Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “AI agents”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 397 records · Page 22Linked to original sources
PubMed2000

Effect of the adhesive layer thickness on the fracture toughness of dental adhesive resins.

We investigated how the thickness of an adhesive layer between two Co-Cr alloy plates affected the mode I fracture toughness of dental adhesive resin by varying the type of resin using a double cantilever beam (DCB) test. Two typical adhesive resins (PV and SB) were used. The adhesive layers of the DCB test specimens were 20, 100 and 200 microns thick. The fracture modes of PV differed with the thickness of the adhesive layer, such as interface fracture at 20 microns thickness, and similar cohesive fracture at 100 and 200 microns thickness. In the case of SB, crack-propagating areas were observed as cohesive fractures in all test specimens with different adhesive layer thickness, and the surfaces of these areas became remarkably rougher as the thickness of the adhesive layer increased. The fracture toughness of PV was not affected by the differences in thickness between the 100 and 200 microns adhesive layers, but there was a notable decrease in fracture toughness when the adhesive layer decreased to a thickness of 20 microns. That of SB showed a tendency to increase as the adhesive layer became thicker.

Adhesiveness↗
PubMed2000

Apoptosis and proliferation as predictors of chemotherapy response in patients with breast carcinoma.

BACKGROUND: Laboratory evidence suggests that many anticancer agents exert their effect by altering the ratio between apoptosis and cellular proliferation. The objective of this clinical study was to examine in vivo changes in apoptotic index (AI), Bcl-2 expression, proliferation (Ki-67 and S-phase fraction [SPF]), and ploidy as potential indicators of chemoresponsiveness. METHODS: Twenty-eight women with primary operable breast carcinoma received 2M (mitoxantrone 11 mg/m2, methotrexate 35 mg/m2 every 3 weeks) for 4 cycles before surgery/radiotherapy, and an additional 2 cycles were given after surgery. Clinical response was assessed after four cycles of treatment according to World Health Organization criteria. Changes in molecular markers were assessed from biopsies obtained by fine-needle aspiration performed before treatment, repeated after 24 and/or 72 hours (T1), and on Days 7 and 21 after the first cycle of chemotherapy. Flow cytometric analysis was used to assess SPF, ploidy, and AI (in situ DNA nick end labeling assay) whereas Ki-67 and Bcl-2 were evaluated by immunocytochemical analysis. RESULTS: The overall response rate was 61% (17 of 28 patients), with a 14% (4 of 28 patients) complete response rate. Patients with diploid carcinomas (P = 0.04) with high Ki-67 (P = 0.0001) and SPF (P = 0.09) were more likely to respond to treatment. Median AI increased by 3.4% with interquartile (IQ) range of 3.2 in responders, compared with only -0.1% (IQ range, 2.2) in nonresponders at T1 (P = 0.03). Median Ki-67 decreased by -12.0% (IQ range, 22.9) in responders and increased by 18.5% (IQ range, 15.1) in nonresponders on Day 21 (P = 0.003). Median Bcl-2 scores increased by 1.0 (IQ range, 4.0) in responders and were unchanged at 0.0 (IQ range, 0.5) in nonresponders (P = 0.08). Changes in SPF or ploidy were not significantly predictive of response. CONCLUSIONS: The results of this preliminary study support evidence that chemotherapy may increase apoptosis, decrease Ki-67, and increase Bcl-2 expression in primary breast carcinomas that subsequently respond to therapy. Methodology allowing morphological confirmation of apoptosis would be advantageous.

Antineoplastic Combined Chemotherapy Protocols↗
PubMed2005

[The relationship between expression of fas mRNA and apoptosis after traumatic brain injury in rats and the role of GM-1 in protecting the brain].

OBJECTIVE: To explore the mechanism of apoptosis after traumatic brain injury (TBI) in rats and elucidate the role of GM-1 by detecting the expression of Fas mRNA and apoptosis in hippocampi. METHODS: After creating the model of Marmarou cranio-cerebral trauma and offering GM-1 therapy, we observed the expression of Fas mRNA and apoptotic cell death using in situ hybridization and terminal deoxynucleotidyl transferase-mediated dUTP-biotin in situ nick end labeling (TUNEL) technique. RESULTS: Increased expression of Fas mRNA and increased apoptotic cells in hippocampi after TBI were observed. GM-1 could decrease the expression of Fas mRNA and apoptotic cell death. CONCLUSION: The increased expression of Fas mRNA may be a noteworthy cause of apoptotic cell death after traumatic brain injury. GM-1 may play a protective role by way of decreasing the expression of Fas mRNA and apoptotic cell death.

Animals↗
PubMed2000

Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

Amino Acid Sequence↗
PubMed2004

Allergic contact dermatitis from hair dye and development of lichen simplex chronicus.

Those who dye their hair frequently manifest allergic contact dermatitis (ACD) from p-phenylenediamine (PPD)-containing hair dye. PPD is known to be the most frequent sensitizer in hair dye, but there has been no documentation of this sensitizer having a role in chronic dermatologic conditions. Our department experienced a case of a 62-year-old woman with lichen simplex chronicus (LSC), who complained of aggravation after hair dyeing and made such an association. We conducted a prospective and retrospective study to further evaluate the clinical associations between the two. In our prospective study, patch testing was performed in selected patients who regularly carried out hair dyeing and also had clinical manifestations of LSC. Also a retrospective examination was conducted in cases where patch testing had been performed with PPD in the past for suspected ACD and further selected cases with concurrent LSC and/or other neurodermatitis. 11 and 14 patients in our prospective and retrospective study, respectively, presented with both LSC and positive findings to PPD. 5 (45.5%) and 4 (28.6%) patients in our prospective and retrospective study showed clinical relevance from clinical improvement after stopping use and rechallenge. We report several cases of patients diagnosed as having LSC and/or prurigo nodularis who showed clinical improvement after discontinuing the use of hair dye. The suggestion can therefore be made that hair dye could be a possible aetiologic agent causing LSC in those using hair dyes.

Adult↗
PubMed2003

Effects of atorvastatin versus fenofibrate on apoB-100 and apoA-I kinetics in mixed hyperlipidemia.

Kinetics of apo B and apo AI were assessed in 8 patients with mixed hyperlipidemia at baseline and after 8 weeks of atorvastatin 80 mg q.d. and micronised fenofibrate 200 mg q.d. in a cross-over study. Both increased hepatic production and decreased catabolism of VLDL accounted for elevated cholesterol and triglyceride concentrations at baseline. Atorvastatin significantly decreased triglyceride, total, VLDL and LDL cholesterol and apo B concentrations (-65%, -36%, -57%, -40% and -33%, respectively, P<0.05). Kinetic analysis revealed that atorvastatin stimulated the catabolism of apo B containing lipoproteins, enhanced the delipidation of VLDL1 and decreased VLDL1 production. Fenofibrate lowered triglycerides and VLDL cholesterol (-57% and -64%, respectively, P<0.05) due to enhanced delipidation of VLDL1 and VLDL2 and increased VLDL1 catabolism. Changes of HDL particle composition accounted for the increase of HDL cholesterol during atorvastatin and fenofibrate (18% and 23%, P<0.01). Only fenofibrate increased apo AI concentrations through enhanced apo AI synthesis (45%, P<0.05). We conclude that atorvastatin exerts additional beneficial effects on the metabolism of apo B containing lipoproteins unrelated to an increase in LDL receptor activity. Fenofibrate but not atorvastatin increases apo AI production and plasma turnover.

Adult↗
PubMed2004

Preparation of human hepatocellular carcinoma-targeted liposome microbubbles and their immunological properties.

AIM: To prepare the human hepatocellular carcinoma-(HCC)-targeted liposome microbubbles and to investigate their immunological properties. METHODS: Human hepatocarcinoma specific monoclonal antibody HAb18 was attached to the surface of home-made liposome microbubbles by static attraction to prepare the targeted liposome microbubbles. The combination of HAb18 with liposome microbubbles was confirmed by the slide agglutination test and immunofluorescent assay. Their immunological activity was measured by ELISA. Rosette formation test, rosette formation blocking test and immun-ofluorescent assay were used to identify the specific binding of targeted liposome microbubbles to SMMC-7721 hepatoma cells, and cytotoxicity assay was used to detect their effect on human hepatocytes. RESULTS: The targeted liposome microbubbles were positive in the slide agglutination test and immunofluorescent assay. ELISA indicated that the immunological activity of HAb18 on the liposome microbubbles was similar to that of free HAb18. SMMC-7721 cells were surrounded by the targeting liposome microbubbles to form rosettes, while the control SGC-7901 gastric cancer cells were not. Proliferation of SMMC-7721 cells and normal human hepatocytes was not influenced by the targeted liposome microbubbles. CONCLUSION: The targeted liposome microbubbles with a high specific biological activity have been successfully prepared, which specifically bind to human hepatocarcinoma cells, and are non-cytotoxic to hepatocytes. These results indicate that the liposome microbubbles can be used as a HCC-targeted ultrasound contrast agent that may enhance ultrasound images and thus improve the diagnosis of HCC, especially at the early stage.

Antibodies, Monoclonal↗
PubMed2004

O6-methylguanine-DNA methyltransferase gene: epigenetic silencing and prognostic value in head and neck squamous cell carcinoma.

BACKGROUND: Alkylating N-nitroso compounds can interact directly with DNA, forming O(6)-alkylguanine, a DNA adduct proved to be mutagenic and carcinogenic if not sufficiently repaired. A specific DNA repair enzyme, O(6)-methylguanine-DNA methyltransferase (MGMT), can remove the alkyl group from the O(6)-position of the guanine, thereby preventing its mutagenic and carcinogenic effects. Inactivation of the MGMT gene in association with promoter hypermethylation results in persistence of O(6)-alkylguanine in DNA, leading to G:C to A:T transition mutation and these G:C to A:T transition mutations can inactivate p53 tumor suppressor gene or activate ras proto-oncogene. METHODS: We analyzed MGMT promoter hypermethylation and protein expression patterns in 94 cases of primary head and neck squamous cell carcinoma (HNSCC) by methylation-specific PCR (MSP) and immunohistochemical staining. The results were then correlated with clinical follow-up data. RESULTS: MGMT promoter hypermethylation was present in 17 of 94 patients (18.1%) and apparent loss of protein expression was seen in 19 of 93 HNSCC patients (20.4%). The presence of MGMT promoter hypermethylation was significantly correlated with loss of MGMT protein expression in HNSCC. Both MGMT promoter hypermethylation and loss of protein expression were significantly correlated to increased tumor recurrences and decreased patient survival, independent of other risk factors, such as tumor site, tumor size, nodal status, age, and chemoradiation therapy. CONCLUSIONS: MGMT promoter hypermethylation and apparent loss of protein expression are reliable and independent prognostic factors in HNSCC. The above study may also provide guideline or basis for applying alkylating antitumor agents to patients with HNSCC that display MGMT promoter hypermethylation and/or loss of MGMT protein expression.

Adult↗
PubMed1991

[New approach in the research of analgesics and antihypertensive agents].

The activation or interruption of the responses induced by regulatory peptides are ensured by ectoenzymes, the most important of them belonging to the group of zinc metallopeptidases. Thus angiotensin converting enzyme (ACE) forms the hypertensive peptide angiotensin II from its inactive precursor AI. This also the case for aminopeptidase N (APN) and neutral endopeptidase 24.11 (NEP, CALLA) which together inactivate the endogenous opioid peptides, enkephalins, whereas only NEP is involved in the metabolism of the atrial natriuretic factor (ANP) at the kidney and vascular levels. The pharmacological effects resulting from the inhibition of these enzymatic processes will appear only in tissues where the peptide substrate is tonically or phasically released. This promising approach is expected to avoid, or at least to minimize, the side effects resulting from excessive and ubiquitous stimulation of peptide receptors by exogenously administered agonists or antagonists. The essential amino acids known to be present in the active site of the bacterial endopeptidase thermolysin from crystallographic studies, have also been found in NEP by using a new program of sequence comparison associated with mutagenesis experiments. Several classes of selective inhibitors of NEP, APN and ACE have been rationally designed by taking into account the structural differences in the active site of these peptidases. Thus, the retro-inversion of the amide bond of the NEP inhibitor thiorphan resulted in the elimination of a residual interaction with ACE. Moreover, we have proposed to associate inhibitory potencies towards two peptidases in the same compound. Thus kelatorphan HONH-CO-CH2-CH(CH2 phi)-CONH-CH(CH3)-COOH and other systemically-active mixed NEP/APN inhibitors were shown capable of completely blocking enkephalin metabolism in vivo. This concept has been extended to mixed NEP/ACE inhibitors with compounds such as HS-CH2-CH(CH2 phi)-CONH-CH(CH2R)-COOH where R = CH-(CH3)2 (ES 34) or -OCH2 phi (ES 37). Only mixed inhibitors of NEP and APN are able to produce potent analgesia after intracerebroventricular or systemic administration without the major side effects of morphine (tolerance and dependence). Thiorphan or its prodrugs acetorphan or sinorphan lead to a increase in natriuresis and diuresis by protection of ANP degradation, but without any significant antihypertensive effect. Contrastingly mixed NEP/ACE inhibitors such as ES34 induce decreases in blood pressure higher than those that produced by the association of selective NEP and ACE inhibitors.

Aminopeptidases↗
PubMed2025

The chicken chorioallantoic membrane model for human surgeries and implants.

The fertilized chick egg, particularly its chorioallantoic membrane (CAM), has emerged as a valuable model in biomedical research due to its extensive applications in vascular studies, cancer investigations, surgical advancements including neurological, gynecological, urological, and retinal procedures, drug evaluation, and implant assessments. This review provides an in-depth examination of the chicken genome, structural composition of CAM, developmental progression, vascularization patterns, and cellular regulatory mechanisms. Furthermore, it underscores the CAM's significance in assessing therapeutic kinetics, biocompatibility, biodistribution, and drug effectiveness. A particular focus is placed on its role in analyzing vascular-disrupting agents (VDAs) for cancer treatment, alongside the incorporation of advanced imaging technologies such as photodynamic therapy, radiotherapy, positron emission tomography (PET)/computed tomography (CT) imaging, ultrasound techniques, and AI-driven detection methods for real-time vascular monitoring. By evaluating its advantages, limitations, and applications, this study establishes that CAM is a crucial alternative model for biomedical research, facilitating enhanced experimental design and methodological refinement.

angiogenesis↗
PubMed2005

Comparative assessment of lipid effects of endocrine therapy for breast cancer: implications for cardiovascular disease prevention in postmenopausal women.

Cardiovascular disease (CVD) is the leading cause of death in the developed world for both men and women. Women experience significant alterations in lipid profiles during the years following menopause, including a reduction in plasma high-density lipoprotein cholesterol and an elevation of plasma low-density lipoprotein cholesterol, and are at an increased risk of CVD. These changes are due in part to the reduction in estrogen production following the onset of the menopause. Therefore, agents that have anti-estrogenic effects, such as most endocrine therapies for breast cancer, may increase the risk of CVD. Tamoxifen, historically the standard endocrine therapy, has an overall beneficial effect on lipid profiles. However, long-term data from clinical trials have failed to demonstrate a cardioprotective effect and patients treated with tamoxifen did not experience fewer cardiovascular events compared with those receiving placebo. Indeed, a number of studies have shown that tamoxifen may have a detrimental effect, with a significantly increased risk of venous thromboembolic events, pulmonary embolism and stroke. The third-generation aromatase inhibitors (AIs) have demonstrated an improvement in efficacy and tolerability over previous treatments. Since they have a different mechanism of action to tamoxifen, they are not anticipated to exert the same impact on lipid profiles. Clinical trials with anastrozole demonstrated no clinically relevant impact on lipid profiles in postmenopausal patients with advanced breast cancer. However, as lipid profiles are surrogate endpoints, the most appropriate endpoint is the incidence of cardiovascular events in long-term studies. This is of particular relevance in the treatment of early breast cancer, where endocrine agents may be used in the adjuvant setting for periods of 5 years or more. Long-term adjuvant anastrozole treatment resulted in significantly fewer thromboembolic and cerebrovascular events and a similar incidence of ischemic cardiovascular events compared with tamoxifen. The effects of the other AIs on lipid levels are variable, and any correlation with cardiovascular events is currently unknown.

Anastrozole↗
PubMed2001

Assessment of the clinical effect of topical tacalcitol on ichthyoses with retentive hyperkeratosis.

BACKGROUND: Topical tacalcitol (1alpha,24-dihydroxyvitamin D3) has been demonstrated to produce beneficial clinical effects on epidermo-hyperproliferative disorders such as psoriasis and pityriasis rubra pilaris. However, the efficacy of the agent has not been elucidated in retentive hyperkeratotic disorders. OBJECTIVE: The object of the study was to assess the clinical efficacy of topical tacalcitol against ichthyoses with retentive hyperkeratosis; X-linked ichthyosis (XLI), ichthyosis vulgaris (IV), and acquired ichthyosis (AI). METHODS: Tacalcitol was topically applied on 9 patients with the retention ichthyoses, using a single-blinded, bilaterally paired approach with right-left comparison of tacalcitol and the base. RESULTS: Clinical improvement obtained by topical tacalcitol exclusively was not superior to that of the vehicle alone in any of the ichthyotic patients. CONCLUSION: Topical tacalcitol therapy was ineffective against ichthyoses without epidermal hyperproliferation.

Administration, Topical↗
PubMed2005

The efficacy of high- and low-dose intravenous omeprazole in preventing rebleeding for patients with bleeding peptic ulcers and comorbid illnesses.

This study sought to determine if high-dose omeprazole infusion could improve the control of rebleeding in patients with comorbid illnesses and bleeding peptic ulcers. After achieving hemostasis by endoscopy, 105 patients were randomized into high-dose (n = 52) and low-dose (n = 53) groups, receiving 200 and 80 mg/day omeprazole, respectively, as a continuous infusion for 3 days. Thereafter, oral omeprazole, 20 mg/day, was given. The cumulative rebleeding rates comparatively rose in both groups (high-dose vs. low-dose group), beginning on day 3 (15.4% vs. 11.3%), day 7 (19.6% vs. 20%), and day 14 (32.7% vs. 28.9%), until day 28 (35.4% vs. 33.3%), and were not significantly different between the two groups (P > 0.50). Multiple logistic regression confirmed that a serum albumin level <3 g/dL was an independent factor associated with rebleeding (P = 0.002). For patients with comorbidities, 3-day omeprazole infusion, despite increasing the daily dose from 80 to 200 mg, was not adequate to control peptic ulcer rebleeding.

Aged↗
PubMed2004

In vitro generation and characterisation of an influenza B variant with reduced sensitivity to neuraminidase inhibitors.

A contemporary influenza type B virus was passaged in vitro in the presence of increasing concentrations of the neuraminidase inhibitors, zanamivir and oseltamivir carboxylate (0.1-1000 microM over nine passages). After the fifth passage in the presence of zanamivir (10 microM), the virus acquired a Glu 119 Asp neuraminidase mutation (influenza A N2 subtype numbering) in the enzyme active site. After a further three passages, in which growth occurred in 100 microM of zanamivir, a Gln 218 Lys mutation (A (H3) numbering) in the HA1 domain of the haemagglutinin was found. In a fluorescence-based neuraminidase inhibition assay, viruses with the Glu 119 Asp NA mutation had a 32,000-fold reduction in sensitivity to the NA inhibitor zanamivir compared to the wild-type virus, while the mutation resulted in a 105-fold reduction in sensitivity to oseltamivir carboxylate. Viruses grown in the presence of 1000 microM oseltamivir carboxylate did not acquire any neuraminidase mutations but did have a His 103 Gln substitution (A (H3) numbering) in the HA1 region of the haemagglutinin which was demonstrated to significantly reduce receptor binding strength in vitro. Tissue culture assays demonstrated that the HA mutation caused a seven-fold reduction in sensitivity to oseltamivir carboxylate, and a 90-fold reduction in sensitivity to zanamivir.

Antiviral Agents↗
PubMed2004

Are all aromatase inhibitors the same? A review of the current evidence.

Third-generation aromatase inhibitors (AIs)--letrozole, anastrozole, and exemestane--are challenging tamoxifen as the standard endocrine therapy for postmenopausal women with hormone receptor-positive breast cancer. AIs suppress estrogen levels by inhibiting aromatase, the enzyme that catalyzes the final step of estrogen biosynthesis. Studies have shown that AIs are highly effective and safe in the treatment of advanced disease, and more recently, AIs have shown promise in the neoadjuvant, adjuvant, and extended adjuvant settings. However, all AIs are not equal. In direct comparisons with anastrozole, letrozole has demonstrated superior estrogen suppression and clinical response in patients with advanced metastatic breast cancer. In addition, letrozole is the only AI to demonstrate consistent superiority over tamoxifen in the neoadjuvant and first-line advanced breast cancer settings. This publication summarizes the available evidence for the efficacy of all 3 agents throughout the breast cancer continuum.

Aromatase Inhibitors↗
PubMed2007

Cost-utility of adjuvant hormone therapies with aromatase inhibitors in post-menopausal women with breast cancer: upfront anastrozole, sequential tamoxifen-exemestane and extended tamoxifen-letrozole.

This evaluation adapts a previous Canadian analysis of upfront and sequential adjuvant AI strategies in postmenopausal women with breast cancer to a Belgian perspective and includes an extended aromatase inhibitor (AI) strategy. A Markov model calculated monthly costs and outcomes in a hypothetical cohort of postmenopausal women with early-stage breast cancer. Baseline event rates and hazard ratios were derived from the Arimidex, Tamoxifen Alone or in Combination trial, International Exemestane Study and MA.17 trials. The analysis took a Belgian healthcare payer perspective with a 20-year time horizon. Costs and outcomes were discounted by 3%. Costs are in 2005 Euros. The cost-utility of all three strategies was favourable (<30,000 euros per QALY gained). Based on indirect comparisons using tamoxifen (TAM) alone as a common comparator, sequential TAM-AI was less costly and more effective than upfront or extended strategies. All three AI strategies were cost-effective alternatives to TAM alone, but sequential TAM-AI appears to be the economically preferred strategy.

Aged↗
PubMed2006

Binding of anti-inflammatory drug cromolyn sodium to bovine serum albumin.

Fluorescence spectroscopy in combination with circular dichroism (CD) and UV-vis absorption spectroscopy were employed to investigate the binding of anti-inflammatory drug cromolyn sodium (Intal) to bovine serum albumin (BSA) under the physiological conditions with Intal concentrations of 0-6.4 x 10(-5)mol L(-1). In the mechanism discussion, it was proved that the fluorescence quenching of BSA by Intal is a result of the formation of Intal-BSA complex. Quenching constants were determined using the Stern-Volmer equation to provide a measure of the binding affinity between Intal and BSA. The thermodynamic parameters Delta G, Delta H, Delta S at different temperatures (298, 304, and 310 K) were calculated and the results indicate the electrostatic interactions play a major role in Intal-BSA association. Binding studies concerning the number of binding sites (n=1) and apparent binding constant K(b) were performed by fluorescence quenching method. Utilizing fluorescence resonant energy transfer (FRET) the distance R between the donor (BSA) and acceptor (Intal) has been obtained. Furthermore, CD and synchronous fluorescence spectrum were used to investigate the structural change of BSA molecules with addition of Intal, the results indicate that the secondary structure of BSA molecules was changed in the presence of Intal.

Animals↗