Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “RNA, Complementary”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 433 records · Page 24Linked to original sources

Quantitative and qualitative differences in DNA complementary to avian myeloblastosis virus between normal and leukemic chicken cells.

Hybridization of avian myeloblastosis virus (AMV) RNA with DNA immobilized on filters or in liquid with a vast DNA excess was used to measure the viral specific DNA sequences in chicken cells. Newly synthesized viral DNA (v-DNA) appears within an hour after infection of chicken embryo fibroblasts (CEF) with avian oncornaviruses. A fraction of newly synthesized v-DNA becomes integrated into the cellular genome and the remainder gradually disappears. A covalent linkage between v-DNA and cellular DNA was demonstrated to exist in CEF and in leukemic myeloblasts by alkaline sucrose velocity sedimentation. Hybridization of AMV RNA in DNA excess has revealed that there are 2 clases of viral specific sequences within normal as well as in leukemic cells. The 2 types of sequences differ in their rate of hybridization. The amount of both types of DNA sequences is about 2 times higher in leukemic cells than in normal cells. Both the fast- and slowly reacting sequences in leukemic cells exhibit a higher Tm (2 degrees C) than the respective DNA sequences in normal cells. Furthermore, when nucleotide sequences in AMV RNA complementary to normal DNA are removed first by exhaustive hybridization with normal DNA, the residual RNA only hybridizes with leukemic DNA but not with normal DNA. These results suggest that leukemic cells contain viral specific DNA sequences which are absent in normal cells. Endogenous v-DNA has been shown to be integrated in cellular DNA region(s) with a reiteration frequency of approximately 1,200 copies per cell and each integration unit appears to have a size approximately equivalent to the 35S RNA subunit of the viral genome. Viral sequences acquired after infection appear to be integrated in the unique region of cell DNA, or in tandem with the endogenous viral sequences.

Animals↗

Mitochondrial plasmid DNAs of broad bean: nucleotide sequences, complex secondary structures, and transcription.

Three circular plasmid DNA molecules of 1704, 1695 and 1476 nucleotide pairs from broad bean mitochondria (mt-plasmids 1-3) have been sequenced. Within a highly homologous segment of mt-plasmid 1 and 2 are found a series of six directly repeated, inverted repeat sequences, separated by unique sequences. Mt-plasmid 3 contains a series of four inverted repeat sequences, unrelated to the inverted repeat sequences of mt-plasmids 1 and 2. Two RNA molecules of about 440 and 320 nucleotides that are complementary to mt-plasmid 2 were detected. Mapping of 5' and 3' termini of these complementary RNA molecules indicated that all transcription from mt-plasmid 2 occurs within a 441 nucleotide region of the molecule. Evidence for transcription of mt-plasmids 1 and 3 was not found.

Base Sequence↗

Transcription and accurate polyadenylation in vitro of RNA from the major late adenovirus 2 transcription unit.

Nucleoprotein complexes with in vitro transcription activity were isolated from HeLa cells late in lytic infection with Adenovirus type 2 (Ad2). Both polymerase II and polymerase III were active in these extracts, and greater than 85% of the labeled RNA was Ad2-specific. Electrophoretic analyses and Southern blot analyses demonstrated that RNA complementary to the entire 30 kb late transcription unit including RNA near the presumed termination site was synthesized. The addition of DRB (5,6,dichloro-1-beta-D-ribofuranosyl-benzimidazole) in vivo prior to the isolation of the complexes resulted in accumulation of polymerase II at the promoter proximal sites, but nascent chains started in vivo in DRB were successfully elongated in vitro. Approximately 10% of the RNA labeled in vitro contained poly(A), and the length of poly(A) was very similar to that of nuclear RNA isolated from Ad2-infected cells. The in vitro sites of poly(A) addition were specific--labeled poly(A)-terminated RNA molecules ended at a point on the genome coincident with previously mapped poly(A) sites of mRNAs produced in vivo. In addition, the polyadenylation enzyme (or enzymes) cosediment with the nucleoprotein complexes during sucrose gradient centrifugation since gradient purified complexes synthesize poly(A) containing RNA in vitro in the absence of any added nuclear extract.

Adenoviruses, Human↗

Electrophoretic and hydrodynamic properties of duplex ribonucleic acid molecules transcribed in vitro: evidence that A-tracts do not generate curvature in RNA.

We have developed a T7 RNA polymerase based transcription system for the production of fully complementary RNA molecules (i.e., molecules capable of forming blunt-ended duplex species) as the direct products of transcription, thus rendering unnecessary the enzymatic removal of single-stranded ends. A combined gel electrophoretic and hydrodynamic analysis of a 180 bp double-stranded (ds) RNA molecule containing four A5-tracts in approximate phase coherence with the helix repeat provides no indication that the helix axis is curved, in sharp contrast to DNA molecules containing phased A-tracts. The electrophoretic behavior of dsRNA molecules reveals that their mobilities in nondenaturing acrylamide gels are approximately 10-20% lower than the corresponding mobilities of duplex DNA, in accord with earlier observations in the literature. Furthermore, the relative mobilities are only slightly modulated by gel concentration, the concentration of monovalent salt, or the presence of spermidine and/or Mg2+. The reduced mobilities are not caused by increased contour length, since direct hydrodynamic measurements using transient electric birefringence indicate that the average helix rise, h, of the dsRNA molecules examined in the current study is 2.8 +/- 0.1 A/bp. The reduced electrophoretic mobilities, extrapolated to zero acrylamide concentration, are consistent with the lower residual charge predicted for dsRNA by counterion condensation theory. Finally, birefringence measurements indicate that dsRNA is only marginally stiffer than DNA, with a persistence length of ca. 500-700 A.

Base Sequence↗

Chlorambucil-taurocholate is transported by bile acid carriers expressed in human hepatocellular carcinomas.

BACKGROUND & AIMS: Chemotherapy of hepatocellular carcinomas is hampered by the insufficient accumulation of cytostatic drugs within the tumor cells. The aim of this study was to evaluate the feasibility of therapeutic strategies using antineoplastic agents coupled to bile acids. METHODS: Expression of the Na(+)-taurocholate-cotransporting polypeptide (NTCP) was analyzed in six hepatocellular carcinomas and in nonmalignant liver tissue. Uptake of the cytostatic drug [3H]-chlorambucil-taurocholate (S2676) was measured in Xenopus laevis oocytes injected with total messenger RNA (mRNA) from the carcinomas or peritumor tissue or with complementary RNA encoding the NTCP or the organic anion-transporting polypeptide (OATP) of human liver. RESULTS: Expression of hepatocellular carcinoma mRNA in oocytes resulted in mainly Na(+)-dependent uptake of chlorambucil-taurocholate. The level of NTCP mRNA in carcinomas amounted to 56% +/- 27% compared with peritumor tissue. Immunofluorescence studies confirmed the expression of NTCP on the surface of hepatocellular carcinoma cells. OATP expression, determined by immunoblotting, was similar in hepatocellular carcinomas and surrounding liver tissue (n = 3). NTCP mediated Na(+)-dependent uptake of chlorambucil-taurocholate (Michaelis constant, 11 mumol/L), whereas OATP mediated Na(+)-independent uptake. CONCLUSIONS: Hepatocellular carcinomas express the Na(+)-dependent bile acid transporter NTCP. Because NTCP mediates high-affinity uptake of chlorambucil-taurocholate, targeting of cytostatic bile acids to hepatocellular carcinomas could become a feasible therapeutic strategy.

Animals↗

Organization of ribosomal genes in Paramecium tetraurelia.

The macronuclear ribosomal DNA (rDNA) of the ciliated protozoan Paramecium tetraurelia (stock 51) was analyzed by digestion with restriction endonucleases. The fragments which contained ribosomal RNA (rRNA) coding sequences and spacer sequences were identified. The spacer sequences exhibited some heterogeneity in size. The genes coding for 5.8S RNA, but not for 5S RNA, are linked to the 17S and 25S rRNA genes. Complementary RNA, synthesized from rDNA of stock 51, was hybridized with restriction digests of whole cell DNA from six other allopatric stocks of this species. The restriction patterns of the rDNA from these seven stocks were, in general, very similar, and the sizes of the coding sequences were identical in all seven stocks. Only the restriction pattern of rDNA from stock 127 differed significantly from that of stock 51. The rDNA from stock 127 was isolated and characterized, and with the exception of the restriction pattern of its spacer, it resembled the rDNA from stock 51. It is concluded that the rDNA repeat in Paramecium, including the spacer, has, in general, been conserved during the course of evolution. It is suggested that in some species, even in the absence of genetic exchange among geographically separated populations, selection pressure may act to conserve spacers of tandemly repeated rDNA. The conservation may be related to the number of rDNA copies in the germinal nucleus.

Animals↗

Sequence-dependent structural variations of hammerhead RNA enzymes.

The discovery of in vivo catalytic activity for the hammerhead RNA self-cleaving domain has led to the development of a new class of sequence-specific RNA endonucleases. Two such ribozymes have been synthesized using in vitro transcription with T7 polymerase and their structures have been studied by optical spectroscopy, nuclear magnetic resonance and nondenaturing gel electrophoresis. These data show the presence of a stable hairpin consisting of a double helical stem and a tetranucleotide loop in both RNA enzymes. Additional structure, with different stabilities, is also observed in both RNA enzymes. The half-lives for cleavage of the complementary RNA substrates by these two RNA enzymes have been previously shown to differ by a factor of 50. The data presented here suggest that this rate difference may be a result of the formation of catalytically inactive conformations in the RNA enzyme which interfere with formation of the enzyme-substrate complex.

Base Sequence↗

Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

DNA-Directed RNA Polymerases↗

Reduction of the amount of periplasmic hydrogenase in Desulfovibrio vulgaris (Hildenborough) with antisense RNA: direct evidence for an important role of this hydrogenase in lactate metabolism.

To establish the function of the periplasmic Fe-only hydrogenase in the anaerobic sulfate reducer Desulfovibrio vulgaris (Hildenborough), derivatives with a reduced content of this enzyme were constructed by introduction of a plasmid that directs the synthesis of antisense RNA complementary to hydrogenase mRNA. It was demonstrated that the antisense RNA technique allowed specific suppression of the synthesis of this hydrogenase in D. vulgaris by decreasing the amount of hydrogenase mRNA but did not result in the complete elimination of the enzyme, as is usual with most conventional mutagenesis techniques. The hydrogenase content in these antisense RNA-producing D. vulgaris clones was two- to threefold lower than in the parental strain when the strains were grown in batch cultures with lactate as a substrate and sulfate as a terminal electron acceptor. Under these conditions, several differences in growth parameters were measured between the hydrogenase-suppressed clones and wild-type D. vulgaris: growth rates of the clones decreased two- to threefold, and at excess lactate, growth yields were reduced by 20%. Furthermore, the amount of hydrogen measured in the culture headspaces was reduced three- to fivefold for the clones. These observations indicate that this hydrogenase has an important function during growth on lactate and is involved in hydrogen production from protons and electrons originating from at least one of the two oxidation reactions in the conversion of lactate to acetate. The implications for the energy metabolism of D. vulgaris are discussed.

Acetates↗

De novo initiation of RNA synthesis by the RNA-dependent RNA polymerase (NS5B) of hepatitis C virus.

Hepatitis C virus (HCV) NS5B protein possesses an RNA-dependent RNA polymerase (RdRp) activity, a major function responsible for replication of the viral RNA genome. To further characterize the RdRp activity, NS5B proteins were expressed from recombinant baculoviruses, purified to near homogeneity, and examined for their ability to synthesize RNA in vitro. As a result, a highly active NS5B RdRp (1b-42), which contains an 18-amino acid C-terminal truncation resulting from a newly created stop codon, was identified among a number of independent isolates. The RdRp activity of the truncated NS5B is comparable to the activity of the full-length protein and is 20 times higher in the presence of Mn(2+) than in the presence of Mg(2+). When a 384-nucleotide RNA was used as the template, two major RNA products were synthesized by 1b-42. One is a complementary RNA identical in size to the input RNA template (monomer), while the other is a hairpin dimer RNA synthesized by a "copy-back" mechanism. Substantial evidence derived from several experiments demonstrated that the RNA monomer was synthesized through de novo initiation by NS5B rather than by a terminal transferase activity. Synthesis of the RNA monomer requires all four ribonucleotides. The RNA monomer product was verified to be the result of de novo RNA synthesis, as two expected RNA products were generated from monomer RNA by RNase H digestion. In addition, modification of the RNA template by the addition of the chain terminator cordycepin at the 3' end did not affect synthesis of the RNA monomer but eliminated synthesis of the self-priming hairpin dimer RNA. Moreover, synthesis of RNA on poly(C) and poly(U) homopolymer templates by 1b-42 NS5B did not require the oligonucleotide primer at high concentrations (>/=50 microM) of GTP and ATP, further supporting a de novo initiation mechanism. These findings suggest that HCV NS5B is able to initiate RNA synthesis de novo.

Animals↗

An internal rearrangement in an Arabidopsis inverted repeat locus impairs DNA methylation triggered by the locus.

In plants, transcribed inverted repeats trigger RNA interference (RNAi) and DNA methylation of identical sequences. RNAi is caused by processing of the double-stranded RNA (dsRNA) transcript into small RNAs that promote degradation of complementary RNA sequences. However, the signals for DNA methylation remain to be fully elucidated. The Arabidopsis tryptophan biosynthetic PAI genes provide an endogenous inverted repeat that triggers DNA methylation of PAI-identical sequences. In the Wassilewskija strain, two PAI genes are arranged as a tail-to-tail inverted repeat and transcribed from an unmethylated upstream promoter. This locus directs its own methylation, as well as methylation of two unlinked singlet PAI genes. Previously, we showed that the locus is likely to make an RNA signal for methylation because suppressed transcription of the inverted repeat leads to reduced PAI methylation. Here we characterize a central rearrangement in the inverted repeat that also confers reduced PAI methylation. The rearrangement creates a premature polyadenylation signal and suppresses readthrough transcription into palindromic PAI sequences. Thus, a likely explanation for the methylation defect of the mutant locus is a failure to produce readthrough dsRNA methylation triggers.

Arabidopsis↗

Expression of luteinizing hormone and chorionic gonadotropin receptor messenger ribonucleic acid in human corpora lutea during menstrual cycle and pregnancy.

In the present study, we examined the expression of LH and CG receptor messenger RNA (mRNA) in human corpora lutea (CL) during the menstrual cycle and pregnancy. Poly(A)-enriched RNA was extracted from CL and analyzed by Northern and slot blots, using a radiolabeled complementary RNA probe derived from the human LH receptor complementary DNA. Northern blot analysis indicated the presence of multiple LH receptor mRNA transcripts with molecular sizes of 8.0, 7.0 and 4.5 kilobases in human CL during the menstrual cycle. The predominant transcript was 4.5 kilobases in size. However, no hybridization signals were observed in nongonadal tissues (heart, liver, and kidney). Densitometric analyses revealed that the levels of LH receptor mRNA increased from early luteal phase to midluteal phase and subsequently decreased during late luteal phase. After the onset of menstruation, the LH receptor mRNA level was undetectable in the regressing CL. Moreover, radioligand receptor assay (RRA) showed a close parallelism between LH receptor mRNA levels and LH receptor content in CL throughout the menstrual cycle. LH receptor mRNA expression was also found in CL during early pregnancy. The level of LH receptor mRNA was relatively high in early pregnancy CL, whereas LH receptor content was low. Using in situ hybridization, LH receptor mRNAs were uniformly expressed in both large and small luteal cells during early and midluteal phase and early pregnancy, but not in regressing CL. In conclusion, these data demonstrate that the regulation of LH receptor content in human CL during luteal phase is associated with similar changes in the receptor message levels, suggesting the physiological roles for LH receptor mRNA during the menstrual cycle in the human. In addition, the expression of LH receptor mRNA was demonstrated in human CL during early pregnancy.

Adult↗

Relationship between nuclear and polysomal RNA populations of Achlya: a simple eucaryotic system.

The relationship between hnRNA and mRNA in the water mold Achlya has been investigated in several ways. Analysis of the nuclear and polysomal poly(A) RNA by sucrose density gradient centrifugation under denaturing and nondenaturing conditions showed that the populations have indistinguishable size distributions. The number average sizes were calculated to be 1150 nucleotides for nuclear and 1140 nucleotides for polysomal poly(A) RNA. Selective inhibition of rRNA synthesis was used to investigate the size distribution of hnRNA without regard to poly(A) content. Very little hnRNA was observed which sedimented more rapidly than polysomal poly(A) RNA. Hybridization experiments in which an excess of nuclear DNA was reacted with 3H-poly(A) hnRNA or 3H-poly(A) mRNA showed that both populations contain repetitive transcripts (9-10%) as well as single-copy transcripts (44%). Analysis of hybrids on hydroxyapatite in the presence of 8 M urea demonstrated that the poly(A) RNA complementary to repetitive DNA sequence components represented a population of molecules distinct from the population complementary to single-copy DNA. The complexity of whole cell, nuclear and polysomal RNA was determined by saturation hypbridization to single-copy 3H-DNA. All three populations were complementary to essentially the same fraction of the DNA. Terminal hybridization values were 3.84, 3.76 and 3.76% for whole cell, nuclear and polysomal RNA, respectively, representing a complexity of 2.1 X 10(6) nucleotides. These data suggest that the composition of the hnRNA and mRNA populations are essentially identical. No evidence for selective turnover of any sequence component or size class within the nucleus was observed.

Base Sequence↗

Transcriptional complexity of vaccinia virus in vivo and in vitro.

The transcriptional complexity of vaccinia virus both in vivo and in vitro has been measured by using DNA:RNA hybridization with RNA in excess. In vivo, "early" or prereplicative RNA was found to saturate at 25% or one-half of the viral genome. "Late" or postreplicative RNA from infected HeLa cells saturated at 52% or essentially the entire genome. This well-regulated transcriptional pattern of the virus in vivo was not maintained in vitro. In a number of experiments a range of saturation values from 40 to 50% was obtained for in vitro synthesized RNA. The complexity of polyadenylated and non-polyadenylated RNA, as well as total purified 8 to 12S RNA released from the virus, was indistinguishable from purified high-molecular-weight virion-associated RNA with a sedimentation value of greater than 20S and equivalent to total in vitro synthesized RNA. No additional hybrid formation was observed in experiments in which total in vitro RNA and late in vivo RNA from infected HeLa cells were combined, suggesting that the virus does not transcribe in vitro DNA sequences that are not also transcribed during productive infection. Approximately 15% complementary RNA was detected when radiolabeled total in vitro RNA was allowed to reanneal with late in vivo RNA, while as much as 8% of the in vitro synthesized RNA was found to be complementary.

Cell-Free System↗

Sequence organization and developmental expression of an interspersed, repetitive element and associated single-copy DNA sequences in Dictyostelium discoideum.

We have examined the genomic organization and developmental expression pattern of a short, transcribed, interspersed repeat element and its associated single-copy sequences. We have previously shown that 1% of the polyadenylated [poly(A)+] RNA from vegetative cells contains sequences that hybridize to this repeat. The complementary RNA is heterogeneous in size, and 90% of its mass hybridizes to single-copy DNA. In this study, we examined a series of genomic DNAs and cDNAs derived from poly(A)+ RNAs which are complementary to the repeat. Comparisons of sequence data from various genomic and cDNA clones indicated that (AAC)n X (GTT)n is the common sequence element. The tandem repeat occurred in approximately 100 short segments (approximately 35 to 150 base pairs) per haploid genome interspersed with single-copy DNA. Probes from regions adjacent to this element hybridized to unique restriction fragments on DNA blots and unique poly(A)+ RNA species on RNA blots. The (AAC)n X (GTT)n sequence was asymmetrically transcribed with only (AAC)n sequences represented in RNA. The repeat was localized within the transcribed regions of several genes and 70 base pairs 5' to the transcription initiation site of another gene. Individual (AAC)n-containing RNAs exhibited a developmental pattern of expression suggestive of the coordinate expression of many AAC gene family members.

Base Sequence↗

Direct observation of base-pair stepping by RNA polymerase.

During transcription, RNA polymerase (RNAP) moves processively along a DNA template, creating a complementary RNA. Here we present the development of an ultra-stable optical trapping system with ångström-level resolution, which we used to monitor transcriptional elongation by single molecules of Escherichia coli RNAP. Records showed discrete steps averaging 3.7 +/- 0.6 A, a distance equivalent to the mean rise per base found in B-DNA. By combining our results with quantitative gel analysis, we conclude that RNAP advances along DNA by a single base pair per nucleotide addition to the nascent RNA. We also determined the force-velocity relationship for transcription at both saturating and sub-saturating nucleotide concentrations; fits to these data returned a characteristic distance parameter equivalent to one base pair. Global fits were inconsistent with a model for movement incorporating a power stroke tightly coupled to pyrophosphate release, but consistent with a brownian ratchet model incorporating a secondary NTP binding site.

Base Pairing↗

Characterization of the transcripts of hepatitis D and B viruses in infected human livers.

To examine the replication of hepatitis D virus (HDV) and its interactions with helper hepatitis B virus (HBV), the RNA of both viruses was analyzed in liver biopsy tissue obtained from six patients with past or present hepatitis. In four of five hepatitis B surface antigen (HBsAg) carriers, the RNA genome of HDV was found in the liver. Further, the complementary RNA species as replication templates of HDV genomes documented in previous animal studies were confirmed. Within the livers of four HBsAg carriers, the transcription of HBV was absent or incomplete, however, in the patient without HDV RNA, the HBV genes expressed accurately and actively. This may account for the previously observed HBV suppression by concomitant HDV infection.

Adult↗