Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “ADENOIDS”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 397 records · Page 22Linked to original sources
PubMed2005

Adenoid size assessment: a comparison of palpation, nasendoscopy and mirror examination.

OBJECTIVES: To compare the digital, mirror and nasendoscopic assessment of adenoid size and posterior choanal obstruction in patients undergoing adenoidectomy. DESIGN: Prospective, blinded study. SETTING: Otorhinolaryngology department at a London teaching hospital. PARTICIPANTS: Twenty-eight consecutive patients undergoing adenoidectomy in conjunction with tonsillectomy or myringotomy under general anaesthesia, aged 17 months to 16 years. MAIN OUTCOME MEASURES: Adenoid size and postnasal space obstruction as assessed by digital examination, nasendoscopy and trans-oral mirror visualization. These examination methods were each compared with each other. RESULTS: Nasendoscopy and mirror examination correlated well (Spearman's R(S) = 0.71, P < 0.0001) but Passing and Bablock regression analysis demonstrated that mirror examination consistently underestimated the degree of choanal obstruction in comparison with nasendoscopy. There was no significant correlation between nasendoscopy and palpation (R(S) = 0.26, P = 0.17) and only a moderate correlation between mirror examination and palpation (R(S) = 0.46, P = 0.014). CONCLUSION: If nasendoscopy is considered the gold standard, then palpation is a poor measure of adenoid hypertrophy and mirror examination consistently underestimates choanal occlusion.

Adenoidectomy↗
PubMed2006

How we do it: laser reduction of peri-tubal adenoids in selected patients with otitis media with effusion.

. The literature supports the benefit of adenoidectomy in patients with otitis media with effusion (OME). . It is difficult to clear adenoid tissue from around the Eustachian tubes using curettes and this conventional method of adenoidectomy is contra-indicated in patients with cleft palates. . Laser reduction of peri-Eustachian adenoid tissue without myringotomies or grommet insertion was performed in three patients with OME. Two patients had previous adenoidectomies performed with curettes and one patient had a cleft palate. . In all three patients, the OME resolved and all had closure of the air-bone gap that was maintained during long-term follow-up (14 months-4 years). . This technique resolved OME without the need for myringotomies or grommet insertion and should be considered particularly in patients who have peri-tubal recurrence of adenoidal tissue following conventional adenoidectomy or in patients with cleft palate where there is concern with regards to palatal incompetence.

Acoustic Impedance Tests↗
PubMed2006

How we do it: Transoral suction diathermy adenoid ablation under direct vision using a 45 degree endoscope.

Keypoints * Adenoid ablation using suction diathermy is associated with a number of difficulties, mainly associated with the use of the mirror. Transoral and transnasal 0 degree endoscopes have also been utilised but again have limitations. We describe a technique that overcomes the above problems. * A prospective case series of patients undergoing suction diathermy adenoidectomy under direct vision using a transoral 45 degree endoscope connected to a monitor was conducted, performed by surgical trainees and under direct supervision of the consultant trainer (J.R.-J.). * Intra-operatively, trainees had to demonstrate to the trainer the appropriate anatomy, completed adenoid ablation, and haemostasis. * Fifty-six cases have been performed. In every case, it was possible for the trainer to monitor the trainee's technique throughout the entire procedure. No complications have been reported. * We describe a modified technique which overcomes the disadvantages previously encountered by conventional suction diathermy adenoid ablation.

Adenoidectomy↗
PubMed2005

Difference in cytokine production and cell activation between adenoidal lymphocytes and peripheral blood lymphocytes of children with otitis media.

We evaluated the immunological potential of adenoidal lymphocytes from children with recurrent otitis media. Interleukin-4 release and CD69 expression were lower in adenoidal lymphocytes than in peripheral blood lymphocytes (PBL). Our results suggest that there may be a difference between the immunological potential of adenoidal lymphocytes and that of PBL in children with otitis.

Adenoids↗
PubMed1994

Haemophilus influenzae resides and multiplies intracellularly in human adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay.

The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 5' end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of adenoid tissue from 10 children who were clinically infection free but were having their adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.

Adenoids↗
PubMed1996

Detection of integrated high risk human papillomavirus in adenoid cystic carcinoma of the uterine cervix.

AIM: To investigate the role of human papillomavirus (HPV) in adenoid cystic carcinoma of the uterine cervix. METHODS: Eleven archival, paraffin wax embedded specimens were analysed by non-isotopic in situ hybridisation (NISH) for HPV types 6, 11, 16, 18, 31, and 33 using digoxigenin labelled probes. The polymerase chain reaction (PCR) was carried out on each of the cases using consensus primers to HPV. RESULTS: A total of eight adenoid cystic carcinomas harboured the HPV genome by NISH, of which five were PCR positive. Integrated HPV 16 DNA was demonstrated in seven of the eight NISH positive cases. One adenoid cystic carcinoma showed integrated HPV 31. HPV DNA was not detected in the three remaining cases. CONCLUSIONS: Integrated high risk HPV genome, in particular type 16, is associated with this uncommon type of primary cervical cancer.

Aged↗
PubMed1980

Studies on lymphoid cells of adenoid tissue in relation to clinical findings.

Adenoid tissue was obtained at operation in 27 children admitted for adenoidectomy and in 6 controls. The occurrence of cells with cytoplasmic immunoglobulin was studied by immunofluorescence of tissue sections, and localization, number of cells and class of immunoglobulin were determined. No differences were found between patients and controls. Mononuclear leucocytes isolated from adenoid tissue and from blood were compared. In the patients, the proportions of B lymphocytes were higher in the tissue than in the blood, in particular IgG-, IgM- and IgD-carrying cells. Stimulation in vitro with polyclonal activators induced less thymidine incorporation in adenoid cells than in blood cells. Stimulation with heat-killed Haemophilus influenzae induced a high response inadenoid cells from 7/20 patients with negative nasopharyngeal culture for H. influenzae, whereas all 7 patients who harboured H. influenzae in the nasopharynx were low responders.

Adenoidectomy↗
PubMedDate not supplied

Eccrine spiradenoma mimicking adenoid cystic carcinoma on fine needle aspiration. A case report.

BACKGROUND: Although the cytologic features of salivary gland tumors are well recognized, an adnexal skin tumor occurring in the same region, on occasion, may resemble and be confused with a salivary gland neoplasm. CASE: A case of eccrine spiradenoma presented as a painful mass in the region of the parotid that mimicked an adenoid cystic carcinoma on fine needle aspiration cytology. CONCLUSION: Fine needle aspirates of eccrine spiradenoma, a benign cutaneous adnexal tumor, may have findings that mimic those of adenoid cystic carcinoma. Both may have cell balls and rosettelike structures surrounding stromal matrix cores. Recognition of three cell types in eccrine spiradenomas, including epithelial cells, myoepithelial cells and lymphocytes, as compared to a single cell type in adenoid cystic carcinoma, is paramount in avoiding this potential pitfall in cytologic diagnosis.

Adenoma, Sweat Gland↗
PubMedDate not supplied

Cytologic features of primary adenoid cystic carcinoma of the uterine cervix. A case report.

BACKGROUND: Adenoid cystic carcinoma of the cervix is a rare, aggressive neoplasm generally found in postmenopausal women. CASE: A cervical cytology specimen was obtained by endocervical brush from an 80-year-old woman with histologically confirmed primary adenoid cystic carcinoma of the cervix. Both small cells arranged in a cribriform (cylindromatous) pattern and moderately dysplastic squamous cells (high grade squamous intraepithelial lesion) were evident. CONCLUSION: Although the endocervical brush technique may yield well-preserved cells and tissue fragments morphologically characteristic of adenoid cystic carcinoma of the cervix, confusion with more common tumors, such as endometrial adenocarcinoma, still may create cytologic diagnostic difficulties.

Aged↗
PubMed2002

Interference of nontypeable Haemophilus influenzae and Moraxella catarrhalis by Streptococcus oralis in adenoid organ culture: a possible strategy for the treatment of the otitis-prone child.

The role of viridans group streptococci (Streptococcus oralis) in the prevention of colonization with nontypeable Haemophilus influenzae and Moraxella catarrhalis was investigated in an adenoid organ culture system. The adenoids from 100 patients who were undergoing adenoidectomy for either hypertrophy or recurrent otitis media were used. Streptococcus oralis Parker uniformly inhibited colonization with nontypeable H. influenzae or M. catarrhalis over a 24-hour period of incubation in adenoid organ culture. Streptococcus oralis Booth, a noninhibitory strain, did not significantly reduce colonization with nontypeable H. influenzae and M. catarrhalis. The results indicate that some strains of S. oralis may inhibit colonization with potential pathogens in the nasopharynx. It is therefore possible that colonization with inhibitory strains of viridans streptococci may be used in the nasopharynx as a relatively safe and inexpensive approach to prevention of recurrent otitis media in some children.

Adenoids↗
PubMed2003

Pediatric endoscopic transnasal adenoid ablation.

We describe a technique in which suction diathermy is used for adenoid ablation through a solely endoscopic transnasal approach in the older pediatric population. This procedure has proved to be both effective and convenient during other transnasal endoscopic procedures, as it provides excellent visualization of both the superior and inferior parts of the nasopharynx and results in minimal to no bleeding in the adenoid bed. In all cases to date, there has been complete resolution of preoperative problems of infection, pain, and bleeding. All patients had good control of postoperative pain. There has been no evidence of postoperative nasopharyngeal stenosis and no velopharyngeal insufficiency. Although transnasal adenoid ablation is not appropriate for the entire pediatric population, this procedure has multiple benefits when another endoscopic sinonasal procedure is planned, when there is neck instability, or when enhanced visualization of the nasopharynx is desired.

Adenoidectomy↗
PubMed1992

Immunologic response of adenoidal lymphocytes to respiratory syncytial virus.

Adenoidal lymphocytes obtained from 43 subjects with serum antibodies to respiratory syncytial virus (RSV) were established in culture in vitro and analyzed for immunoglobulin (Ig) and RSV-specific antibody synthesis. Spontaneous synthesis of Ig was consistently observed in culture supernatants. The ratios of IgA to IgG and IgM to IgG in adenoidal lymphocyte culture supernatant were higher than in serum. In cell cultures stimulated with RSV or pokeweed mitogen, RSV antibody activity was detected in 25 of 43 (58.1%) for IgG, 5 of 43 (11.6%) for IgA, and 4 of 43 (9.3%) for IgM. Also, RSV-specific IgG was detected in some supernatants from unstimulated cultures. In seven cases the cultures of autologous tonsillar lymphocytes were also investigated. Autologous organs exhibited similar polyclonal Ig production and RSV-specific antibody synthesis. These observations demonstrate that both adenoids and palatine tonsils are continuously engaged in synthesis of local antibodies to viral pathogens available to the nasopharynx and respiratory mucosa.

Adenoids↗
PubMed1997

Role of adenoids in the pathogenesis of otitis media: a bacteriologic and immunohistochemical analysis.

Adenoidectomy is frequently performed in children suffering from recurrent or chronic otitis media with effusion and is thought to produce a long-term effect in preventing further episodes of otitis media. Bacteriologic analysis of adenoids from 60 patients revealed a significantly elevated colonization rate of middle ear pathogens in children with a present or previous history of ear disease compared to children with adenoidal hypertrophy only. The predominant pathogen was nontypeable Haemophilus influenzae, followed by Streptococcus pneumoniae and Moraxella catarrhalis. Quantitative analysis did not demonstrate a bacterial overload in the otitis group. Lectin histochemical analysis of the adenoids revealed no significant differences between the three groups; nevertheless, colonization with S pneumoniae demonstrated an increased labeling pattern with succinylated wheat germ agglutinin, indicating the exposure of N-acetyl-glucosamine as part of its own receptor structure. On the basis of these results, we support the concept of adenoidectomy in order to remove a bacterial focus; however, we could not verify the hypothesis of bacterial overgrowth in the nasopharynx.

Adenoidectomy↗
PubMed1983

The effect of an anti-allergic, nasal decongestant combination ('Dimotapp') and sodium cromoglycate nose drops on the histamine content of adenoids, middle ear fluid and nasopharyngeal secretions of children with secretory otitis media.

Twenty-four children with secretory otitis media awaiting operation for removal of adenoids were studied to investigate the effects of an antihistamine/nasal decongestant combination ('Dimotapp') and sodium cromoglycate nasal drops on the histamine content of adenoids, middle ear fluid and nasopharyngeal secretions. The children were divided into three age and sex matched groups, one of which acted as a control, and received recommended therapeutic doses of either drug for 7 days immediately prior to operation. The results showed that total adenoid histamine content of both drug groups was significantly raised (p less than 0.05) when compared to the control group. Where present, neither 'Dimotapp' nor sodium cromoglycate had any effect on the mean free histamine in the middle ear fluid. In the sodium cromoglycate group the mean free histamine content of the nasopharyngeal secretions was significantly higher than in the control or 'Dimotapp' groups.

Adenoids↗
PubMed2004

Adenoid cystic carcinoma of the parotid metastasizing to liver: case report.

BACKGROUND: Adenoid cystic carcinoma is a rare malignant parotid tumor. Metastasis can occur even a decade or more after initial treatment of the primary. CASE PRESENTATION: We report a 60 year old female patient who presented with adenoid cystic carcinoma of the parotid gland. She underwent a total conservative parotidectomy followed by adjuvant radiotherapy. While on follow up, patient developed multiple liver metastases which manifested three years later. Patient lived for another two years before she died of her disease. CONCLUSIONS: Although distant metastases of adenoid cystic carcinoma develop frequently, isolated metastasis to liver is unusual. Even after manifestation of distant metastasis, patients can be expected to live for a number of years. Palliative chemotherapy can be considered in symptomatic cases while the usefulness of metastasectomy is controversial.

Carcinoma, Adenoid Cystic↗
PubMed2001

Ectopic adenoid tissue in the choanae.

A series of 19 patients with often long-lasting nasal stenosis despite repeated treatment attempts, including in many cases repeated adenoidectomy, were found to have ectopic adenoid tissue in the choanae which could only be removed transnasally by forceps. It did not emerge from the rhinopharynx but from the roof of the choanae, the posterior part of the nasal septum and in some cases also from the lateral wall of the choanae. The diagnosis was established by anterior rhinoscopy using a flexible rhinopharyngo-laryngoscope. The treatment was successful in all 19 patients, many of whom had had symptoms for years. It is estimated that about two per cent of patients with adenoid symptoms have such ectopic choanal adenoid tissue, that cannot be removed by the usual oral approach. In young patients with long-lasting nasal stenosis attention should be focused on the bottleneck of the nasopharyngeal airway formed by the choanae, primarily by fibre-optic endoscopic examination.

Adenoidectomy↗
PubMed1982

Adenoid cystic carcinoma of the submaxillary gland.

A review of submaxillary gland neoplasms over a 21 year period revealed 15 malignancies and 7 benign tumors. All of the malignancies occurred in females, and 11 of these were adenoid cystic carcinoma. Two of the 11 were found to have infiltrating ductal carcinoma of the breast (1 pre and 1 postdiagnosis of the submaxillary carcinoma) and 3 had benign breast disease. While previous reports have suggested an association of parotid gland neoplasia and breast cancer, this is the first known report of an association between adenoid cystic carcinoma of the submaxillary gland and cancer of the breast. The discussion of adenoid cystic carcinoma of the submaxillary gland emphasizes the increased frequency of this disease in females, its association with breast disease, and also experimental submaxillary gland neoplasia.

Adult↗
PubMed1991

Adenoid cystic carcinoma: DNA as a prognostic indicator.

A retrospective study was performed on 20 patients with adenoid cystic carcinomas of major salivary glands to see if DNA patterns correlated with their prognoses. Fourteen tumors were found to be DNA diploid; 6 were DNA aneuploid. Histologically, all DNA-aneuploid tumors had solid components, compared with only 5 of the DNA-diploid tumors. All of the DNA-aneuploid tumors recurred, in contrast to only 2 of the DNA-diploid tumors; the difference was highly significant (P less than 0.001). All of the patients with no recurrences had DNA-diploid tumors. In our study, DNA measurements of adenoid cystic carcinomas gave statistically significant information about prognosis and correlated to histological grading. We propose that evaluation of DNA content may be performed before planning the treatment of adenoid cystic carcinomas.

Adult↗