of this reduction we have analyzed the efficiency of splicing of the U6 RNA precursor (U6 pre-RNA) in the pre-mRNA splicing mutants. At the restrictive temperature the ratio of unspliced U6 precursor to mature RNA is elevated in the mutants compared to the wild type grown under identical conditions, indicating a defect in U6 pre-RNA splicing. In this regard, the U6 RNA precursor behaves similarly to pre-mRNAs. Unspliced U6 pre-RNA was also detected in wild type cells under certain growth conditions.

Base Sequence↗
PubMed1989

A secondary structure at the 3' splice site affects the in vitro splicing reaction of mouse immunoglobulin mu chain pre-mRNAs.

The expression of the IgM (immunoglobulin mu) heavy chain gene is known to be regulated at the post-transcriptional level. The two isoforms, the membrane-bound and secreted forms, are generated from the same gene by alternative processing at the 3' end of the primary transcript. The processing reactions involved are polyadenylation at the upstream poly(A) site (for the secreted form) and polyadenylation at the downstream poly(A) site coupled with splicing between exon C4 and exon M1 (for the membrane-bound form). The regulatory mechanism underlying these differential processing reactions is still not well understood. We investigated the splicing reaction between exon C4 and exon M1 in a HeLa nuclear extract using model transcripts containing the 5' and 3' splice sites of the C4-M1 intron. We found that the 3' splice site of the C4-M1 intron is sequestered in a stem-loop structure, which inhibits the splicing reaction in vitro. The inhibition by the stem-loop structure was also observed with a mouse lymphoma extract.

Animals↗
PubMed1999

A conditional U5 snRNA mutation affecting pre-mRNA splicing and nuclear pre-mRNA retention identifies SSD1/SRK1 as a general splicing mutant suppressor.

A combination of point mutations disrupting both stem 1 and stem 2 of U5 snRNA (U5AI) was found to confer a thermosensitive phenotype in vivo. In a strain expressing U5AI, pre-mRNA splicing was blocked before the first step through an inability of the mutant U5 snRNA to efficiently associate with the U4/U6 di-snRNP. Formation of early splicing complexes was not affected in extracts prepared from U5 snRNA mutant cells, while the capacity of these extracts to splice a pre-mRNA in vitro was greatly diminished. In addition, significant levels of a translation product derived from intron containing pre-mRNAs could be detected in vivo. The SSD1/SRK1 gene was identified as a multi-copy suppressor of the U5AI snRNA mutant. Single copy expression of SSD1/SRK1 was sufficient to suppress the thermosensitive phenotype, and high copy expression partially suppressed the splicing and U4/U6.U5 tri-snRNP assembly pheno-types. SSD1/SRK1 also suppressed thermosensitive mutations in the Prp18p and U1-70K proteins, while inhibiting growth of the cold sensitive U1-4U snRNA mutant at 30 degrees C. Thus we have identified SSD1/SRK1 as a general suppressor of splicing mutants.

Base Sequence↗
PubMed2000

Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast.

Correct identification of all introns is necessary to discern the protein-coding potential of a eukaryotic genome. The existence of most of the spliceosomal introns predicted in the genome of Saccharomyces cerevisiae remains unsupported by molecular evidence. We tested the intron predictions for 87 introns predicted to be present in non-ribosomal protein genes, more than a third of all known or suspected introns in the yeast genome. Evidence supporting 61 of these predictions was obtained, 20 predicted intron sequences were not spliced and six predictions identified an intron-containing region but failed to specify the correct splice sites, yielding a successful prediction rate of <80%. Alternative splicing has not been previously described for this organism, and we identified two genes (YKL186C/ MTR2 and YML034W) which encode alternatively spliced mRNAs; YKL186C/ MTR2 produces at least five different spliced mRNAs. One gene (YGR225W/ SPO70 ) has an intron whose removal is activated during meiosis under control of the MER1 gene. We found eight new introns, suggesting that numerous introns still remain to be discovered. The results show that correct prediction of introns remains a significant barrier to understanding the structure, function and coding capacity of eukaryotic genomes, even in a supposedly simple system like yeast.

Alternative Splicing↗
PubMed2006

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing.

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.

Alternative Splicing↗
PubMed1992

Site-specific cross-linking of mammalian U5 snRNP to the 5' splice site before the first step of pre-mRNA splicing.

We have used a site-specific cross-linking strategy to identify RNA and protein factors that interact with the 5' splice site region during mammalian pre-mRNA splicing. Two different pre-mRNA substrates were synthesized with a single 32P-labeled 4-thiouridine residue 2 nucleotides upstream of the 5' splice site. Selective photoactivation of the 4-thiouridine residue after incubation of either substrate under splicing conditions in HeLa nuclear extract resulted in cross-links to the U5 snRNA and the U5 snRNP protein p220. These ATP-dependent interactions occur before the first step of splicing. The U5 snRNA cross-links map to a phylogenetically invariant 9-nucleotide loop sequence and do not require Watson-Crick complementarity to the 5' exon. Cross-links of this position in the pre-mRNA to U1, but not to U2, U4, or U6 snRNAs, were also observed. The kinetics of U1 and U5 cross-link formation are similar, both peaking well before reaction intermediates appear.

Base Sequence↗
PubMed2002

Splicing of the maize Sh1 first intron is essential for enhancement of gene expression, and a T-rich motif increases expression without affecting splicing.

Certain plant and animal introns increase expression of protein-coding sequences when placed in the 5' region of the transcription unit. The mechanisms of intron-mediated enhancement have not been defined, but are generally accepted to be post- or cotranscriptional in character. One of the most effective plant introns in stimulating gene expression is the 1,028-bp first intron of the Sh1 gene that encodes maize (Zea mays) sucrose synthase. To address the mechanisms of intron-mediated enhancement, we used reporter gene fusions to identify features of the Sh1 first intron required for enhancement in cultured maize cells. A 145-bp derivative conferred approximately the same 20- to 50-fold stimulation typical for the full-length intron in this transient expression system. A 35-bp motif contained within the intron is required for maximum levels of enhancement but not for efficient transcript splicing. The important feature of this redundant 35-bp motif is T-richness rather than the specific sequence. When transcript splicing was abolished by mutations at the intron borders, enhancement was reduced to about 2-fold. The requirement of splicing for enhancement was not because of upstream translation initiation codons contained in unspliced transcripts. On the basis of our current findings, we conclude that splicing of the Sh1 intron is integral to enhancement, and we hypothesize that transcript modifications triggered by the T-rich motif and splicing may link the mRNA with the trafficking system of the cell.

Alternative Splicing↗
PubMed1984

Splice junctions in adenovirus 2 early region 4 mRNAs: multiple splice sites produce 18 to 24 RNAs.

We localized the splice junctions in adenovirus 2 early region 4 (E4) mRNAs. Processing of the E4 precursor RNA positioned the donor splice site of the 5' leader sequence adjacent to acceptor sites near the 5' ends of five of the six open reading regions in the E4 transcription unit. Of particular interest among the E4 mRNAs is an extensively spliced class which includes multiple species with sizes ranging from 1.1 to 0.75 kilobases (kb). Purified 1.1- to 0.75-kb mRNAs specified at least 10 polypeptides in vitro. We detected eight acceptor and two donor splice sites utilized in the deletion of the intron from the 3' portion of these mRNAs. E4 RNAs were isolated from the cytoplasm of infected cells at 5, 9, 12, and 18 h after infection. The E4 mRNAs were present throughout infection, but different members of the 1.1- to 0.7-kb class were predominant at each time assayed. Alternate splicing of the 3.0-kb E4 precursor RNA can generate as many as 25 mRNAs that encode at least 16 polypeptides.

Adenoviruses, Human↗
PubMed1987

Noncoding region between the env and src genes of Rous sarcoma virus influences splicing efficiency at the src gene 3' splice site.

Viral RNA and proteins in chicken embryo fibroblasts infected with different cloned variants of the Prague strain Rous sarcoma virus (RSV) were analyzed. The ratio of immunoprecipitated pp60src to the gag gene product p27 in Prague A (PrA) and Prague B (PrB) RSV-infected cells was two to three times that in Prague C (PrC) RSV-infected cells. A significant increase in the steady-state ratio of spliced 2.7-kilobase src gene mRNA to unspliced 9.3-kilobase genome-size RNA was observed in PrA- and PrB- compared with PrC-infected cells, consistent with the differences in the ratios of the gag to src gene protein products. Similar results were obtained when hybrid-selected RNA, which had been labeled for 3 h with [3H]uridine, was analyzed on formaldehyde-agarose gels, suggesting that the observed differences were due to splicing rather than RNA stability. Recombinant plasmids from infectious molecular clones of PrA and PrC were constructed to localize the regions responsible for the effects on src gene splicing. The substitution in place of the corresponding PrA region of the 262-base-pair region between the env gene and the src gene coding sequences from the PrC clone into the infectious PrA plasmid conferred the low src splicing efficiency of the PrC strain. The nucleotide sequence of this region of the PrA plasmid was determined and compared with the sequence of the PrC strain. Only four nucleotide differences were found; two changes were within the intron sequence, and two were in the exon sequence. The possible role of these differences in determining the extent of viral RNA splicing is discussed.

Animals↗
PubMed1996

Characterization of the spliced pol transcript of feline foamy virus: the splice acceptor site of the pol transcript is located in gag of foamy viruses.

Foamy viruses, or spumaviruses, are distinct members of the Retroviridae. Here we have characterized the long terminal repeat of the feline, or cat, foamy virus by determining the locations of the transcriptional start site and the poly(A) addition site. The splice donor and splice acceptor sites of the subgenomic mRNA responsible for Pro-Pol protein expression were identified by nucleotide sequencing of the corresponding cDNAs. The leader exon of the feline foamy virus is 57 nucleotides long. The splice acceptor of the subgenomic pol mRNA was found to be located in gag. The location of the splice acceptor of the human foamy virus pol mRNA was confirmed to map in gag. The pol splice acceptor site in gag of the cat foamy virus is located further downstream than that of human foamy virus.

Animals↗
PubMed1992

Trypanosoma brucei spliced-leader RNA methylations are required for trans splicing in vivo.

The Trypanosoma brucei spliced leader (SL) RNA donates its 5' leader sequence to all nuclear pre-mRNAs via trans RNA splicing. The SL RNA is a small-nuclear U RNA-like molecule which is present in the cell as part of a small ribonucleoprotein particle. However, unlike the trimethylguanosine-capped small nuclear U RNAs, the SL RNA has a highly modified 5' terminus containing an m7G cap and methylations on the first four transcribed nucleotides. Here, we show that incubation of procyclic-form T. brucei in the presence of the S-adenosylmethionine analog, sinefungin, leads to a rapid inhibition of SL RNA methylation. A concomitant inhibition of trans splicing and an accumulation of high-molecular-weight tubulin transcripts were also observed. The effects of sinefungin on SL RNA methylation and on trans splicing were correlated by labeling of cells incubated in the presence of the antibiotic. The results indicate that 5' modifications of the SL RNA are necessary for it to participate in trans splicing. SL RNA modification is not required for assembly of the core SL ribonucleoprotein, as these Cs2SO4-resistant particles can be formed with either methylated or undermethylated SL RNA.

Adenosine↗
PubMed1987

Substrate recognition and identification of splice sites by the tRNA-splicing endonuclease and ligase from Saccharomyces cerevisiae.

We have examined the substrate requirements for efficient and accurate splicing of tRNA precursors in Saccharomyces cerevisiae. The effects of Schizosaccharomyces pombe tRNASer gene mutations on the two steps in splicing, intron excision and joining of tRNA halves, were determined independently by using partially purified splicing endonuclease and tRNA ligase from S. cerevisiae. Two mutations (G14 and A46) reduced the efficiency of excision and joining in parallel, whereas two others (U47:7 and C33) produced differential effects on these two steps; U47:7 affected primarily the excision reaction, and C33 had a greater impact on ligation. These data indicate that endonuclease and ligase recognize both common and unique features of their substrates. Another two mutations (Ai26 and A37:13) induced miscutting, although with converse effects on the two splice sites. Thus, the two cutting events appear to be independent. Finally, we suggest that splice sites may be determined largely through their position relative to sites within the tRNA-like domain of the precursors. Several of these important sites were identified, and others are proposed based on the data described here.

Base Sequence↗
PubMed1988

trans splicing in Leishmania enriettii and identification of ribonucleoprotein complexes containing the spliced leader and U2 equivalent RNAs.

The 5' ends of Leishmania mRNAs contain an identical 35-nucleotide sequence termed the spliced leader (SL) or 5' mini-exon. The SL sequence is at the 5' end of an 85-nucleotide primary transcript that contains a consensus eucaryotic 5' intron-exon splice junction immediately 3' to the SL. The SL is added to protein-coding genes immediately 3' to a consensus eucaryotic 3' intron-exon splice junction. Our previous work demonstrated possible intermediates in discontinuous mRNA processing that contain the 50 nucleotides of the SL primary transcript 3' to the SL, the SL intron sequence (SLIS). These RNAs have a 5' terminus at the splice junction of the SL and the SLIS. We examined a Leishmania nuclear extract for these RNAs in ribonucleoprotein (RNP) particles. Density centrifugation analysis showed that the SL RNA is predominantly in RNP complexes at 60S, while the SLIS-containing RNAs are in complexes at 40S. We also demonstrated that the SLIS can be released from polyadenylated RNA by incubation with a HeLa cell extract containing debranching enzymatic activity. These data suggested that Leishmania enriettii mRNAs are assembled by bimolecular or trans splicing as has been recently demonstrated for Trypanosoma brucei. Furthermore, we determined the partial sequence of the Leishmania U2 equivalent RNA and demonstrated that it cosediments with the SL RNA at 60S in a nuclear extract. These RNP particles may be analogous to so-called spliceosomes that have been demonstrated in other systems.

Animals↗
PubMed2004

Two intronic mutations cause 17-hydroxylase deficiency by disrupting splice acceptor sites: direct demonstration of aberrant splicing and absent enzyme activity by expression of the entire CYP17 gene in HEK-293 cells.

To date, only two among 46 mutations in the CYP17 gene cause 17-hydroxylase deficiency (17OHD) by disrupting mRNA splice donor sites. We studied two subjects with intronic CYP17 mutations: a compound heterozygote for Y329D plus an AG to CG substitution at the 3' end of intron 2, and a homozygote for a TTTT deletion near the 3' end of intron 3. We hypothesized that both mutations caused 17OHD by disrupting splice acceptor sites. To prove this mechanism, the entire CYP17 genes (wild type and both mutations) were amplified, subcloned into pcDNA3, and expressed in HEK-293 cells. The mRNA derived from the wild-type CYP17 gene was correctly spliced and translated into active enzyme, as shown by the correct sequence in the RT-PCR products and by the 17-hydroxylation of progesterone. In contrast, cells expressing the mutant genes had no 17-hydroxylase activity. The mRNA derived from the AG to CG mutation used the first AG in exon 3 as the splice acceptor site, shifting the reading frame and introducing a stop codon. RNA derived from the TTTT deletion skipped exon 4 entirely, deleting 29 amino acids in-frame. Our data show that these are the first two 17OHD cases resulting from mutations that alter splice acceptor sites. These studies also demonstrate the feasibility of expressing the entire CYP17 gene, with simultaneous protein and RNA analysis, as a general methodology for characterizing how intronic CYP17 mutations cause 17OHD.

Adult↗
PubMed2006

Distal regulation of alternative splicing by splicing enhancer in equine beta-casein intron 1.

The complexity of cotranscriptional splicing is reflected in the coordinated interplay between various cis-elements and transacting factors. In this report, we demonstrated that a cis-element in intron 1 of the equine beta-casein gene (intronic splicing enhancer 1, ISE1) increases the inclusion of all weak exons in its pre-mRNA. The ISE1 also functioned on a hybrid transcript, which was transcribed from the alpha-globin promoter, where it increased the inclusion of the human fibronectin EDA exon and the beta-casein exon 5. The region of ISE1 necessary for its function included the same sequence as is found in some exonic splicing enhancers. Since the ISE1 influenced the splicing of the entire transcript from intron 1, we propose a model for the cotranscriptional splicing of beta-casein mRNA, where the 5' end of the growing transcript remains associated with the C-terminal domain of RNA polymerase II. Thus, the ISE1 remains in close proximity to the mRNA exit groove throughout transcription and influences all weak exons as soon as they are copied.

Alternative Splicing↗
PubMed1990

Cell-type-specific splicing factors and the regulation of alternative RNA splicing.

A very wide variety of biological processes are regulated by alternative splicing. By this means, a gene can be transcribed in several different tissues but in each tissue the RNA transcript is spliced in a particular way to produce a different mRNA and hence a different protein. It is now clear that alternative splicing is regulated by factors which are expressed in a tissue-specific manner and which are necessary for the splicing events to occur. This review will discuss the evidence for the existence of these factors, their nature, and the mechanisms by which they regulate splicing by interacting with sequences in the RNA.

Animals↗
PubMed1990

Analysis of a splice acceptor site mutation which produces multiple splicing abnormalities in the human argininosuccinate synthetase locus.

The cloned argininosuccinate synthetase gene from a citrullinemia patient's fibroblast cell line revealed a single base substitution (G to C) within the splice acceptor site of the last intron. The mutation abolished normal RNA splicing, and, by cDNA analysis, three abnormal splicing pathways were demonstrated. The major pathway involved the activation of a cryptic acceptor site in the last exon that resulted in a deletion of seven nucleotides in the mature RNA. Another pathway involved a downstream cryptic acceptor site, that is 388 nucleotides downstream from the first cryptic site. Northern blot analysis showed that this second cryptic site is present on the minor 2.7-kilobase mRNA, but not on the major species of argininosuccinate synthetase mRNA, which is 1.7-kilobases in length. Using this aberrant cDNA as a probe, the cDNA of the 2.7-kilobase mRNA was isolated and studied. Sequence analysis suggests that this species of RNA is the one that bypasses the polyadenylation signal employed by the 1.7-kilobase RNA. Since both transcripts encounter the same translation termination codon, both RNAs should encode identical protein. Furthermore, a tract of 22 repeats of d(CA).(GT) is found at the 3' end of the gene and this repeat sequence is present on the 2.7-kilobase RNA. The third pathway of the abnormal splicing revealed a rare class of transcript that has the last intron retained in the mature RNA. This study shows that in human the intron inclusion can occur through a naturally occurring point mutation. All these abnormally spliced RNAs resulted in a protein reading frame shift.

Amino Acid Metabolism, Inborn Errors↗
PubMed1989

Mutation of 3' splice sites in two different class I genes results in different usage of cryptic splice sites.

To determine the pattern of alternative splicing at the 5' end of class I genes, the 3' splice sites bordering exon 2 of the H-2Dd and H-2Kd genes were mutated from AG to GG (H-2Dd) or CG (H-2Kd). The mutant genes were transfected into L cells, and RNA from clones expressing these Ag was used for analysis by RNase and S1 nuclease mapping techniques. The first intervening sequence of both class I genes contains several potential 3' splice acceptor sites. However, a clear preference for only one site was detected in each of the H-2Dd and H-2Kd mRNA. Examination of the endogenous H-Dd and H-2Kd class I transcripts in normal murine tissues and in tumors demonstrated that the alternatively spliced mRNAs were produced, but at a low frequency. Infection of transfected L cells or tumor lines with vesicular stomatitis virus altered the level of differentially spliced message in these cells.

Animals↗