SEARCH · Search PubMed
Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
The vat(D) and erm(B) genes encoding streptogramin resistance in Enterococcus faecium transferred together, and a direct physical link between erm(B) and vat(D) was detected. Both the vat(D) and erm(B) probes hybridized to fragments of different sizes in the donor and transconjugants, which indicated a transposition event.
We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.
DNA from the murine pneumotropic virus was extracted from virus in lung tissue of infected mice, and the regulatory region of the genome was amplified by PCR. The regulatory region of individual plasmid cloned DNA molecules appeared to have heterogeneous enhancer segments, whereas the protein-coding part of the genome had a uniform length. Nucleotide sequence analysis revealed that the majority of the DNA molecules had a structure differing from the standard type. A 220-bp insertion at nucleotide position 142 with a concomitant deletion of nucleotides 143 to 148 was prominent. There were two variants of the 220-bp insertion, differing at two nucleotide positions at one of the termini. Other DNA molecules had complete or partial deletions of these structures and surrounding sequences in the viral enhancer. However, the end of the insertion at nucleotide 142 was frequently preserved. The viral early and late promoter activity of the variant regulatory regions was tested in a luciferase reporter assay by using transfected NIH 3T3 cells. In relation to the standard-type DNA, all variants, including a G272T mutant, had much stronger late promoters. In contrast, the early promoter activity was influenced in a positive or negative direction by individual mutations. Also, the activity of the viral origin of DNA replication was affected by the sequence variation of the regulatory region, although the effects were smaller than for the late promoter. Analysis by Southern blotting and quantification using dot blots showed that approximately 10(3) copies of material related to the 220-bp insert in murine pneumotropic virus DNA was present in mouse and human DNA but not in Escherichia coli DNA. Moreover, analysis by PCR indicated that there were multiple copies in the mouse genome of sequences that were identical or closely related to the 220-bp viral DNA segment. These data together with the nucleotide sequence analysis suggest that the 220-bp insertion is related to a transposable element of a novel type.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Transposable elements (TE) are prominent components of most eukaryotic genomes. In addition to their possible participation in the origin of sexual reproduction in eukaryotes, they may be also involved in its maintenance as important contributors to the deleterious mutation load. Comparative analyses of transposon content in the genomes of sexually reproducing and anciently asexual species may help to understand the contribution of different TE classes to the deleterious load. The apparent absence of deleterious retrotransposons from the genomes of ancient asexuals is in agreement with the hypothesis that they may play a special role in the maintenance of sexual reproduction and in early extinction for which most species are destined upon the abandonment of sex.
BACKGROUND: The primate-specific Alu elements, which originated 65 million years ago, exist in over a million copies in the human genome. These elements have been involved in genome shuffling and various diseases not only through retrotransposition but also through large scale Alu-Alu mediated recombination. Only a few subfamilies of Alus are currently retropositionally active and show insertion/deletion polymorphisms with associated phenotypes. Retroposition occurs by means of RNA intermediates synthesised by a RNA polymerase III promoter residing in the A-Box and B-Box in these elements. Alus have also been shown to harbour a number of transcription factor binding sites, as well as hormone responsive elements. The distribution of Alus has been shown to be non-random in the human genome and these elements are increasingly being implicated in diverse functions such as transcription, translation, response to stress, nucleosome positioning and imprinting. RESULTS: We conducted a retrospective analysis of putative functional sites, such as the RNA pol III promoter elements, pol II regulatory elements like hormone responsive elements and ligand-activated receptor binding sites, in Alus of various evolutionary ages. We observe a progressive loss of the RNA pol III transcriptional potential with concomitant accumulation of RNA pol II regulatory sites. We also observe a significant over-representation of Alus harboring these sites in promoter regions of signaling and metabolism genes of chromosome 22, when compared to genes of information pathway components, structural and transport proteins. This difference is not so significant between functional categories in the intronic regions of the same genes. CONCLUSIONS: Our study clearly suggests that Alu elements, through retrotransposition, could distribute functional and regulatable promoter elements, which in the course of subsequent selection might be stabilized in the genome. Exaptation of regulatory elements in the preexisting genes through Alus could thus have contributed to evolution of novel regulatory networks in the primate genomes. With such a wide spectrum of regulatory sites present in Alus, it also becomes imperative to screen for variations in these sites in candidate genes, which are otherwise repeat-masked in studies pertaining to identification of predisposition markers.
Bacterial genomes generally consist of stable regions termed core genome, and variable regions that form the so-called flexible gene pool. The flexible part is composed of bacteriophages, plasmids, transposons as well as unstable large regions that have been termed genomic islands. Genomic islands encoding virulence factors of pathogenic bacteria have been designated "pathogenicity islands". Pathogenicity islands were first discovered in uropathogenic Escherichia coli and presently more than 30 bacterial species carrying pathogenicity islands have been described. This review summarises the current knowledge on bacterial genomic islands and their general features, and discusses their putative role in the evolution of microbes in the light of genomics of pathogenic bacteria.
The integration of an MFC-powered Fenton (MFC-Fenton) system into the traditional anaerobic composting process can promote excess dewatered sludge (ES) decomposition. However, the antibiotic resistance gene (ARG) profiles in ES treated by MFC-Fenton systems remain poorly understood; in addition, the effect of adding 2-bromoethane sulfonate (BES, a methane inhibitor) during ES treatment using an MFC-Fenton system on ARG levels is largely unexplored. The present work focused on investigating the effects of BES and bioelectrochemical processes on ARG and MGE abundances and unraveling the ARG attenuation mechanism. According to our findings, adding BES promoted ARG reduction in ES in an MFC-Fenton system. The average ARG levels in the MFC-Fenton samples containing high BES contents (0.4 or 0.5 g BES/g VSS) markedly declined relative to those in samples containing lower BES levels. Moreover, macrolide transporter ATP-binding protein, macrolide-efflux protein, and macB levels markedly decreased as BES levels increased. BES supplementation and bioelectrochemical assistance were crucial for altering the ARG composition in the MFC-Fenton system. Changes in the microbial community composition had the greatest effect on the variation in ARG composition. Furthermore, the Actinobacteria and Firmicutes levels accounted for 52.8% of the overall ARG variation. Among MGEs, plasmids, insertion sequences, and integrons showed lower levels within the sludge metagenomes. Typically, sulI, sulII, tetG, and bla TEM levels were positively correlated with metal resistance genes (MRGs), and their levels markedly declined following the MFC-Fenton process. Thus, the collective evidence indicates that BES synergizes with bioelectrogenesis to reduce ARG abundance.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
The MGEs of Drosophila and other objects contain open reading frames (ORFs) encoding transposition enzymes, and "motifs" similar to functional sites: promoters, enhancers, heat shock regulatory sites, those of reception of different stress external signals and hormones, recombination sites, etc. In other words, MGE play a role of "movable cassettes of regulatory elements" in the genomes. The patterns of genome MGE localization are the important components of polygenic systems of character expression, the subjects of variation and evolution. The summed up density of MGE localization along the genome has probably the upper value corresponding to approx. 1 MGE copy per gene. The transpositional variability of MGE patterns could be random, non-random, self-related and inducible. The MGE patterns are important subjects of microevolution and reconstruction of trees of the pattern similarity is an effective method for its description. The patterns could be changed by selection of limited quantitative characters. The stress induction (temperature, treatment, dysgenic cross, etc.) stimulated the MGE transpositions and excisions, mass in population and multiple in individuals. The temperature induction acts probably through the system of response to heat shock treatment. The totality of MGE patterns make up the genomic system capable of quick reorganizations after stress external and genomic influences. The stress external influences are often correlated with passing of the population through the "bottle-neck" stage. The rate of transpositions has an upper limiting border, so named "boundary of regulation error catastrophe", that corresponds to approx. 1 transposition per genome, per generation. After the stress induction of transpositions this boundary could be exceeded, the state of the population norm becoming disrupted. The changes in MGE patterns are also supposed to accompany the changes of characters of isolation, i.e. to accompany the speciation.
Explore the source record for details and available documents.
Explore the source record for details and available documents.
Males of Drosophila melanogaster isogenic line with oligogene mutation radius incompletus (ri) were exposed to standard heat-shock (SHS: t = 37 degrees C, 90 min) and heavy heat-shock (SHS: three-fold transfer of males from t = 37 degrees C, 2h, t0t = 4 degrees C 1 h, and back). At F1 of the treated males with untreated females of the same isogenic line mass transpositions of MGE Dm412 were found. The new positions of MGE seem to be not random, and 5 "hot sites" of transpositions were detected. The probabilities of transpositions were estimated after SHS and HHS and in control sample. They were, correspondingly, 3.4 x 10(-2), 8.7 x 10(-2) and less than 4.1 x 10(-4) transpositions per genome, per site occupied, per generation. Therefore, as a result of HS treatment, the probabilities of transpositions were two orders of magnitude increased as compared to control, directly at next generation after induction. Comparison of these results with those obtained after step-wise temperature treatment shows that induction is dependent rather of "stressor effect" of temperature treatment than of treatment way used.
Explore the source record for details and available documents.
Explore the source record for details and available documents.