Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “expression efficiency”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 379 records · Page 21Linked to original sources

Expression of a CD3 epsilon transgene in CD3 epsilon(null) mice does not restore CD3 gamma and delta expression but efficiently rescues T cell development from a subpopulation of prothymocytes.

The TCR-associated CD3 complex consists of four subunits, i.e. CD3 gamma, delta, epsilon and zeta, which are expressed very early in T cell development prior to the expression of the TCR and the pre-TCR alpha chain. It is unclear whether the expression of each CD3 protein is independent of, or is influenced by, other CD3 subunits. To study whether CD3 epsilon regulates expression of CD3 gamma and delta genes, we generated a strain of CD3 epsilon-deficient mice termed CD3 epsilon(delta P/delta P) (epsilon(delta P)), in which the promoter of CD3E was disrupted, and subsequently reconstituted these mice with a CD3 epsilon transgene. In the epsilon(delta P) mice, T cell development is arrested at the double-negative stage and targeting the CD3 epsilon gene caused severe inhibition of CD3 gamma and delta gene expression. Introduction of the CD3 epsilon transgene did not restore CD3 gamma and delta expression. However, a very small fraction of prothymocytes that expressed CD3 gamma and delta was rescued upon reconstitution of the CD3 epsilon transgene. Remarkably, this rescue led to a very efficient differentiation and maturation of thymocytes, resulting in a significant T cell population in the periphery. These results demonstrate that CD3 epsilon does not regulate expression of CD3 gamma and delta genes, and underscore the capacity of each prothymocyte to give rise to a large number of mature peripheral T cells.

Animals↗

Gene gun delivery of mRNA in situ results in efficient transgene expression and genetic immunization.

The use of mRNA to transfer genetic information into mammalian somatic cells in vivo or ex vivo may be advantageous in a number of gene therapy protocols. Success in utilizing in vivo RNA delivery for transgene expression has been extremely limited, partially due to RNA instability and to the lack of an efficient intracellular delivery mechanism applicable to a wide variety of tissue or organ systems. We report here that a particle-mediated gene delivery technology can be used to effectively deliver RNA molecules into a number of mammalian somatic tissue types. Expression from RNA transcripts of three reporter genes, firefly luciferase, human growth hormone and human alpha-1 antitrypsin, was detected in monolayer and suspension cell cultures bombarded in vitro, and in in vivo bombarded rat liver tissues, and mouse liver and epidermal tissues. Gene gun treatment of mouse epidermis in vivo with human alpha-1 antitrypsin messenger RNA elicited a strong, consistent antibody response which showed an increased titer with subsequent boosts. Results from this study point to future opportunities of applying RNA delivery techniques for transgenic studies, genetic vaccination, and gene therapy.

Animals↗

The Tn10-encoded tetracycline resistance mRNA contains a translational silencer in the 5' nontranslated region.

We performed a mutational analysis of the left half of Tn10-encoded tet operator O2, located in the 5' nontranslated region of the mRNA for the resistance protein TetA, and determined the importance of that region for translation efficiency and mRNA stability. Transcriptional fusions of 17 mutants to lacZ expressed the same amounts of beta-galactosidase, while translational fusions varied 35-fold in expression efficiency. The mRNA half-lives varied 24-fold, with 9.6 min for the most highly expressed mRNA and 0.4 min for the least efficiently expressed mRNA. Toeprint experiments were performed to distinguish whether these mutations define a determinant of mRNA stability or influence translation initiation. The highly expressed mRNA was 24-fold more efficient in forming the initiation complex in vitro than the low-expression mutant. It was concluded that this sequence, albeit located upstream of the ribosome-binding sequence, is an important determinant for efficient initiation of translation. Secondary-structure calculations of the mRNAs revealed no correlation of the potential to form double strands masking the ribosome-binding sequence with expression efficiency.

Base Sequence↗

Targeting expression to the mammary gland: intronic sequences can enhance the efficiency of gene expression in transgenic mice.

We are studying the tissue-specific expression of the sheep milk-whey protein gene, beta-lactoglobulin. We have used sequences derived from this gene to target the expression of biomedical proteins into milk with the intention to exploit this technology in transgenic sheep as a means of protein production. In the present study, a series of beta-lactoglobulin hybrid genes and beta-lactoglobulin minigenes were evaluated for expression in the mammary gland of transgenic mice. In particular, we have assessed whether there is a requirement for introns for efficient transgene expression in the mammary gland, since the coding sequences of many candidate proteins are available only as cDNAs. The results suggest that the inclusion of natural introns in constructs can enhance the efficiency of transgene expression. Thus, a hybrid construct comprising 4.3 kb of the immediate 5' flanking sequences of beta-lactoglobulin fused to a genomic minigene encoding human alpha-antitrypsin (alpha 1AT) was expressed much more efficiently than an alpha 1AT-cDNA construct containing the same beta-lactoglobulin segment. Similarly, the intact beta-lactoglobulin gene was expressed more efficiently than the corresponding intronless beta-lactoglobulin minigene. This effect was not seen in transient expression experiments in baby hamster kidney cells when beta-lactoglobulin-alpha 1AT constructs were driven by SV40 enhancer sequences. The effect cannot be explained by a simple requirement for splicing, since the inclusion of the first beta-lactoglobulin intron into cDNA constructs encoding human alpha 1AT or beta-lactoglobulin itself failed to enhance the efficiency of transgene expression. It is concluded that sequence elements within introns may interact with the upstream 5' flanking sequences of beta-lactoglobulin and enable the latter to function efficiently in the mammary gland of transgenic mice.

Animals↗

Exogenous DNA expression in eukaryotic cells following microinjection.

Microinjection of nucleic acids, DNA, RNA, proteins, and any soluble material into living eukaryotic cells makes it possible to design experiments focused on single cells. In contrast facilitated transfer protocols requires hundreds of thousands of cells from which the expressed gene or intracellular effect must be detected within the culture. In addition to the immediate observable nature of the expressed product and intracellular reaction, microinjection bypasses the uptake toxicity associated with facilitated transfer of foreign material into cultured cells. The direct injection of material into the nucleus or cytoplasm allows the number of treated cells to be monitored and expression efficiencies to be observed directly. Microinjection of a hundred cells grown on small glass coverslips and subsequently counted for expression of the foreign material determines expression efficiency as a percentage of cells injected. The efficiency is based on detection of the foreign inserted gene product and does not control for relative promoter efficiency between constructs. The purpose is not to compare two constructs to each other but to monitor dual expression. The creation of marker fluorescent proteins, such as the green fluorescent protein (GFP) in the same expression plasmid with a test gene allows the immediate observation of the GFP injected cells and within the same cells the positive or negative expression of the test gene. Expression of a foreign gene, such as SV40 T antigen cloned into an expression vector can be detected four hours after microinjection of the DNA. Fusing GFP into the same expression region of the T coding sequence labels T-GFP as a fusion protein with characteristic T immunological staining nuclear patterns but allows the cells to be studied without fixation through sequential periods of observation. The direct nature of microinjection allows comparison of gene expression in a variety of cells and the determination of the number of cells expressing the exogenous material in relationship to the number of cells injected.

Animals↗

High efficiency transduction of human VEGF165 into human skeletal myoblasts: in vitro studies.

We report the transduction of human VEGF165 gene into human myoblast and characterization of the transduced myoblasts for transduction and expression efficiency. Human myoblasts were assessed by immunostaining for desmin expression. A replication incompetent adenoviral vector carrying human VEGF165 was constructed and used for transduction of myoblasts. Immunostaining of transduced myoblasts was used to determine transduction efficiency. Expression efficiency was confirmed by immunoblotting, ELISA and reverse transcription (RT)-PCR analysis using human VEGF165 specific primers (5'-3' = 5'ATGAACTTTCTGCTGTCTTGGGTG and 3'-5' = ACACCGCCTCGGCTTGTCACA3'. Biological activity of the secreted VEGF165 was determined by human umbilical vein endothelial cell proliferation and [H3] thymidine incorporation assays. Human myoblast preparation was >95% pure with 99% viability after transduction. Immunostaining showed >95% VEGF(165) positive myoblasts. Western blotting and ELISA revealed high VEGF165 expression in the transduced myoblasts. Maximum transduction efficiency was achieved by 8 h exposure of myoblasts to virus at 1:1,000 ratio on three consecutive days. Concentration of VEGF165 released in the culture medium peaked (37 +/- 3 ng/ml) at 8 days post-transduction. Cell proliferation assay on human umbilical vein endothelial cells using supernatant from VEGF165 transduced myoblasts revealed extensive proliferation of cells which was suppressed in the presence of anti-human VEGF165 antibody in culture medium and was further confirmed by thymidine incorporation assay. The untransduced myoblasts secreted VEGF165 in vitro (300 +/- 50 pg/ml) that is enhanced many folds (37 +/- 3 ng/ml) in VEGF165 transduced myoblast as determined by ELISA. These studies suggest that human myoblast are potential carriers of human VEGF165 to achieve concurrent angiomyogenesis for cardiac repair.

Adenoviridae↗

Myocardial injection of CA promoter-based plasmid mediates efficient transgene expression in rat heart.

BACKGROUND: Although naked plasmid injection is the safest and most convenient method for gene delivery, a major limitation of this approach is currently poor transgene expression. The CA promoter (chicken beta-actin promoter with cytomegalovirus, CMV, enhancer) is one of the strongest transcriptional control modules found; however, it is uncertain whether a CA promoter-based vector is efficient enough for naked gene therapy in a cardiovascular context. METHODS: The beta-galactosidase (LacZ) expression provided by CA promoter plasmid (pCAZ2) injection into the skeletal muscle or the heart of Lewis rats was compared with CMV promoter plasmid or adenoviral vector (AxCAZ3). The effect of Simian virus 40 of the replication origin (SV40ori) deletion from pCAZ2 on transgene expression was also evaluated. RESULTS: pCAZ2 showed the highest LacZ expression in both skeletal muscle and heart in comparison with the CMV promoter-based vector 5 days after naked plasmid injection. LacZ expression in the heart obtained using 20 micro g of pCAZ2 was almost equivalent to that shown with AxCAZ3 at 6.0 x 10(9) optical particle units. The time course of transgene expression driven by CMV and CA promoters in the heart were similar, with the CA promoter providing significantly higher gene expression than the CMV promoter across all time points examined. SV40ori deletion from pCAZ2 did not affect transgene expression in either skeletal muscle or heart. CONCLUSIONS: Transgene expression mediated by naked CA promoter-based plasmid injection was shown to be quite efficient in the heart. We propose that the CA promoter vector is suitable for myocardial gene therapy.

Actins↗

Catalytic efficiency of expressed aromatase following site-directed mutagenesis.

Mutant aromatase cytochrome P-450s, expressed in CHO cells after transfection with cDNAs, have been characterized in terms of their catalytic efficiencies. After solubilization from microsomes, specific aromatase P-450 content of wild-type and mutants Pro308Phe, Asp309Asn, Asp309Ala and Phe406Arg was quantitated by a sandwich enzyme-linked immunosorbent assay (ELISA). Microsomal aromatase activity was determined by the 3H-water method using [1 beta-3H]androstenedione as substrate. Estimations of the actual turnover rate (catalytic efficiency) were derived from the combined data. The P-450 content in the mutants varied but was always less than that in the wild type. Hence, the decreases in the Vmax observed in the mutant enzymes did not correlate completely with reductions in catalytic effectiveness. In recent studies on the structure-function relationship of aromatase cytochrome P-450, the observed reduction of enzyme activity in terms of Vmax following site-directed mutagenesis led to the assumption that there was a corresponding loss of catalytic effectiveness. The present study reveals that a lower P-450 content can contribute significantly to decreasing catalytic activity in the mutants. In fact, in mutant Phe406Arg which exhibited virtually no catalytically active aromatase, the specific P-450 content was below the detectable level. Because of its location, the result of this latter mutation could be a major structural perturbation of the heme-binding property. Thus, interpretation of losses and reductions in aromatase activity resulting from single amino-acid replacement should take into account changes in the specific content of aromatase cytochrome P-450.

Androstenedione↗

Specific down-regulation of HER-2/neu mediated by a chimeric U6 hammerhead ribozyme results in growth inhibition of human ovarian carcinoma.

The U6 expression system was explored for efficient expression of a ribozyme against the human proto-oncogene c-neu. A hammerhead ribozyme (neuRz) and the control mutant ribozyme (MRz) were targeted to cleave c-neu mRNA at the tyrosine kinase domain. In vitro cleavage showed that neuRz was very active while MRz was not. Near-maximal target cleavage observed at a low ribozyme:target ratio (0.1) suggests that neuRz has good activity and turnover capability under physiological conditions, i.e., <5 mM MgCl(2) and 37 degrees C. Chimeric U6 ribozyme was expressed at about 5 x 10(6) copies/cell at 48 h in the ovarian carcinoma cell line SKOV-3.ip1. Partial down-regulation of c-neu mRNA and protein was observed in a dose-dependent manner in cells transiently transfected with U6neuRz- but not with MRz-containing plasmid. Sorted transient transfectants demonstrated dramatic growth inhibition with the neuRz-expressing cells. Our results demonstrate that the U6 expression system is very efficient and suitable for the expression of a hammerhead ribozyme. Moreover, nonviral delivery of the neuRz-expressing plasmid resulted in specific down-regulation of c-neu and, subsequently, growth inhibition of ovarian cancer cells overexpressing c-neu.

Blotting, Northern↗

Construction of a broad host range shuttle vector for gene cloning and expression in Actinobacillus pleuropneumoniae and other Pasteurellaceae.

We have constructed a pair of broad host range expression vectors, pJFF224-NX and pJFF224-XN, based on plasmid RSF1010, which enable cloning and efficient expression of genes in Actinobacillus pleuropneumoniae and Pasteurella haemolytica and in Escherichia coli. The vectors consist of the minimal autonomous replicon of the broad host range plasmid RSF1010 and a type II chloramphenicol acetyl transferase gene for chloramphenicol resistance selection. In addition, they contain a gene expression cassette based on the E. coli bacteriophage T4 gene 32 promoter region and a transcription stop signal, which are separated by a segment of multiple cloning sites in both orientations. Electroporation and subsequent selection for chloramphenicol resistance was used for the introduction of the vectors in A. pleuropneumoniae and P. haemolytica. A promoterless xy/E gene from the Pseudomonas putida TOL plasmid was cloned onto pJFF224-NX. This plasmid enabled efficient expression of active catechol2,3oxygenase in A. pleuropneumoniae and P. haemolytica. It was stably maintained in A. pleuropneumoniae without antibiotic selection, showing less than 0.1% loss after 100 generations, while native RSF1010 and other RSF1010-based vectors were unstable in this host.

Actinobacillus pleuropneumoniae↗

[Cloning and expression of truncated Midkine cytokine from gastric carcinogenesis tissue in E. coli].

OBJECTIVE: To clone the truncated Midkine from gastric carcinogenesis tissue and express in Escherichia coli. METHODS: A pair of PCR specific primers were designed according to the reported human tMK cDNA sequence in Genbank. The target DNA fragment was obtained by RT-PCR from gastric carcinoma patient's carcinogenesis tissue and cloned into pMD 18 T-vector. After sequencing, the tMK nucleotide fragment was inserted into an E. coli expression vector pBV222. The recombinant plasmid was transferred into E. coli DH5alpha and an E. coli DH5alpha expressed recombinant tMK protein, DH5alpha/pBV222-tMK, was obtained. DH5alpha/pBV222-tMK was cultured and induced with 42 degrees C. RESULTS: Truncated Midkine was cloned from gastric carcinogenesis tissue and the efficiently expressed recombinant tMK protein was obtained. SDS-PAGE indicated the molecular weight of recombinant tMK protein accorded with anticipation. CONCLUSION: The tMK was expressed in gastric carcinoma of Chinese patients' carcinogenesis tissue. The efficient expression of tMK protein was actualized in E. coli by clone and recombination.

Adenocarcinoma↗

Structural studies of alpha-N-acetylgalactosaminidase: effect of glycosylation on the level of expression, secretion efficiency, and enzyme activity.

alpha-N-Acetylgalactosaminidase (alphaNAGAL, EC 3.2.1.49) is an exoglycosidase specific for the hydrolysis of terminal alpha-linked N-acetylgalactosamine from oligosaccharide chains. After cloning of its cDNA, the recombinant alphaNAGAL (ralphaNAGAL) was produced in Pichia pastoris, a methylotrophic yeast strain. The enzyme was hyperglycosylated by the host cells, resulting in a protein with a molecular mass of approximately 50 kDa, which was 7 kDa larger than that of its native counterpart. When deglycosylated with endoglycosidase H under nondenaturing conditions, ralphaNAGAL remained fully active, suggesting that the glycosylation is not required for enzyme activity. Data derived from mass spectrometry indicated that all three putative N-glycosylation sites [Asn residues at positions 161 (N1), 185 (N2), and 369 (N3)] in the enzyme were glycosylated, and a high-mannose structure, which was possibly phosphorylated, was attached to the sites N1 and N2. In order to examine the effect of individual N-linked oligosaccharide chains on the expression of ralphaNAGAL in P. pastoris, we mutated each of the N-glycosylation sites, as well as all three sites in the same protein molecule, by substituting the Asn with a Gln residue. The results indicate that ralphaNAGAL mutations in any of the three glycosylation sites, N2 being the most profound, impaired the expression level, altered subcellular distribution, and decreased the efficiency of secretion. Our data suggest that the N-glycosylation of ralphaNAGAL expressed in P. pastoris may be important in protein folding and resistance to protease degradation during protein synthesis, although it is apparently not required for enzyme activity.

Animals↗

Construction of a new family of high efficiency bacterial expression vectors: identification of cDNA clones coding for human liver proteins.

Construction of a family of bacterial expression vectors, pEX1-3, is described. These vectors are derived from a cro-lacZ gene fusion plasmid which expresses large quantities of fusion protein under the control of the PR promoter of bacteriophage lambda. A polylinker has been engineered into the 3' end of the lacZ gene in all three translational reading frames, and stop signals for transcription and translation inserted, so that any open reading frame DNA may be expressed as a hybrid beta-galactosidase protein. cDNA fragments cloned in these vectors can be detected with an efficiency of greater than 1 in 3, thus enabling the detection of rare cDNA molecules. In addition, the low solubility of hybrid proteins leads to a rapid isolation procedure allowing antibodies of pre-determined specificity to be made against expressed regions of cloned DNA. We describe the cloning of albumin and complement C9 genes from a human cDNA library using polyclonal and monoclonal antibodies.

Bacteriophage lambda↗

Efficient synthesis of enzymatically active calf chymosin in Saccharomyces cerevisiae.

We have constructed a high-efficiency expression vector to direct the synthesis of heterologous polypeptides in yeast. The vector is termed a sandwich expression vector as the heterologous gene is inserted between the 5' and 3' control regions of the efficiently expressed yeast PGK gene. We have used this vector to direct the expression of three derivatives of the calf chymosin cDNA gene; preprochymosin, prochymosin and chymosin. Prochymosin is synthesised to at least 5% of total yeast-cell protein and furthermore, it can be readily activated to produce an enzyme which has milk-clotting activity.

Animals↗

A proinsulin gene splice variant with increased translation efficiency is expressed in human pancreatic islets.

As glucose-induced insulin expression is mainly regulated at the translational level, and such regulation often involves the 5'-untranslated region (5'UTR), we examined the human proinsulin gene 5'UTR. RT-PCR and sequencing demonstrated that a proinsulin splice variant (SPV) generated from a cryptic 5'-splice site and retaining the first 26 bp of intron 1 was present in human pancreatic islets from normal donors. The expression of this SPV was metabolically regulated, as shown by quantitative real-time RT-PCR, revealing a more than 10-fold increase in the SPV in isolated human islets incubated at 16.7 mM compared with 1.67 mM glucose. In vitro wheat-germ translation and in vivom transfection studies demonstrated that the altered 5'UTR of the SPV increased translation. The SPV yielded 4-fold more in vitro translated preproinsulin protein than the native proinsulin mRNA, and the SPV 5'UTR inserted upstream from a luciferase reporter gene resulted in a more than 6-fold higher luciferase activity, suggesting enhanced translation in vivo. Retention of the 26 bp changed the proposed secondary RNA structure of the SPV, which may facilitate ribosomal binding and explain the increase in translation efficiency. These results suggest a novel mechanism by which metabolic changes can modulate the expression of 5'UTR SPVs and thereby regulate translation efficiency.

5' Untranslated Regions↗

Cloning of a LEU gene and an ARS site of Rhodotorula glutinis.

Genomic library of DNA from an extracellular protease-producing yeast strain, Rhodotorula glutinis K-24, was constructed, using Escherichia coli plasmid vector PBR322. A LEU gene from R. glutinis was cloned, and found to complement leu- mutations in E. coli and Saccharomyces cerevisiae. In E. coli, the LEU gene in the cloned yeast DNA fragment was efficiently expressed when inserted into the vector in one orientation. In S. cerevisiae, the R. glutinis LEU gene was efficiently expressed when inserted into a shuttle vector YEP13 in both orientations, suggesting that the isolated R. glutinis DNA fragment contains a promotor sequence of R. glutinis in front of the LEU gene. In addition, our data suggests that the cloned LEU fragment also contains an ARS (autonomously replication sequence) site of R. glutinis that could function in S. cerevisiae.

Blotting, Southern↗

Cytotoxic immune response blunts long-term transgene expression after efficient retroviral-mediated hepatic gene transfer in rat.

Vectors derived from oncoretroviruses can transduce a small proportion of hepatocytes when injected in the regenerating liver. Transgene expression may be sustained for months without immune response. In striking contrast, we observed a rapid extinction when the intravenous injection of a high input of nuclear beta-galactosidase (beta-gal) expression vector, one day after partial hepatectomy, led to a significant proportion of transduced cells in the liver. Extinction was associated with liver inflammation on tissue sections and appearance of antibodies against the transgene product, while vector genomes became undetectable in liver tissue by PCR. These observations suggested the elimination of transduced cells by an immune response. Transgenic rats tolerant for cytoplasmic beta-gal, or normal rats depleted in CD8 T lymphocytes, steadily expressed the beta-gal vector. In the spleen of normal rats, we detected cytotoxic cells directed against cells expressing beta-gal after the injection of the beta-gal vector. In jaundiced Gunn rats deficient in bilirubin glucuronosyl transferase (BGT1) and treated with a human BGT1 cDNA expression vector, we observed the same kinetics of extinction as well as the appearance of anti-BGT1 antibodies. This study demonstrates that retrovirus-mediated gene transfer may induce cytotoxic T lymphocytes specifically directed against transgene-expressing cells.

Animals↗

Expression and efficient export of enzymatically active Mycobacterium tuberculosis glutamine synthetase in Mycobacterium smegmatis and evidence that the information for export is contained within the protein.

We have investigated the expression and extracellular release of active, recombinant Mycobacterium tuberculosis glutamine synthetase (EC 6.3.1.2), an enzyme that is a potentially important determinant of M. tuberculosis infection and whose extracellular release is correlated with pathogenicity. The M. tuberculosis glutamine synthetase gene encodes a polypeptide of 478 amino acids; 12 such subunits comprise the active enzyme. Northern blot, nuclease S1, and primer extension analyses revealed glutamine synthetase specific transcripts of approximately 1,550 and 1,650 nucleotides produced under low and high nitrogen conditions, respectively. Expression of recombinant M. tuberculosis glutamine synthetase in Escherichia coli YMC21E, a glutamine synthetase deletion mutant, led to transcomplementation of the mutant but not to release of active enzyme. Expression in Mycobacterium smegmatis 1-2c, from the gene's own promoter, resulted in the release of >95% of all recombinant enzyme. No hybrid molecules containing M. tuberculosis and M. smegmatis glutamine synthetase subunits were detected. Native and recombinant exported and intracellular glutamine synthetase molecules were indistinguishable from one another by mass, N-terminal amino acid sequence, antibody reactivity, and enzymatic activity. Since M. tuberculosis glutamine synthetase is similar to other, strictly intracellular, bacterial glutamine synthetases and the DNA sequence upstream of the structural gene does not encode a leader peptide, the information to target the protein for export must be contained in its amino acid sequence and/or conformation.

Amino Acid Sequence↗