Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “FERREDOXINS”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 415 records · Page 23Linked to original sources
PubMed1994

Functional and evolutionary implications of a [3Fe-4S] cluster of the dicluster-type ferredoxin from the thermoacidophilic archaeon, Sulfolobus sp. strain 7.

The dicluster-type ferredoxin is a key electron carrier in the cytoplasm of the aerobic and thermoacidophilic archaeon, Sulfolobus sp. strain 7, and contains 1 aspartate and 7 cysteine residues as possible ligands to two FeS clusters. The optical, electron paramagnetic resonance (EPR), and cyclic voltammetric studies suggest the presence of one each of [3Fe-4S]1+,0 (-280 mV) and [4Fe-4S]2+,1+ (-530 mV) clusters in the purified Sulfolobus ferredoxin, and the lower potential [4Fe-4S] center was scarcely reducible by excess dithionite even at pH 9. While the Sulfolobus ferredoxin has been known to function as an electron acceptor of 2-oxoacid:ferredoxin oxidoreductase (Kerscher, L., Nowitzki, S., and Oesterhelt, D. (1982) Eur. J. Biochem. 128, 223-230), it is not known whether one or both of two clusters is reduced during the steady-state turnover of the enzyme. Here we show by combinations of the optical and EPR spectroscopies that only the higher potential [3Fe-4S] cluster is reduced at the physiological pH during the steady-state turnover of the purified 2-oxoacid:ferredoxin oxidoreductase at 50 degrees C. The functional significance and evolutionary implications of the [3Fe-4S] center in dicluster-type ferredoxins are discussed.

Amino Acid Sequence↗
PubMed1994

Identification of the amino acids involved in the functional interaction between photosystem I and ferredoxin from Synechocystis sp. PCC 6803 by chemical cross-linking.

Ferredoxin isolated from the cyanobacterium Synechocystis sp. PCC 6803 has been chemically cross-linked to purified photosystem I from the same organism. The reaction was catalyzed by N-ethyl-3-(3-dimethylaminopropyl)carbodiimide in the presence of N-hydroxysulfosuccinimide. A short reaction time and neutral pH values can be used in the presence of the two reagents, ensuring the integrity of both of the proteins and the iron-sulfur cluster of the ferredoxin. The only covalent complex detected comprised ferredoxin and the photo-system I (PSI)-D subunit, as identified by antibodies probing after electrophoresis. Electron paramagnetic resonance measurements of this covalent complex have shown that the cross-linked ferredoxin was entirely photoreducible by photosystem I and that the molar ratio of ferredoxin to PSI was close to 1. Extensive sequencing of the peptides obtained after proteolysis of the purified cross-linked product led to the identification of a covalent bond between glutamic acid 93 of ferredoxin and lysine 106 of the PSI-D subunit.

Amino Acid Sequence↗
PubMed1976

Isolation of chick renal mitochondrial ferredoxin active in the 25-hydroxyvitamin D3-1alpha-hydroxylase system.

An iron-sulfur protein has been isolated from chick kidney mitochondria and purified (200-fold as determined enzymatically by its NADPH-cytochrome c reductase activity in the presence of adrenodoxin reductase) on DEAE-cellulose and gel filtration on Sephadex G-100. The purified protein showed an absorption peak at 411 nm with a shoulder at 460 nm. The electron paramagnetic resonance spectrum was typical of a ferredoxin-type iron-sulfur protein with g values: gx=gy-1.94 and gz=2.02. The molecular weight was estimated by gel filtration to be 12,500. When tested against anti-adrenodoxin gamma-globulin, the protein showed a precipitin line that fused completely with that of adrenodoxin. Based on these findings it is concluded that this protein is an iron-sulfur protein quite similar to adrenal ferredoxin. In the presence of adrenoxodin reductase, NADPH, and carbon monoxide, the purified renal ferredoxin was found to be active in the reduction of cytochrome P-450 solubilized from chick kidney mitochondria. It was also effective in the reconstituted 25-hydroxyvitamin D3-1alpha-hydroxylase composed of the cytochrome P-450 from rachitic chick kidneys and adrenodoxin reductase. A ferredoxin reductase isolated from chick kidney mitochondria could replace adrenodoxin reductase in the reconstituted system. These results strongly support a previous conclusion that the kidney mitochondrial 25-hydroxyvitamin D3-1alpha-hydroxylation system consists of a renal ferredoxin reductase (presumably a flavoprotein), renal ferredoxin, and cytochrome P-450.

25-Hydroxyvitamin D3 1-alpha-Hydroxylase↗
PubMed2005

Purification and characterization of the tungsten enzyme aldehyde:ferredoxin oxidoreductase from the hyperthermophilic denitrifier Pyrobaculum aerophilum.

A tungsten-containing aldehyde:ferredoxin oxidoreductase (AOR) has been purified to homogeneity from Pyrobaculum aerophilum. The N-terminal sequence of the isolated enzyme matches a single open reading frame in the genome. Metal analysis and electron paramagnetic resonance (EPR) spectroscopy indicate that the P. aerophilum AOR contains one tungsten center and one [4Fe-4S](2+/1+) cluster per 68-kDa monomer. Native AOR is a homodimer. EPR spectroscopy of the purified enzyme that has been reduced with the substrate crotonaldehyde revealed a W(V) species with g(zyx) values of 1.952, 1.918, 1.872. The substrate-reduced AOR also contains a [4Fe-4S](1+) cluster with S=3/2 and zero field splitting parameters D=7.5 cm(-1) and E/D=0.22. Molybdenum was absent from the enzyme preparation. The P. aerophilum AOR lacks the amino acid sequence motif indicative for binding of mononuclear iron that is typically found in other AORs. Furthermore, the P. aerophilum AOR utilizes a 7Fe ferredoxin as the putative physiological redox partner, instead of a 4Fe ferredoxin as in Pyrococcus furiosus. This 7Fe ferredoxin has been purified from P. aerophilum, and the amino acid sequence has been identified using mass spectrometry. Direct electrochemistry of the ferredoxin showed two one-electron transitions, at -306 and -445 mV. In the presence of 55 microM ferredoxin the AOR activity is 17% of the activity obtained with 1 mM benzyl viologen as an electron acceptor.

Aldehyde Oxidoreductases↗
PubMed1974

Low Temperature Electronic Absorption Spectra of Oxidized and Reduced Spinach Ferredoxins. Evidence for Nonequivalent Iron(III) Sites.

The electronic absorption spectra of oxidized and reduced spinach ferredoxins have been measured between 1200 and 600 nm at low temperature in D(2)O/ethylene glycol glasses. Relatively weak absorption bands are observed at 720, 820, and 920 nm in oxidized ferredoxin, and at 652, 820, and 920 nm in reduced ferredoxin. The spectral results show that the two Fe(III) centers in oxidized ferredoxin are not equivalent, and that the 820- and 920-nm bands are associated with the nonreducible site. Assignment of the reducible site as tetrahedral Fe(III) is indicated. The 720-nm (13.9 kcm(-1)) band in oxidized ferredoxin is attributed to an intensity-enhanced (6)A(1) --> (4)T(1)d-d transition, whereas the 652-nm (15.3 kcm(-1)) feature of reduced ferredoxin could be due either to (5)E --> (3)T(1) in tetrahedral Fe(II)S(4) or an Fe(II) --> Fe(III) intervalence excitation.

Journal Article↗
PubMed1990

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana.

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.

Journal Article↗
PubMed1991

Purification and characterization of a soybean flour-inducible ferredoxin reductase of Streptomyces griseus.

We have purified an NADH-dependent ferredoxin reductase from crude extracts of Streptomyces griseus cells grown in soybean flour-enriched medium. The purified protein has a molecular weight of 60,000 as determined by sodium dodecyl sulfate gel electrophoresis. The enzyme requires Mg2+ ion for catalytic activity in reconstituted assays, and its spectral properties resemble those of many other flavin adenine dinucleotide-containing flavoproteins. A relatively large number of hydrophobic amino acid residues are found by amino acid analysis, and beginning with residue 7, a consensus flavin adenine dinucleotide binding sequence, GXGXXGXXXA, is revealed in this protein. In the presence of NADH, the ferredoxin reductase reduces various electron acceptors such as cytochrome c, potassium ferricyanide, dichlorophenolindophenol, and nitroblue tetrazolium. However, only cytochrome c reduction by the ferredoxin reductase is enhanced by the addition of ferredoxin. In the presence of NADH, S. griseus ferredoxin and cytochrome P-450soy, the ferredoxin reductase mediates O dealkylation of 7-ethoxycoumarin.

Amino Acid Sequence↗
PubMed2005

Identification of the N- and C-terminal substrate binding segments of ferredoxin-NADP+ reductase by NMR.

Ferredoxin-NADP(+) reductase (FNR) catalyzes the reduction of NADP(+) through the formation of an electron transfer complex with ferredoxin. To gain insight into the interaction of this enzyme with substrates at both ends of the polypeptide chain, we performed NMR analyses of a 314-residue maize leaf FNR with a nearly complete assignment of the backbone resonances. The chemical shift perturbation upon formation of the complex indicated that a flexible N-terminal region of FNR contributed to the interaction with maize ferredoxin, and an analysis of N-terminally truncated mutants of FNR confirmed the importance of this region for the binding of ferredoxin. Comparison between the spectra of FNR in the NADP(+)- and inhibitor-bound states also revealed that the nicotinamide moiety of NADP(+) was accessible to the C-terminal Tyr314. We propose that the formation of the catalytic competent complex of FNR and substrates is achieved through the interaction of the N- and C-terminal segments with ferredoxin and NADP(+), respectively. Since the ends of the polypeptide chain act as flexible regions of proteins, they may contribute to the search of a larger space for a binding partner and to the opening of active sites.

Amino Acid Sequence↗
PubMedDate not supplied

Rapid and sensitive amino-acid sequencing of cloning Thermus thermophilus HB8 ferredoxin by proteomics.

Recombinant holo Thermus thermophilus [7Fe-8S] ferredoxin was synthesized by cloning from Thermus thermophilus HB8 gene. A specific sequence (Pro-His-Val-Ile) at the N-terminus of the recombinant ferredoxin was determined by a rapid and highly sensitive mass spectral method using a novel Ru(II) Edman reagent, [(tpy)Ru(tpy-C6H4-NCS)](PF6)2 (tpy=terpyridine). The formation of the recombinant holoTtFd was established by the characteristic absorptions and CD extrema as [7Fe-8S] ferredoxin. The catalytic electron-transfer reactivity of the [7Fe-8S] ferredoxin between ferredoxin-NADP+ reductase and cytochrome c was recognized.

Cytochromes c↗
PubMed2002

Mycobacterium tuberculosis FprA, a novel bacterial NADPH-ferredoxin reductase.

The gene fprA of Mycobacterium tuberculosis, encoding a putative protein with 40% identity to mammalian adrenodoxin reductase, was expressed in Escherichia coli and the protein purified to homogeneity. The 50-kDa protein monomer contained one tightly bound FAD, whose fluorescence was fully quenched. FprA showed a low ferric reductase activity, whereas it was very active as a NAD(P)H diaphorase with dyes. Kinetic parameters were determined and the specificity constant (kcat/Km) for NADPH was two orders of magnitude larger than that of NADH. Enzyme full reduction, under anaerobiosis, could be achieved with a stoichiometric amount of either dithionite or NADH, but not with even large excess of NADPH. In enzyme titration with substoichiometric amounts of NADPH, only charge transfer species (FAD-NADPH and FADH2-NADP+) were formed. At NADPH/FAD ratios higher than one, the neutral FAD semiquinone accumulated, implying that the semiquinone was stabilized by NADPH binding. Stabilization of the one-electron reduced form of the enzyme may be instrumental for the physiological role of this mycobacterial flavoprotein. By several approaches, FprA was shown to be able to interact productively with [2Fe-2S] iron-sulfur proteins, either adrenodoxin or plant ferredoxin. More interestingly, kinetic parameters of the cytochrome c reductase reaction catalyzed by FprA in the presence of a 7Fe ferredoxin purified from M. smegmatis were determined. A Km value of 30 nm and a specificity constant of 110 microM(-1) x s(-1) (10 times greater than that for the 2Fe ferredoxin) were determined for this ferredoxin. The systematic name for FprA is therefore NADPH-ferredoxin oxidoreductase.

Anaerobiosis↗
PubMed2005

Analysis of the nearly identical morpholine monooxygenase-encoding mor genes from different Mycobacterium strains and characterization of the specific NADH : ferredoxin oxidoreductase of this cytochrome P450 system.

Cloning and sequencing of the morABC operon region revealed the genes encoding the three components of a cytochrome P450 monooxygenase, which is required for the degradation of the N-heterocycle morpholine by Mycobacterium sp. strain HE5. The cytochrome P450 (P450(mor)) and the Fe(3)S(4) ferredoxin (Fd(mor)), encoded by morA and morB, respectively, have been characterized previously, whereas no evidence has hitherto been obtained for a specifically morpholine-induced reductase, which would be required to support the activity of the P450(mor) system. Analysis of the mor operon has now revealed the gene morC, encoding the ferredoxin reductase of this morpholine monooxygenase. The genes morA, morB and morC were identical to the corresponding genes from Mycobacterium sp. strain RP1. Almost identical mor genes in Mycobacterium chlorophenolicum PCP-1, in addition to an inducible cytochrome P450, pointing to horizontal gene transfer, were now identified. No evidence for a circular or linear plasmid was found in Mycobacterium sp. strain HE5. Analysis of the downstream sequences of morC revealed differences in this gene region between Mycobacterium sp. strain HE5 and Mycobacterium sp. strain RP1 on the one hand, and M. chlorophenolicum on the other hand, indicating insertions or deletions after recombination. Downstream of the mor genes, the gene orf1', encoding a putative glutamine synthetase, was identified in all studied strains. The gene morC of Mycobacterium sp. strain HE5 was heterologously expressed. The purified recombinant protein FdR(mor) was characterized as a monomeric 44 kDa protein, being a strictly NADH-dependent, FAD-containing reductase. The K(m) values of FdR(mor) for the substrate NADH (37.7 +/- 4.1 microM) and the artificial electron acceptors potassium ferricyanide (14.2 +/- 1.1 microM) and cytochrome c (28.0 +/- 3.6 microM) were measured. FdR(mor) was shown to interact functionally with its natural redox partner, the Fe(3)S(4) protein Fd(mor), and with the Fe(2)S(2) protein adrenodoxin, albeit with a much lower efficiency, but not with spinach ferredoxin. In contrast, adrenodoxin reductase, the natural redox partner of adrenodoxin, could not use Fd(mor) in activity assays. These results indicated that FdR(mor) can utilize different ferredoxins, but that Fd(mor) requires the specific NADH : ferredoxin oxidoreductase FdR(mor) from the P450(mor) system for efficient catalytic function.

Cytochrome P-450 Enzyme System↗
PubMed1977

[Study of the NADH and NADPH-ferredoxin oxidoreductase activities in Clostridium acetobutylicum].

The NADH and NADPH-ferredoxin oxidoreductase have been studied in Clostridium acetobutylicum. Acetyl-CoA is an obligatory activator of NADH-ferredoxin reductase activity and NADH a competitive inhibitor of ferredoxin-NAD+ reductase activity. These regulations are the same when C. acetoburylicum moves from 'butylic-type metabolism' to 'butyric-type metabolism'; this demonstrates that NADH-ferredoxin oxidoreductase cna, through its reversible action, meet the very different cell needs imposed by these two types of culture. The physiological function of the clostridial NADPH-ferredoxin oxidoreductase was anabolic as it has been with other clostridia.

Acetyl Coenzyme A↗
PubMed1984

Electron transfer by ferredoxin:NADP+ reductase. Rapid-reaction evidence for participation of a ternary complex.

Rapid reaction studies presented herein show that ferredoxin:NADP+ oxidoreductase (FNR, EC 1.18.1.2) catalyzes electron transfer from spinach ferredoxin (Fd) to NADP+ via a ternary complex, Fd X FNR X NADP+. In the absence of NADP+, reduction of ferredoxin:NADP+ reductase by Fd was much slower than the catalytic rate: 37-80 s-1 versus at least 445 e-s-1; dissociation of oxidized spinach ferredoxin (Fdox) from one-electron reduced ferredoxin:NADP+ reductase (FNRsq) limited the reduction of FNR. This confirms the steady-state kinetic analysis of Masaki et al. (Masaki, R., Yoshikaya, S., and Matsubara, H. (1982) Biochim. Biophys. Acta 700, 101-109). Occupation of the NADP+ binding site of FNR by NADP+ or by 2',5'-ADP (a nonreducible NADP+ analogue) greatly increased the rate of electron transfer from Fd to FNR, releiving inhibition by Fdox. NADP+ (and 2',5'-ADP) probably facilitate the dissociation of Fdox; equilibrium studies have shown that nucleotide binding decreases the association of Fd with FNR (Batie, C. J. (1983) Ph.D. dissertation, Duke University; Batie, C. J., and Kamin, H. (1982) in Flavins and Flavoproteins VII (Massey, V., and Williams, C. H., Jr., eds) pp. 679-683, Elsevier, New York; Batie, C.J., and Kamin, H. (1982) Fed. Proc. 41, 888; and Batie, C.J., and Kamin, H. (1984) J. Biol. Chem. 259, 8832-8839). Premixing Fd with FNR was found to inhibit the reaction of the flavoprotein with NADP+ and with NADPH; thus, substrate binding may be ordered, NADP+ first, then Fd. FNRred and NADP+ very rapidly formed an FNRred X NADP+ complex with flavin to nicotinamide charge transfer bands. The Fdred X NADP+ complex then relaxed to an equilibrium species; the spectrum indicated a predominance of FNRox X NADPH charge-transfer complex. However, charge-transfer species were not observed during turnover; thus, their participation in catalysis of electron transfer from Fd to NADP+ remains uncertain. The catalytic rate of Fd to NADP+ electron transfer, as well as the rates of electron transfer from Fd to FNR, and from FNR to NADP+ were decreased when the reactants were in D2O; diaphorase activity was unaffected by solvent. On the basis of the data presented, a scheme for the catalytic mechanism of catalysis by FNR is presented.

Adenosine Diphosphate↗
PubMed1993

Evidence for the involvement of PSI-E subunit in the reduction of ferredoxin by photosystem I.

Of the stroma-accessible proteins of photosystem I (PSI) from Synechocystis sp. PCC 6803, the PSI-C, PSI-D and PSI-E subunits have already been characterized, and the corresponding genes isolated. PCR amplification and cassette mutagenesis were used in this work to delete the psaE gene. PSI particles were isolated from this mutant, which lacks subunit PSI-E, and the direct photoreduction of ferredoxin was investigated by flash absorption spectroscopy. The second order rate constant for reduction of ferredoxin by wild type PSI was estimated to be approximately 10(9) M-1s-1. Relative to the wild type, PSI lacking PSI-E exhibited a rate of ferredoxin reduction decreased by a factor of at least 25. After reassociation of the purified PSI-E polypeptide, the original rate of electron transfer was recovered. When a similar reconstitution was performed with a PSI-E polypeptide from spinach, an intermediate rate of reduction was observed. Membrane labeling of the native PSI with fluorescein isothiocyanate allowed the isolation of a fluorescent PSI-E subunit. Peptide analysis showed that some residues following the N-terminal sequence were labeled and thus probably accessible to the stroma, whereas both N- and C-terminal ends were probably buried in the photosystem I complex. Site-directed mutagenesis based on these observations confirmed that important changes in either of the two terminal sequences of the polypeptide impaired its correct integration in PSI, leading to phenotypes identical to the deleted mutant. Less drastic modifications in the predicted stroma exposed sequences did not impair PSI-E integration, and the ferredoxin photoreduction was not significantly affected. All these results lead us to propose a structural role for PSI-E in the correct organization of the site involved in ferredoxin photoreduction.

Amino Acid Sequence↗
PubMed1988

Model of a complex between the tetrahemic cytochrome c3 and the ferredoxin I from Desulfovibrio desulfuricans (Norway strain).

A three-dimensional model of an electron-transfer complex between the tetrahemic cytochrome c3 and the ferredoxin I from the sulfate-reducing bacterium Desulfovibrio desulfuricans (Norway strain) has been generated through computer graphics methods. The model is based on the known X-ray structure of the cytochrome and on a model of the ferredoxin that has been derived through computer graphics modeling and energy minimization methods, from the X-ray structure of the homologous ferredoxin from Peptococcus aerogenes. Four possible models of interaction between the two molecules were examined by bringing in close proximity each of the four hemes and the redox center (4Fe-4S) of the ferredoxin and by optimizing the ion pairs interactions. One of these models shows by far the "best" structure in terms of charges, interactions, and complementarity of the topology of the contact surfaces. In this complex, the distance between the iron atoms of the ferredoxin redox center and the hemic iron atom is 11.8 A, which compares well with those found between redox centers in other complexes. The contact surface area between the two molecules is 170 A2.

Amino Acid Sequence↗
PubMed1995

Alternative form of the dicluster ferredoxin from the thermoacidophilic archaeon, Sulfolobus sp. strain 7.

An alternative form of a 7Fe dicluster-type ferredoxin (Fd-B) with a different charge density was purified as a minor component from the aerobic and thermoacidophilic archaeon, Sulfolobus sp. strain 7. Comparison of its properties with those of native 7Fe ferredoxin (Fd-A), a major ferredoxin, was made in terms of the molecular properties, the absorption, circular dichroism and electron paramagnetic resonance spectral properties, and the reactivity coupled with the cognate 2-oxoacid:ferredoxin oxidoreductase at 50 degrees C. Our results suggest that the Sulfolobus 7Fe ferredoxin has two spectroscopically distinct forms with slightly different conformations.

Aerobiosis↗
PubMed1999

Formaldehyde ferredoxin oxidoreductase from Pyrococcus furiosus: the 1.85 A resolution crystal structure and its mechanistic implications.

Crystal structures of formaldehyde ferredoxin oxidoreductase (FOR), a tungstopterin-containing protein from the hyperthermophilic archaeon Pyrococcus furiosus, have been determined in the native state and as a complex with the inhibitor glutarate at 1.85 A and 2. 4 A resolution, respectively. The native structure was solved by molecular replacement using the structure of the homologous P. furiosus aldehyde ferredoxin oxidoreductase (AOR) as the initial model. Residues are identified in FOR that may be involved in either the catalytic mechanism or in determining substrate specificity. The binding site on FOR for the physiological electron acceptor, P. furiosus ferredoxin (Fd), has been established from an FOR-Fd cocrystal structure. Based on the arrangement of redox centers in this structure, an electron transfer pathway is proposed that begins at the tungsten center, leads to the (4Fe:4S) cluster of FOR via one of the two pterins that coordinate the tungsten, and ends at the (4Fe:4S) cluster of ferredoxin. This pathway includes two residues that coordinate the (4Fe:4S) clusters, Cys287 of FOR and Asp14 of ferredoxin. Similarities in the active site structures between FOR and the unrelated molybdoenzyme aldehyde oxidoreductase from Desulfovibrio gigas suggest that both enzymes utilize a common mechanism for aldehyde oxidation.

Aldehyde Oxidoreductases↗
PubMed1995

Pyruvate: ferredoxin oxidoreductase from the sulfate-reducing Archaeoglobus fulgidus: molecular composition, catalytic properties, and sequence alignments.

Archaeoglobus fulgidus is a hyperthermophilic sulfate-reducing archaeon. In this communication we describe the purification and properties of pyruvate: ferredoxin oxidoreductase from this organism. The catabolic enzyme was purified 250-fold to apparent homogeneity with a yield of 16%. The native enzyme had an apparent molecular mass of 120 kDa and was composed of four different subunits of apparent molecular masses of 45, 33, 25, and 13 kDa, indicating an alpha beta gamma delta structure. Per mol, the enzyme contained 0.8 mol thiamine pyrophosphate, 9 mol non-heme iron, and 8 mol acid-labile sulfur. FAD, FMN, lipoic acid, and copper were not found. The purified enzyme showed an apparent Km for coenzyme A of 0.02 mM, for pyruvate of 0.3 mM, and for clostridial ferredoxin of 0.01 mM, an apparent Vmax of 64 U/mg (at 65 degrees C) with a pH optimum near 7.5 and an Arrhenius activation energy of 75 kJ/mol (between 30 and 70 degrees C). The temperature optimum was above 90 degrees C. At 90 degrees C, the enzyme lost 50% activity within 60 min in the presence of 2 M KCl. The enzyme did not catalyze the oxidation of 2-oxoglutarate, indolepyruvate, phenylpyruvate, glyoxylate, and hydroxypyruvate. The N-terminal amino acid sequences of the four subunits were determined. The sequence of the alpha-subunit had similarities to the N-terminal amino acid sequence of the alpha-subunit of the heterotetrameric pyruvate: ferredoxin oxidoreductase from Pyrococcus furiosus and from Thermotoga maritima, and unexpectedly, to the N-terminal amino acid sequence of the homodimeric pyruvate:ferredoxin oxidoreductase from proteobacteria and from cyanobacteria. No sequence similarities were found, however, between the alpha-subunits of the enzyme from A. fulgidus and the heterodimeric pyruvate:ferredoxin oxidoreductase from Halobacterium halobium.

Amino Acid Sequence↗