Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “noncoding genome”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 415 records · Page 23Linked to original sources
PubMed1993

Virological features of hepatitis C virus infection in hemodialysis patients.

The clinical and epidemiological relevance of circulating antibodies to hepatitis C virus (HCV) in hemodialysis patients is uncertain, since clinical signs of infection are often mild or absent, with alanine aminotransferase (ALT) values that are virtually always normal, and liver biopsies are only rarely performed. Determination of HCV RNA in serum is therefore critical for distinguishing chronic HCV infection from previous exposure to the virus. We studied HCV viremia by reverse transcription polymerase chain reaction (RT-PCR) in the 5'-noncoding region of the viral genome in 77 dialysis patients who were screened for anti-HCV by a second-generation enzyme-linked immunosorbent assay (the enzyme immunoassay II; Ortho HCV, 2nd generation, Ortho Diagnostic Systems Raritan, N.J.) and a second-generation recombinant immunoblot assay (Chiron Corporation and Ortho Diagnostic Systems) and prospectively evaluated for ALT elevations over a period of 5 years. Of 77 patients tested, 29 (38%) had active infection as shown by a positive PCR assay result, and of these, 26 were anti-HCV positive. Although a good correlation was found between circulating anti-HCV and HCV RNA in serum, 10 (28%) of 36 anti-HCV-positive patients were HCV RNA negative by PCR, suggesting either low levels of viremia or past exposure to HCV and subsequent recovery. On the other hand, 3 (7.3%) of 41 anti-HCV-negative patients had HCV RNA in their sera, indicating seronegative HCV infection. The ALT level had no predictive value for HCV infection, because it was repeatedly normal in 18 (62%) of 29 viremic patients. HCV genotyping was also performed and indicated that all four known genotypes of HCV were present in our group. In conclusion, serological assays are reliable for detecting exposure to HCV in hemodialysis patients; however, direct identification of the viral genome is required to document current infection.

Adolescent↗
PubMed1993

Rapid detection of poliovirus by reverse transcription and polymerase chain amplification: application for differentiation between poliovirus and nonpoliovirus enteroviruses.

This report describes a rapid method of detection of poliovirus from viral isolates of clinical specimens using a single set of primers selected from the conserved 5' noncoding region of the poliovirus genome. Of the 144 clinical viral isolates examined, 81 were positive for polioviruses and 50 were positive for nonpoliovirus enteroviruses by tissue culture neutralization and infectivity. All 81 (100%) of the viral isolates identified as poliovirus by tissue culture infectivity were also positive by polymerase chain reaction. Of 50 nonpoliovirus enterovirus isolates found to be negative for poliovirus by tissue culture neutralization and infectivity, 48 were also negative by polymerase chain reaction. The high sensitivity (100%) and specificity (96%) of the primer set indicate that this assay has potential clinical applicability in the diagnosis of nonpoliovirus enterovirus infection.

Base Sequence↗
PubMed1983

Regulation of polyoma virus transcription in murine embryonal carcinoma cells.

Undifferentiated murine embryonal carcinoma (EC) cells are resistant to infection with wild-type polyoma virus. The block appears to be located at the transcriptional level. Polyoma host range mutants capable of expressing early and late functions in EC cells have been isolated. The modifications responsible for the phenotype of these mutants are localized in the noncoding region of polyoma DNA genome, containing regulatory sequences for replication and transcription. We compared the 5' termini of early and late mRNAs of wild-type polyoma and mutant viruses in EC cells and in permissive cells. Our results show that wild-type mRNA is normally spliced in EC cells but present at a very low level. The sequence modifications of the mutant viruses lead to a 100-fold increase in the production of mRNA in these cells, but the major 5' termini of early and late mRNAs are identical to those in wild-type-infected 3T6 cells.

Animals↗
PubMed1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

DNA, Viral↗
PubMed1986

RNA-binding proteins of bovine rotavirus.

Two major bovine rotavirus proteins have RNA-binding activity as shown by an RNA overlay-protein blot assay. Of the six proteins in purified virions, only one showed RNA-binding activity. This 92,000-molecular-weight (92K) protein was present in both single- and double-shelled particles. Its RNA-binding activity was blocked by preincubation with monospecific antibody to VP2. Thus, the 92K RNA-binding protein in rotavirus virions is VP2, the second most abundant protein in single-shelled particles. In infected cell extracts, numerous cellular RNA-binding proteins and two virus-specific RNA-binding proteins were detected, VP2 and a 31K nonstructural (NS31) protein. VP2 bound single-stranded RNA in preference to double-stranded RNA, whereas NS31 bound both single- and double-stranded RNA equally well. Binding did not appear to be nucleotide sequence specific, because RNA from uninfected cells and an unrelated RNA virus bound to VP2 and to NS31 as did rotavirus RNA. This technique showed that both cellular and rotavirus RNA-binding proteins also bound DNA. VP2 interacted with rotavirus RNA over a broad pH range, with an optimum at pH 6.4 to 6.8, and at NaCl concentrations between 0 and 100 mM. The RNA-binding activity of NS31 exhibited similar pH and NaCl dependency. Sequence-specific nucleic acid binding could be detected by this method. When labeled synthetic oligodeoxyribonucleotides corresponding to the 3' and 5' plus-sense terminal sequences of rotavirus gene segments were used as probes, the 3' synthetic oligodeoxyribonucleotide bound to one 48K protein in control and infected cells. This suggests that there may be a specific functional interaction between the 48K cellular protein and this 3'-terminal noncoding region of the rotavirus genome or mRNA. These data show that the RNA overlay-protein blot assay is a useful test to identify some cellular and viral proteins with RNA-binding activity. For bovine rotavirus, the evidence suggests that, of all the virus-specific proteins, VP2 and NS31 are most likely to interact with RNA during transcription and replication or virus assembly or both.

Animals↗
PubMed1989

Differences in replication of attenuated and neurovirulent polioviruses in human neuroblastoma cell line SH-SY5Y.

A base change from C to U at position 472 of the 5' noncoding region of the poliovirus genome is known to be a major determinant of attenuation in the P3/Sabin vaccine strain. To determine the biochemical basis for the attenuated phenotype imparted by this mutation, a cell line in which replication of neurovirulent and attenuated viruses could be distinguished was identified. A pair of P3/Sabin-P2/Lansing viral recombinants that differ only at position 472 was used; the viruses replicated equally well in HeLa cells, but the virus with a U at base 472 was attenuated in mice. In the human neuroblastoma cell line SH-SY5Y, recombinants with a U at base 472 replicated to approximately 10-fold-lower titers than did neurovirulent viruses with a C at this position. Analysis of viral RNA and protein synthesis indicated that translation of the attenuated viral RNA was specifically reduced in SH-SY5Y cells.

HeLa Cells↗
PubMed2006

Host species-dependent population structure of a pollen-borne plant virus, Cherry leaf roll virus.

Cherry leaf roll virus (CLRV) belongs to the Nepovirus genus within the family Comoviridae. It has a host range which includes a number of wild tree and shrub species. The serological and molecular diversity of CLRV was assessed using a collection of isolates and samples recovered from woody and herbaceous host plants from different geographical origins. Molecular diversity was assessed by sequencing a short (375-bp) region of the 3' noncoding region (NCR) of the genomic RNAs while serological diversity was assessed using a panel of seven monoclonal antibodies raised initially against a walnut isolate of CLRV. The genomic region analyzed was shown to exhibit a significant degree of molecular variability with an average pairwise divergence of 8.5% (nucleotide identity). Similarly, serological variability proved to be high, with no single monoclonal antibody being able to recognize all isolates analyzed. Serological and molecular phylogenetic reconstructions showed a strong correlation. Remarkably, the diversity of CLRV populations is to a large extent defined by the host plant from which the viral samples are originally obtained. There are relatively few reports of plant viruses for which the genetic diversity is structured by the host plant. In the case of CLRV, we hypothesize that this situation may reflect the exclusive mode of transmission in natural plant populations by pollen and by seeds. These modes of transmission are likely to impose barriers to host change by the virus, leading to rapid biological and genetic separation of CLRV variants coevolving with different plant host species.

3' Untranslated Regions↗
PubMed1988

Purification of Xenopus laevis mitochondrial RNA polymerase and identification of a dissociable factor required for specific transcription.

The Xenopus laevis mitochondrial RNA (mtRNA) polymerase was purified to near homogeneity with an overall yield approaching 50%. The major polypeptides in the final fraction were a doublet of proteins of approximately 140 kilodaltons that copurified with the mtRNA polymerase activity. It appeared likely that the smaller polypeptide is a breakdown product of the larger one. The highly purified polymerase was active in nonspecific transcription but required a dissociable factor for specific transcription of X. laevis mtDNA. The factor could be resolved from mtRNA polymerase by hydrophobic chromatography and had a sedimentation coefficient of 3.0 S. The transcription factor eluted from both the hydrophobic column and a Mono Q anion-exchange column as a single symmetrical peak. The mtRNA polymerase and this factor together are necessary and sufficient for active transcription from four promoters located in a noncoding region of the mtDNA genome between the gene for tRNA(Phe) and the displacement loop.

Animals↗
PubMed1999

A novel unenveloped DNA virus (TT virus) associated with acute and chronic non-A to G hepatitis.

In 1997, a novel DNA virus was isolated from the serum of a patient with posttransfusion hepatitis of unknown etiology in Japan, and it was named TT virus (TTV) after the initials of the index patient. TTV is a nonenveloped, single-stranded and circular DNA virus, and its entire sequence of approximately 3.9 kb has been determined. For being a DNA virus, TTV has a wide range of sequence divergence, allowing the classification into at least 16 genotypes separated by a sequence difference of >30% from one another. The nucleotide sequence of the noncoding region of the TTV genome is conserved, whereas that of the coding region is highly variable. TTV strains with extremely high sequence divergence are common in the same individuals, thereby indicating a mixed infection of TTV strains of different genotypes. An association is found between hepatitis of unknown etiology and the TTV genotypes which are detectable by PCR with primers deduced from the N22 region (genotype 1) in the open reading frame 1 encoding the capsid protein. It would be important to select the primers for specific detection of the TTV genotypes associated with clinical diseases, to further evaluate the capacity of TTV to induce acute and chronic liver disease as well as extrahepatic manifestations.

Base Sequence↗
PubMed2003

New microRNAs from mouse and human.

MicroRNAs (miRNAs) represent a new class of noncoding RNAs encoded in the genomes of plants, invertebrates, and vertebrates. MicroRNAs regulate translation and stability of target mRNAs based on (partial) sequence complementarity. Although the number of newly identified miRNAs is still increasing, target mRNAs of animal miRNAs remain to be identified. Here we describe 31 novel miRNAs that were identified by cloning from mouse tissues and the human Saos-2 cell line. Fifty-three percent of all known mouse and human miRNAs have homologs in Fugu rubripes (pufferfish) or Danio rerio (zebrafish), of which almost half also have a homolog in Caenorhabditis elegans or Drosophila melanogaster. Because of the recurring identification of already known miRNAs and the unavoidable background of ribosomal RNA breakdown products, it is believed that not many more miRNAs may be identified by cloning. A comprehensive collection of miRNAs is important for assisting bioinformatics target mRNA identification and comprehensive genome annotation.

Animals↗
PubMed2006

Initiation factor-independent translation mediated by the hepatitis C virus internal ribosome entry site.

The hepatitis C viral mRNA initiates translation using an internal ribosome entry site (IRES) located in the 5' noncoding region of the viral genome. At physiological magnesium ion concentrations, the HCV IRES forms a binary complex with the 40S ribosomal subunit, recruits initiation factor eIF3 and the ternary eIF2/GTP/Met-tRNA(i)Met complex, and joins 60S subunits to assemble translation-competent 80S ribosomes. Here we show that in the presence of 5 mM MgCl2, the HCV IRES can initiate translation by an alternative mechanism that does not require known initiation factors. Specifically, the HCV IRES was shown to initiate translation in a reconstituted system consisting only of purified 40S and 60S subunits, elongation factors, and aminoacylated tRNAs at high magnesium concentration. Analyses of assembled complexes supported a mechanism by which preformed 80S ribosomes can assemble directly on the HCV IRES at high cation concentrations. This mechanism is reminiscent of that employed by the divergent IRES elements in the Dicistroviridae, exemplified by the cricket paralysis virus, which mediates initiation of protein synthesis without initiator tRNA.

Aminoacylation↗
PubMed2006

Assessment of the role of common genetic variation in the transient neonatal diabetes mellitus (TNDM) region in type 2 diabetes: a comparative genomic and tagging single nucleotide polymorphism approach.

Recent evidence supports the strong overlap between genes implicated in monogenic diabetes and susceptibility to type 2 diabetes. Transient neonatal diabetes mellitus (TNDM) is a rare disorder associated with overexpression of genes at a paternally expressed imprinted locus on chromosome 6q24. There are two overlapping genes in this region: the transcription factor zinc finger protein associated with cell cycle control and apoptosis (ZAC also known as PLAGL1) and HYMA1, which encodes an untranslated mRNA. Several type 2 diabetes linkage studies have reported linkage to chromosome 6q22-25. We hypothesized that common genetic variation at this TNDM region influences type 2 diabetes susceptibility. In addition to the coding regions, we used comparative genomic analysis to identify conserved noncoding regions, which were resequenced for single nucleotide polymorphism (SNP) discovery in 47 individuals. Twenty-six SNPs were identified. Fifteen tag SNPs (tSNPs) were successfully genotyped in a large case-control (n = 3,594) and family-based (n = 1,654) study. We did not find any evidence of association or overtransmission of any tSNP to affected offspring or of a parent-of-origin effect. Using a study sufficiently powered to detect odds ratios of <1.2, we conclude that common variation in the TNDM region does not play an important role in the genetic susceptibility to type 2 diabetes.

Alleles↗
PubMed2002

[A new human cellular protein AUP1. II. cDNA cloning, genomic organization of Aup1 gene ans preliminary characterization of human AUP1 protein].

We report here the cloning of human cDNA of Aup1 gene (ancient uniquitous protein 1), its genomic organization and preliminary characterization of human AUP1 protein. Genomic length of the human Aup1 gene is composed of 12 exons and 11 introns spanning 3047 bp. A single open reading frame of 1230 bp starts with the first ATG from nucleotide 5630 of the genomic sequence, in accordance with the Kazak rule, and stops with TGA on nucleotide 8500 of the genomic sequence AC005041.2. The 3 noncoding region has a 152 bp length followed by poly(A)tail. All exon-intron junctions conform to 5' donor and 3' acceptor consensus. Exon and intron sizes range from 69 to 187 bp, and from 180 to 262 bp, resp. We have cloned a full-length human Aup1 cDNA. For preliminary characterization of human AUP1 protein, we cloned the full-length human Aup1 cDNA in pcDNA3 vector. In vitro transcription/translation of the cloned cDNA yielded a 45 kDa protein. Human Aup1 coding region demonstrates 90% homology to its rat and mouse homologous at the nucleotide level, and 82% at the amine acid level.

Amino Acid Sequence↗
PubMed1997

[Establishment of semi-nested polymerase chain reaction for detecting Coxsackie B virus RNA and the application in clinical diagnosis of viral myocarditis].

The aim of this study was to determine the applicability of the polymerase chain reaction (PCR) technique for the detection of CBV RNA and for routine diagnostic use in clinics. To this end, three oligomeric regions of great homology among the CBVs were selected from the conserved 5'-noncoding region of the CBV genome, and were designated as a set of primers and probe. Semi-nested CBV PCR assay was established. The sensitivity of the method is at 0.1 TCID50 in diluted virus stocks, and this method doesn't react with other related viruses. After the optimum reaction system was determined, the technique was then used in clinical samples. In patients with myocarditis, 62 of 111 serum samples were positive by PCR. The CSF samples from patients with meningitis were also tested, and the positive result was found in 7 out of 20 (35%) specimens. Using the same 111 samples, the PCR technique was compared with the ELISA. The detection rates of the two methods for CBV were 56% and 45%, respectively, with a coincident rate of 77%.

Enterovirus B, Human↗
PubMed1994

Hypocomplementemia associated with hepatitis C viremia in sera from voluntary blood donors.

OBJECTIVES: Hepatitis C virus (HCV) infection induces extra-hepatic manifestations, most of which are considered to be mediated by circulating immune complexes. For evaluating this association in a wider perspective, complement activity was determined in sera from apparently healthy individuals, and hypocomplementemia was tested for correlation with HCV viremia. METHODS: Sera from 10,532 voluntary blood donors were stored at 4 degrees C overnight, serially diluted 2-fold, and tested for hemolytic activity by a microtitration method and antibody to HCV (anti-HCV) by passive hemagglutination with recombinant HCV antigens of the second generation. HCV RNA was determined in sera with anti-HCV or hypocomplementemia, or both, by polymerase chain reaction with nested primers deduced from the 5'-noncoding region of the HCV genome. RESULTS: Hypocomplementemia was detected in 53 (0.5%) of 10,532 donations and anti-HCV in 94 (0.9%). Anti-HCV was detected in 48 (91%) of the 53 sera with hypocomplementemia, more frequently than in 46 (0.44%) of 10,479 sera without (p < 0.001). Among 94 sera positive for anti-HCV, HCV RNA was detected in 45 (94%) of 48 sera with hypocomplementemia, more often than in 10 (22%) of 46 sera without (p < 0.001). CONCLUSIONS: A close association of hypocomplementemia with HCV viremia among apparently healthy blood donors would reflect circulating immune complexes which may cause extrahepatic diseases, such as cryoglobulinemia and membranoproliferative glomerulonephritis, in some HCV carriers. The storage of sera from HCV carriers at 4 degrees C before the test would have contributed to a decreased hemolytic activity due to the cold activation of complement by cryoglobulins involving HCV.

Adult↗
PubMed1994

HCV RNA is present in the menstrual blood of women with chronic hepatitis C infection.

OBJECTIVES: To further determine potential routes of sexual transmission of hepatitis C virus (HCV), we examined the menstrual blood of women chronically infected with this virus. METHODS: Ten premenopausal women with documented HCV infection were studied. All patients were anti-HCV positive by ELISA-II and positive for HCV RNA by polymerase chain reaction. Eight patients acquired their infection via intravenous drug abuse, one patient through blood transfusion, and one patient was a health care worker. Liver biopsies showed evidence of chronic hepatitis in all patients. Menstrual blood was collected on the first day of menses utilizing a sterile 15-ml conical centrifuge tube. Total RNA was isolated from serum by the one-step guanidinium method. Reverse transcriptase polymerase chain reaction was performed with "nested" primers from the 5' noncoding region of the HCV genome. All samples were run twice, and negative controls were run with each sample. Three anti-HCV negative volunteers served as controls. RESULTS: HCV RNA was present in the menstrual blood of all chronically infected patients tested. All controls were negative for menstrual blood HCV RNA. CONCLUSIONS: 1) HCV RNA is routinely present in the menstrual blood of women chronically infected with this virus. 2) Knowledge of the presence of HCV RNA in menstrual blood should help facilitate appropriate guidelines for the sexual counseling of patients with chronic HCV infection.

Adult↗
PubMed1993

Comparison of mitochondrial DNA polymorphism between Chinese subjects and patients with mitochondrial myopathy.

Mitochondrial myopathies are a clinically and biochemically heterogeneous group of disorders sharing common features characterized by structural and functional abnormalities of the mitochondria in skeletal muscle biopsy of the patients. The genetic defects in some of the mitochondrial diseases have been reported recently. However, the mechanisms of pathogenesis of these disorders are still obscure. It has been hypothesized by Morgan-Hughes that there is an increased frequency of DNA polymorphism in the noncoding region of the mitochondrial genome in patients with mitochondriopathy. In this study, we analyzed the mtDNAs isolated from 62 healthy Chinese subjects and 34 blood samples of patients with various mitochondrial myopathies to search for disease-associated RFLPs by PCR technique and restriction pattern analysis. A comparison of the frequency of RFLPs in mtDNAs between normal Chinese subjects and patients was done by statistical analysis. Five new polymorphic sites in mtDNAs from patients were revealed by restriction endonucleases AluI, HaeIII, HinfI, and EcoRII, respectively. These results showed that the frequency of RFLPs in mtDNA increased in patients with mitochondriopathies. Although these results are in line with the hypothesis of Morgan-Hughes, we analyzed only 8.9% of the nucleotide sequence of human mtDNA. Further test of the hypothesis with more detailed analysis of mtDNAs from more patients and larger normal population size is warranted.

DNA, Mitochondrial↗
PubMed1997

Two functional complexes formed by KH domain containing proteins with the 5' noncoding region of poliovirus RNA.

The 5' noncoding region of the poliovirus genome contains RNA structures important for replication and translation. Here we show that two closely related cellular poly(rC) binding proteins (PCBP1 and PCBP2) bind to the terminal cloverleaf structure and facilitate the interaction of the viral protein 3CD (the uncleaved precursor of the protease-polymerase). In addition, these cellular proteins bind to stem-loop IV of the internal ribosomal entry site. The proteins are cytoplasmic and largely associated with ribosomes; they appear to dimerize in solution and to form heterodimers when binding to stem-loop IV. Initiation of viral translation in Xenopus oocytes is strongly inhibited by co-injection of specific antibodies directed against PCBP1 or PCBP2, indicating that the poly(rC) binding proteins may facilitate this process. Furthermore, PCPB-depleted HeLa extracts translate poliovirus RNA inefficiently and the activity is partially restored by addition of recombinant PCBP proteins.

Animals↗