Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “oligonucleotide composition”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 379 records · Page 21Linked to original sources
PubMed1973

Absence of the sequence G-T-psi-C-G(A)- in several eukaryotic cytoplasmic initiator transfer RNAs.

The nucleotide sequence G-T-Psi-C-G(A)- has previously been found in every tRNA of known sequence that is active in protein biosynthesis. An exception to this generalization is the recently sequenced initiator tRNA from yeast cytoplasm. It is now reported that cytoplasmic initiator tRNAs from wheat germ, rabbit liver, and sheep mammary gland also lack the G-T-Psi-C-G(A)- sequence. Thus: (i) nucleoside composition analyses show the absence of T in all these tRNAs; (ii) analyses of oligonucleotide fragments produced by T1 ribonuclease show the absence not only of the T-Psi-C-G(A)- sequence, but also of U-Psi-C-G(A)- or U-U-C-G(A)- sequences in such digests. The absence of G-T-Psi-C-G(A)- in the eukaryotic cytoplasmic initator tRNAs is, therefore, not simply due to lack of enzymatic modification of U to T.

Adenosine↗
PubMed1997

G protein heterotrimer Galpha13beta1gamma3 couples the angiotensin AT1A receptor to increases in cytoplasmic Ca2+ in rat portal vein myocytes.

The subunit composition of angiotensin AT1 receptor-activated G protein was identified by using antisense oligonucleotide injection into the nucleus of rat portal vein myocytes. In these cells, we have previously shown that increases in the cytoplasmic calcium concentration ([Ca2+]i) induced by activation of angiotensin AT1 receptors were dependent on extracellular Ca2+ entry by L-type Ca2+ channels and subsequent Ca2+-induced Ca2+ release from the intracellular stores. The angiotensin AT1 receptor-activated increases in [Ca2+]i were selectively inhibited by injection of antisense oligonucleotides directed against the mRNAs coding for the alpha13, beta1, and gamma3 subunits. A correlating reduction in Galpha13, Gbeta1, and Ggamma3 protein expression was confirmed by immunocytochemistry. In addition, anti-alpha13 antibody and synthetic peptide corresponding to the carboxyl terminus of the Galpha13 subunit inhibited, in a concentration-dependent manner, the angiotensin AT1 receptor-mediated Ca2+ response. Reverse transcription-polymerase chain reaction analysis showed that only the angiotensin AT1A receptor was expressed in rat portal vein smooth muscle. Furthermore, injection of anti-AT1A oligonucleotides selectively inhibited the angiotensin II-induced increase in [Ca2+]i. We conclude that the receptor-activated signal leading to increases in [Ca2+]i is transduced by the heterotrimeric G13 protein composed of alpha13/beta1/gamma3 subunits and that the carboxyl terminus of the Galpha13 subunit interacts with the angiotensin AT1A receptor.

Angiotensin II↗
PubMed2000

The kappaB and V(D)J recombination signal sequence binding protein KRC regulates transcription of the mouse metastasis-associated gene S100A4/mts1.

A kappaB-like sequence, Sb, is integral to the composite enhancer located in the first intron of the metastasis-associated gene, S100A4/mts1. Oligonucleotides containing this sequence form three specific complexes with nuclear proteins prepared from S100A4/mts1-expressing CSML100 adenocarcinoma cells. Protein studies show the Sb-interacting complexes include NF-kappaB/Rel proteins, p50.p50 and p50.p65 dimers. Additionally, the Sb sequence was bound by an unrelated approximately 200-kDa protein, p200. Site-directed mutagenesis in conjunction with transient transfections indicate that p200, but not the NF-kappaB/Rel proteins, transactivates S100A4/mts1. To identify candidate genes for p200, double-stranded DNA probes containing multiple copies of Sb were used to screen a randomly primed lambdagt11 cDNA expression library made from CSML100 poly(A)(+) RNA. Two clones corresponding to the DNA-binding proteins KRC and Alf1 were identified. KRC encodes a large zinc finger protein that binds to the kappaB motif and to the signal sequences of V(D)J recombination. In vitro DNA binding assays using bacterially expressed KRC fusion proteins, demonstrate specific binding of KRC to the Sb sequence. In addition, introduction of KRC expression vectors into mammalian cells induces expression of S100A4/mts1 and reporter genes driven by S100A4/mts1 gene regulatory sequences. These data indicate that KRC positively regulates transcription of S100A4/mts1.

3T3 Cells↗
PubMed1988

5'-Levulinyl and 2'-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.

The levulinyl group has been employed for protection of the 5'-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2'-tetrahydro-furanyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.

Aminolevulinic Acid↗
PubMed2004

A microarray search for genes predominantly expressed in human omental adipocytes: adipose tissue as a major production site of serum amyloid A.

To identify genes predominantly expressed in omental adipocytes, microarray expression profiles from 33 human tissues or cell types were analyzed, using an algorithm developed for identification of transcripts predominantly expressed in a certain tissue. Both known adipocyte-specific and more unexpected genes were among the 28 genes identified. To validate the approach, adipocyte expression of three of these genes, acute-phase serum amyloid A (A-SAA), aquaporin 7, and transport secretion protein-2.2, was compared with 17 other human tissues by real-time PCR. The unexpectedly high expression of A-SAA in adipocytes was further verified by Northern blot and immunohistochemistry. The liver, reported to be the main production site for A-SAA, displayed the second highest expression using microarray and real-time PCR. In obese subjects, adipose tissue mRNA and serum A-SAA levels were down-regulated during an 18-wk diet regime (P < 0.05 and P < 0.0001, respectively). A-SAA serum levels were highly correlated to adipose tissue mRNA levels (P < 0.001) and to the total (P < 0.0001) and sc (P < 0.0001) adipose tissue areas, as analyzed by computed tomography. We show that adipose tissue is a major expression site of A-SAA during the nonacute-phase reaction condition. This provides a direct link between adipose tissue mass and a marker for low-grade inflammation and cardiovascular risk.

Adipocytes↗
PubMed1989

The distribution of the frequency of occurrence of nucleotide subsequences, based on their overlap capability.

DNA's genetic code can be represented as an alphabetic sequence composed of the four letters A, C, G, and T, which represent the four types of nucleotides--adenylic, cytidylic, guanylic, and thymidylic acid--of which DNA is composed. Now that these sequences have been identified for many genes and are available in computer-readable form, scientists can analyze these data and search for patterns in an attempt to learn more about the regulatory functions of the gene. One area of study is that of the frequency of occurrence of specific nucleotide subsequences (e.g., ACAC) within part or all of a nucleotide sequence. This paper derives the probability distribution of the frequency of occurrence of a subsequence within a nucleotide sequence, under the hypothesis that the four nucleotides occur at random and with equal probability. This distribution is nontrivial because different subsequences have different "overlap capability." For example, the subsequence AAAA can occur up to 17 times in a sequence of length 20 (which would happen if the sequence were composed solely of A's), but the subsequence ACGT cannot occur more than 5 times in a sequence of length 20. Thus, the frequency distributions are different for each type of overlap capability. It is of interest to assess and compare the degree of nonrandomness for different subsequences or among different portions of a sequence; the existence and degree of nonrandomness may be related to the type and degree of functionality of a nucleotide (sub)sequence. The frequency distributions provided here can be used to perform exact significance tests of the hypothesis of randomness. An approximate test is also described for use with long sequences; this can be used to test a more general null hypothesis of nucleotides occurring with unequal probabilities.

Algorithms↗
PubMed1994

Oligonucleotide design and optimized protocol for site-directed mutagenesis.

We have optimized conditions for the successful execution of site-directed mutagenesis (SDM) in systems that utilize mutagenic oligonucleotide primers to direct the synthesis of mutant plasmids. In this report, we describe strategies for the design of single-strand DNA templates for SDM, mutagenic oligonucleotide primers, as well as conditions for the annealing, synthesis and propagation of mutant plasmids. The primary focus of the report details the technical aspects of computer-assisted mutagenic oligonucleotide design. Important features include oligonucleotide length, number of matched bases flanking the point(s) of mutation(s), melting temperature, internal stability of the 5' and 3' ends, hairpin and dimer formation, and potential false-priming sites. Largely through a retrospective analysis of our successes and failures, we describe features of the mutagenic oligonucleotide primer that appear critical in this mutagenesis system. Specific examples of efficient and inefficient oligonucleotides are discussed. These characteristics and guidelines should be applicable for SDM of a broad range of target sequences of varying composition, complexity and secondary structure.

Computers↗
PubMed2002

Isolation of small-subunit rRNA for stable isotopic characterization.

Small-subunit ribosomal RNA (SSU rRNA) has several characteristics making it a good candidate biomarker compound: it is found in bacteria, archaea and eukaryotes; it is quickly degraded extracellularly, hence SSU rRNA extracted from a sample probably derives from the currently active population; it includes both conserved and variable regions, allowing the design of capture probes at various levels of phylogenetic discrimination; and rRNA sequences from uncultured species can be classified by comparison with the large and growing public database. Here we present a method for isolation of specific classes of rRNAs from mixtures of total RNA, employing biotin-labelled oligonucleotide probes and streptavidin-coated paramagnetic beads. We also show that the stable carbon isotope composition of Escherichia coli total RNA and SSU rRNA reflects that of the growth substrate for cells grown on LB, M9 glucose and M9 acetate media. SSU rRNA is therefore a promising biomarker for following the flow of carbon, and potentially nitrogen, in natural microbial populations. Some possible applications are discussed.

Carbon Isotopes↗
PubMed2006

Rapid quantitative profiling of complex microbial populations.

Diverse and complex microbial ecosystems are found in virtually every environment on earth, yet we know very little about their composition and ecology. Comprehensive identification and quantification of the constituents of these microbial communities--a 'census'--is an essential foundation for understanding their biology. To address this problem, we developed, tested and optimized a DNA oligonucleotide microarray composed of 10,462 small subunit (SSU) ribosomal DNA (rDNA) probes (7167 unique sequences) selected to provide quantitative information on the taxonomic composition of diverse microbial populations. Using our optimized experimental approach, this microarray enabled detection and quantification of individual bacterial species present at fractional abundances of <0.1% in complex synthetic mixtures. The estimates of bacterial species abundance obtained using this microarray are similar to those obtained by phylogenetic analysis of SSU rDNA sequences from the same samples--the current 'gold standard' method for profiling microbial communities. Furthermore, probes designed to represent higher order taxonomic groups of bacterial species reliably detected microbes for which there were no species-specific probes. This simple, rapid microarray procedure can be used to explore and systematically characterize complex microbial communities, such as those found within the human body.

Adult↗
PubMed2001

Determination of bias in the relative abundance of oligonucleotides in DNA sequences.

Different statistical measures of bias of oligonucleotide sequences in DNA sequences were compared, both by theoretical analysis and according to their abilities to predict the relative abundances of oligonucleotides in the genome of Escherichia coli. The expected frequency of an oligonucleotide calculated from a maximal order Markov model was shown to be a degenerate case of the expected frequency calculated from biases of all subwords arising when noncontiguous subwords exhibit no bias. Since (at least in E. coli) noncontiguous sequences exhibit significant bias, the total compositional bias approach is expected to represent biases in genomic sequences more faithfully than Markov approaches. In fact, the efficacy of statistics based on Markov analysis even at the highest order were inferior in predicting actual frequencies of oligonucleotides to methods that factored out biases of internal subwords with gaps. Using total compositional bias as a measure of relative abundance, tetranucleotide and hexanucleotide palindromes were found to be distributed differently from nonpalindromic sequences, with their means shifted somewhat towards underrepresentation. A subpopulation of palindromic hexanucleotides, however, was highly underrepresented, and this group consisted almost entirely of targets for Type II restriction enzymes found within strains of E. coli. Sites recognized by Type I endonucleases from related strains were not markedly biased, and with pentanucleotides, palindromic and nonpalindromic sequences had nearly identical distributions. The loss of restriction sites may be explained by the free transfer of plasmids encoding restriction enzymes and episodic selection for the presence of the enzymes.

Base Composition↗
PubMed1988

Rapid identification of clones using the same degenerate oligonucleotide mixture for both screening and sequencing.

A simple and rapid strategy for distinguishing between positively hybridizing colonies and false positive-hybridization signals is described. The isolation of a specific DNA sequence depends on the ability to distinguish between a clone that contains the correct sequence and a false hybridization-positive or background signal. This procedure utilizes the same oligonucleotide mixture both as a screening probe and as a sequencing primer. The mixture of oligonucleotides is used as a primer to obtain sequence information directly from double-stranded DNA. Conditions for sequencing with oligonucleotides having up to 64-fold degeneracy are described. Since the sequence information obtained is directly adjacent to the site of oligonucleotide:DNA hybridization, it is necessary to know only a minimal length of DNA or peptide sequence to both design oligonucleotide probes and confirm the authenticity of the hybridization positives. The advantages of the degenerate oligonucleotide sequencing method include the rapid, reliable identification of authentic versus false hybridization positives made directly without subcloning into single-stranded M13 phage, without sequencing large regions of DNA, or without synthesizing sequence-specific primers.

Animals↗
PubMed1990

Characterization of the DNA damage recognized by an antiserum elicited against cis-diamminedichloroplatinum (II)-modified DNA.

A series of in vitro and in vivo studies were performed to characterize DNA damage recognized by an antiserum elicited against DNA modified with cis-diamminedichloroplatinum(II) (cisplatin). Adducts determined by the cisplatin-DNA enzyme-linked immunosorbent assay (ELISA) in human blood cell DNA have been shown to correlate well with positive clinical outcome in testicular and ovarian cancer patients receiving platinum drug-based chemotherapy (Reed et al. (1990) Proc. Natl. Acad. Sci., 84; 5024, and Reed et al. (1988) Carcinogenesis, 9, 1909). DNAs from calf thymus, salmon sperm, pBR322 and synthetic oligonucleotides were modified with cisplatin in vitro before or after specific DNA digestion steps to yield adducted samples of known size and/or chemical composition. These cisplatin modified DNAs were assayed by atomic absorption spectrometry (AAS) to assess absolute platinum content, and by ELISA to determine the antiserum specificity. The antiserum recognizes native cisplatin-modified calf thymus DNA, and native oligonucleotides containing intrastrand cis-Pt (NH3)2-d(pGpG) adducts (Pt-GG) and intrastrand cis-Pt (NH3)2-d(pApG) adducts (Pt-AG). Modified plasmid DNA fragments of varying sizes (down to 309 base pairs) are recognized similarly to cisplatin-modified calf thymus DNA. The antiserum does not cross-react with individual Pt-GG or Pt-AG adducts not bound to DNA. In experiments designed to assess the relationship between adduct measured by ELISA and total platinum bound to DNA as measured by AAS, male and female Sprague-Dawley rats were injected i.p. with cisplatin and a dose response for adduct formation was determined in kidney DNA samples. Values obtained by ELISA were substantially lower than those measured by AAS, and the two were directly related in DNA from kidney tissues of rodents but not in DNA from human nucleated blood cells. In rodent samples the ELISA measured a consistent 0.2% of the total DNA-bound platinum determined by AAS, with a correlation coefficient of 0.91. Among 54 blood cell DNA samples from human patients, which gave measurable adduct values in both ELISA and AAS, the ELISA measured a variable fraction (0.2-33.0%) of the total DNA-bound platinum measured by AAS. We conclude that the cisplatin-DNA ELISA measures a three dimensional lesion in DNA that is formed in direct proportion to total DNA-bound platinum in rat kidney, but that in human biological samples, interindividual variability precludes a relationship that conforms to simple mathematical algorithms.

Animals↗
PubMed1999

Importance of nucleotide sequence and chemical modifications of antisense oligonucleotides.

The antisense approach is conceptually simple and elegant; to design an inhibitor of a specific mRNA, one needs only to know the sequence of the targeted mRNA and an appropriately modified complementary oligonucleotide. Of the many analogs of oligodeoxynucleotides explored as antisense agents, phosphorothioate analogs have been studied the most extensively. The use of phosphorothioate oligodeoxynucleotides as antisense agents in various studies have shown promising results. However, they have also indicated that quite often, biological effects observed could be solely or partly non-specific in nature. It is becoming clear that not all phosphorothioate oligodeoxynucleotides of varying length and base composition are the same, and important consideration should be given to maintain antisense mechanisms while identifying effective antisense oligonucleotides. In this review, I have summarized the progress made in my laboratory in understanding the specificity and mechanism of actions of phosphorothioate oligonucleotides and the rationale for designing second-generation mixed-backbone oligonucleotides.

Animals↗
PubMed1993

Basic matrices for the matrix-assisted laser desorption/ionization mass spectrometry of proteins and oligonucleotides.

In order to examine the importance of pH in the matrix-assisted laser desorption/ionization (MALDI) analysis of proteins and oligonucleotides, 37 highly substituted pyrimidine, pyridine, and benzene derivatives containing basic amino groups were screened as potential matrices. Several of these compounds were useful for the preparation and analysis of samples under neutral and basic pH conditions. The matrix, 2-amino-4-methyl-5-nitropyridine, gave good results with small proteins (up to approximately 12,000 Da). The best results with oligonucleotides were obtained with 2-amino-5-nitropyridine, which was a useful matrix for the analysis of mixed-base oligonucleotides smaller than 20 nucleotides in length and homopolymers of thymidine. In general, oligonucleotide analysis using basic matrices was found to be subject to similar constraints of size and base composition that hold when acidic matrices are used. A major advantage of these newly discovered matrix materials over the more commonly used acidic matrices is that they extend the utility of MALDI to the analysis of acid-sensitive species.

Base Sequence↗
PubMed1995

Compact structures of d(CNG)n oligonucleotides in solution and their possible relevance to fragile X and related human genetic diseases.

We show that oligonucleotides of CNG tracts readily adopt compact DNA structures that move unusually fast on gels. Base composition does not explain this, and non-CNG triplets (including GNC) do not form such structures. Chemical probing and melting experiments suggest that the structures probably are not hairpins. Although both long and short tracts can adopt compact structures, the structure formed by longer tracts is more compact than that formed by shorter ones. We note the possibility that such structures may form in vivo, and be instrumental in normal and/or abnormal function of human genes.

Base Sequence↗
PubMed2003

Solving the riddle of the bright mismatches: labeling and effective binding in oligonucleotide arrays.

RNA binding to high-density oligonucleotide arrays has shown tantalizing differences with solution experiments. We analyze here its sequence specificity, fitting binding affinities to sequence composition in large datasets. Our results suggest that the fluorescent labels interfere with binding, causing a catch-22. To be detected, the RNA must both glow and bind: without labels it cannot be seen even if bound, while with too many it will not bind. A simple model for the binding of labeled oligonucleotides sheds light on the interplay between binding energies and labeling probability.

Base Sequence↗
PubMed1987

Complementary base-pairing properties of cyclized and linear oligonucleotides.

Oligouridylates of varying chain lengths were synthesized by polynucleotide phosphorylase and cyclized by RNA ligase. Over chain lengths from 7 to 15, the bindings of the cyclized and linear oligomers to polyadenylate were measured on the basis of differential migration of bound and free oligomers on a gel exclusion column. Binding of the cyclized oligomers was found to be far weaker than that of their linear counterparts of equal length. Such a general reduction in base-pairing capacity due to the cyclized conformation, by limiting the strength of unintended base-pairing without obstructing the possible development of strong specific base-pairing, may represent an advantage important to the function and evolution of loop structures in tRNA and other RNA molecules.

Base Composition↗
PubMed1988

Co-localization of rare oligonucleotides and regulatory elements in mammalian upstream gene regions.

In order to identify putative control signals of gene expression, 634 mammalian DNA sequences spanning 1.8 x 10(6) base-pairs were analysed and the frequencies of 1024 oligonucleotides five bases long (5-tuples) were determined. We defined as rare those 5-tuples having an observed frequency less than 50% of that expected by chance on the basis of base composition, and which had a reduction in frequency not attributable to CpG suppression or to coding constraints. Very few rare 5-tuples were identified; in addition, three oligonucleotides, reverse complements of rare 5-tuples, were found to have a frequency ranging between 0.582 and 0.671. The frequency of most of the rare 5-tuples was higher in 5' promoter regions as compared to exonic segments, so imitating the distribution pattern of known signals. Some of the rare 5-tuples identified by this strategy belonged to a portion of the nine base-pair binding site in promoters, which is also known as the octamer motif. In addition, three of the rare oligonucleotides were found to be located within other regulatory elements, previously identified by techniques of molecular biology. Two rare 5-tuples were found within sites of interaction between DNA and proteins, one of them being a transcriptional factor. The available data about known control sequences involved in gene expression in mammals therefore provide evidence for a role in gene regulation of the rare oligonucleotide selected.

Animals↗