Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Genomic sequencing”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 361 records · Page 20Linked to original sources
PubMed2001

Complete genomic sequence of Pasteurella multocida, Pm70.

We present here the complete genome sequence of a common avian clone of Pasteurella multocida, Pm70. The genome of Pm70 is a single circular chromosome 2,257,487 base pairs in length and contains 2,014 predicted coding regions, 6 ribosomal RNA operons, and 57 tRNAs. Genome-scale evolutionary analyses based on pairwise comparisons of 1,197 orthologous sequences between P. multocida, Haemophilus influenzae, and Escherichia coli suggest that P. multocida and H. influenzae diverged approximately 270 million years ago and the gamma subdivision of the proteobacteria radiated about 680 million years ago. Two previously undescribed open reading frames, accounting for approximately 1% of the genome, encode large proteins with homology to the virulence-associated filamentous hemagglutinin of Bordetella pertussis. Consistent with the critical role of iron in the survival of many microbial pathogens, in silico and whole-genome microarray analyses identified more than 50 Pm70 genes with a potential role in iron acquisition and metabolism. Overall, the complete genomic sequence and preliminary functional analyses provide a foundation for future research into the mechanisms of pathogenesis and host specificity of this important multispecies pathogen.

Base Sequence↗
PubMed2026

Genetic diversity and drug resistance profiles of Mycobacterium tuberculosis among Ethiopian children as determined by whole-genome sequencing.

UNLABELLED: Ethiopia ranks 30th among the tuberculosis (TB) burden countries, with children representing a significant yet understudied population group. This study aims to investigate the genetic diversity and drug-resistant profile among Ethiopian children. We included children under 15 years of age diagnosed with culture-confirmed pulmonary TB/drug-resistant TB between January 2017 and June 2023. Phenotypic drug susceptibility testing and whole-genome sequencing were conducted for 85 Mycobacterium tuberculosis (MTB) isolates. Demographic data were combined with genomic information. Lineage 4 was the most dominant (77.6%), while lineage 2 was less common (1%). Within lineage 4, several sub-lineages were identified, with lineage 4.2.2.2 being notably the most predominant (48%). Most of these cases were from Oromia (58%), including the hotspot areas for lineage 4 that were identified at a 99% confidence level. Among 17 MDR/pre-XDR-TB isolates, lineages 3 and 4.2.2.2 were the dominantly observed lineages/sub-lineages, with proportions of 29% and 65%, respectively. Of the 85 cases, 30.5% were drug-resistant TB to at least one of the five first-line anti-TB drugs tested by phenotypic drug susceptibility testing. Of these 26 drug-resistant TB cases, 23 were concordant with whole-genome sequencing characterization. The most frequent resistance mutations to rifampicin were found in the rpoB gene, specifically p.Ser450Leu (88%), followed by isoniazid in the katG gene, p.Ser315Thr (86%). Multidrug-resistant TB was strongly associated with MTB lineages (P = 0.007). This study identified high genetic diversity of M. tuberculosis and related drug-resistance mutations, with a strong concordance between whole-genome sequencing-based predictions and phenotypic drug susceptibility testing. IMPORTANCE: Our findings revealed a high genetic diversity of Mycobacterium tuberculosis among Ethiopian children, with the most common lineage being lineage 4, specifically lineage 4.2.2.2, in which a higher frequency of multidrug-resistant tuberculosis (TB) was observed. Additionally, we identified regional hotspots, suggesting ongoing community transmission. Moreover, whole-genome sequencing demonstrated high concordance with phenotypic drug susceptibility testing and identified mutation genes associated with first- and second-line anti-TB drugs, highlighting its usefulness in providing comprehensive results for resistance detection in children. Thus, it is essential for integrating genomic surveillance into childhood TB and drug resistance control.

Humans↗
PubMed2001

Structural organization, complete genomic sequences and mutational analyses of the Fukuyama-type congenital muscular dystrophy gene, fukutin.

Fukuyama-type congenital muscular dystrophy (FCMD) is an autosomal recessive severe muscular dystrophy in combination with cerebral cortical dysplasia. Previously, we identified the gene responsible for FCMD, termed fukutin, through positional cloning. In this study, we have sequenced 131892 bp of genomic DNA in the region of the fukutin gene on chromosome 9q31 and obtained its complete genomic structure. The fukutin genomic sequence spans approximately 100 kb and is organized into 10 exons (41-6067 bp) and nine introns (1841-21460 bp). Using these sequence data, we have identified three novel fukutin mutations in FCMD patients. We have also located a putative TATA box in the flanking 5' region and identified numerous alternatively spliced fukutin mRNA transcripts. Analysis of expressed sequence tag clusters within the region revealed two novel genes upstream of the fukutin gene. These data provide fundamental information to support detailed genetic and functional analyses of the fukutin gene.

Alternative Splicing↗
PubMed1996

GenomeInspector: a new approach to detect correlation patterns of elements on genomic sequences.

MOTIVATION: Most of the sequences determined in current genome sequencing projects remain at least partially unannotated. The available software for DNA sequence analysis is usually limited to the prediction of individual elements (level 1 methods), but does not assess the context of different motifs. However, the functionality of biological units like promoters depends on the correct spatial organization of multiple individual elements. RESULTS: Here, we present a second-level software package called GenomeInspector [[http:@www.gsf.de/biodv/genomeinspector.html ]], for further analysis of results obtained with level 1 methods (e.g. MatInspector [[http:@www.gsf.de/biodv/matinspector.html ]] or ConsInspector [[http:@www.gsf.de/biodv/consinspector.html++ +]]). One of the main features of this modular program is its ability to assess distance correlations between large sets of sequence elements which can be used for the identification and definition of basic patterns of functional units. The program provides an easy-to-use graphical user interface with direct comprehensive display of all results for megabase sequences. Sequence elements showing spatial correlations can be easily extracted and traced back to the nucleotide sequence with the program. GenomeInspector identified promoters of glycolytic enzymes in yeast [[http:@www.mips.biochem.mpg.de/mips/yeast/]] as members of a subgroup with unusual location of an ABF1 site. Solely on the basis of distance correlation analysis, the program correctly selected those transcription factors within these promoters already known to be involved in the regulation of glycolytic enzymes, demonstrating the power of this method.

Algorithms↗
PubMed2004

Complete genome sequence of Rickettsia typhi and comparison with sequences of other rickettsiae.

Rickettsia typhi, the causative agent of murine typhus, is an obligate intracellular bacterium with a life cycle involving both vertebrate and invertebrate hosts. Here we present the complete genome sequence of R. typhi (1,111,496 bp) and compare it to the two published rickettsial genome sequences: R. prowazekii and R. conorii. We identified 877 genes in R. typhi encoding 3 rRNAs, 33 tRNAs, 3 noncoding RNAs, and 838 proteins, 3 of which are frameshifts. In addition, we discovered more than 40 pseudogenes, including the entire cytochrome c oxidase system. The three rickettsial genomes share 775 genes: 23 are found only in R. prowazekii and R. typhi, 15 are found only in R. conorii and R. typhi, and 24 are unique to R. typhi. Although most of the genes are colinear, there is a 35-kb inversion in gene order, which is close to the replication terminus, in R. typhi, compared to R. prowazekii and R. conorii. In addition, we found a 124-kb R. typhi-specific inversion, starting 19 kb from the origin of replication, compared to R. prowazekii and R. conorii. Inversions in this region are also seen in the unpublished genome sequences of R. sibirica and R. rickettsii, indicating that this region is a hot spot for rearrangements. Genome comparisons also revealed a 12-kb insertion in the R. prowazekii genome, relative to R. typhi and R. conorii, which appears to have occurred after the typhus (R. prowazekii and R. typhi) and spotted fever (R. conorii) groups diverged. The three-way comparison allowed further in silico analysis of the SpoT split genes, leading us to propose that the stringent response system is still functional in these rickettsiae.

Chromosome Inversion↗
PubMed2003

The $1000 genome: ethical and legal issues in whole genome sequencing of individuals.

Progress in gene sequencing could make rapid whole genome sequencing of individuals affordable to millions of persons and useful for many purposes in a future era of genomic medicine. Using the idea of $1000 genome as a focus, this article reviews the main technical, ethical, and legal issues that must be resolved to make mass genotyping of individuals cost-effective and ethically effective. It presents the case for individual ownership of a person's genome and its formation, and shows the implications of that position for rights to informed consent and privacy over sequencing, testing, and disclosing genomic information about identifiable individuals. Legal recognition of a person's right to control his or her genome and the information that it contains is essential for further progress in applying genomic discoveries to human lives.

Adult↗
PubMed2004

3D-GENOMICS: a database to compare structural and functional annotations of proteins between sequenced genomes.

The 3D-GENOMICS database (http://www.sbg.bio. ic.ac.uk/3dgenomics/) provides structural annotations for proteins from sequenced genomes. In August 2003 the database included data for 93 proteomes. The annotations stored in the database include homologous sequences from various sequence databases, domains from SCOP and Pfam, patterns from Prosite and other predicted sequence features such as transmembrane regions and coiled coils. In addition to annotations at the sequence level, several precomputed cross- proteome comparative analyses are available based on SCOP domain superfamily composition. Annotations are available to the user via a web interface to the database. Multiple points of entry are available so that a user is able to: (i) directly access annotations for a single protein sequence via keywords or accession codes, (ii) examine a sequence of interest chosen from a summary of annotations for a particular proteome, or (iii) access precomputed frequency-based cross-proteome comparative analyses.

Amino Acid Sequence↗
PubMed2003

The genetic colinearity of rice and other cereals on the basis of genomic sequence analysis.

Small segments of rice genome sequence have been compared with that of the model plant Arabidopsis thaliana and with several closer relatives, including the cereals maize, rice, sorghum, barley and wheat. The rice genome is relatively stable relative to those of other grasses. Nevertheless, comparisons with other cereals have demonstrated that the DNA between cereal genes is highly variable and evolves rapidly. Genic regions have undergone many more small rearrangements than have been revealed by recombinational mapping studies. Tandem gene duplication/deletion is particularly common, but other types of deletions, inversions and translocations also occur. The many thousands of small genic rearrangements within the rice genome complicate but do not negate its use as a model for larger cereal genomes.

Chromosome Walking↗
PubMed2004

The CHAOS/DIALIGN WWW server for multiple alignment of genomic sequences.

Cross-species sequence comparison is a powerful approach to analyze functional sites in genomic sequences and many discoveries have been made based on genomic alignments. Herein, we present a WWW-based software system for multiple alignment of large genomic sequences. Our server utilizes the previously developed combination of CHAOS and DIALIGN to achieve both speed and alignment accuracy. CHAOS is a fast database search tool that creates a list of local sequence similarities. These are used by DIALIGN as anchor points to speed up the final alignment procedure. The resulting alignment is returned to the user in different formats together with a list of anchor points found by CHAOS. The CHAOS/DIALIGN software is freely available at http://dialign.gobics.de/chaos-dialign-submission.

Genomics↗
PubMed2006

A gene-based high-resolution comparative radiation hybrid map as a framework for genome sequence assembly of a bovine chromosome 6 region associated with QTL for growth, body composition, and milk performance traits.

BACKGROUND: A number of different quantitative trait loci (QTL) for various phenotypic traits, including milk production, functional, and conformation traits in dairy cattle as well as growth and body composition traits in meat cattle, have been mapped consistently in the middle region of bovine chromosome 6 (BTA6). Dense genetic and physical maps and, ultimately, a fully annotated genome sequence as well as their mutual connections are required to efficiently identify genes and gene variants responsible for genetic variation of phenotypic traits. A comprehensive high-resolution gene-rich map linking densely spaced bovine markers and genes to the annotated human genome sequence is required as a framework to facilitate this approach for the region on BTA6 carrying the QTL. RESULTS: Therefore, we constructed a high-resolution radiation hybrid (RH) map for the QTL containing chromosomal region of BTA6. This new RH map with a total of 234 loci including 115 genes and ESTs displays a substantial increase in loci density compared to existing physical BTA6 maps. Screening the available bovine genome sequence resources, a total of 73 loci could be assigned to sequence contigs, which were already identified as specific for BTA6. For 43 loci, corresponding sequence contigs, which were not yet placed on the bovine genome assembly, were identified. In addition, the improved potential of this high-resolution RH map for BTA6 with respect to comparative mapping was demonstrated. Mapping a large number of genes on BTA6 and cross-referencing them with map locations in corresponding syntenic multi-species chromosome segments (human, mouse, rat, dog, chicken) achieved a refined accurate alignment of conserved segments and evolutionary breakpoints across the species included. CONCLUSION: The gene-anchored high-resolution RH map (1 locus/300 kb) for the targeted region of BTA6 presented here will provide a valuable platform to guide high-quality assembling and annotation of the currently existing bovine genome sequence draft to establish the final architecture of BTA6. Hence, a sequence-based map will provide a key resource to facilitate prospective continued efforts for the selection and validation of relevant positional and functional candidates underlying QTL for milk production and growth-related traits mapped on BTA6 and on similar chromosomal regions from evolutionary closely related species like sheep and goat. Furthermore, the high-resolution sequence-referenced BTA6 map will enable precise identification of multi-species conserved chromosome segments and evolutionary breakpoints in mammalian phylogenetic studies.

Animals↗
PubMed2005

The complete plastid genome sequence of the haptophyte Emiliania huxleyi: a comparison to other plastid genomes.

The complete nucleotide sequence of the plastid genome of the haptophyte Emiliania huxleyi has been determined. E. huxleyi is the most abundant coccolithophorid and has a key role in the carbon cycle. It is also implicated in the production of dimethylsulphide (DMS), which is involved in cloud nucleation and may affect the global climate. Here, we report the plastid genome sequence of this ecologically and economically important species and compare its gene content and arrangement to other known plastid genomes. The genome is circular and consists of 105,309 bp with an inverted repeat of 4,841 bp. In terms of both genome size and gene content E. huxleyi cpDNA is substantially smaller than any other from the red plastid lineage. The genetic information is densely packed, with 86.8% of the genome specifying 110 identified protein-coding genes, 9 open reading frames, 28 different tRNAs, and 3 rRNAs. A detailed comparison to other plastid genomes, based on gene content, gene function, and gene cluster analysis is discussed. These analyses suggest a close relationship of the E. huxleyi cpDNA to the chlorophyll c-containing plastids from heterokonts and cryptophytes, and they support the origin of the chromophyte plastids from the red algal lineage.

Evolution, Molecular↗
PubMed2006

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome.

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

Chromosomes, Bacterial↗
PubMed2002

Genome sequence of the human malaria parasite Plasmodium falciparum.

The parasite Plasmodium falciparum is responsible for hundreds of millions of cases of malaria, and kills more than one million African children annually. Here we report an analysis of the genome sequence of P. falciparum clone 3D7. The 23-megabase nuclear genome consists of 14 chromosomes, encodes about 5,300 genes, and is the most (A + T)-rich genome sequenced to date. Genes involved in antigenic variation are concentrated in the subtelomeric regions of the chromosomes. Compared to the genomes of free-living eukaryotic microbes, the genome of this intracellular parasite encodes fewer enzymes and transporters, but a large proportion of genes are devoted to immune evasion and host-parasite interactions. Many nuclear-encoded proteins are targeted to the apicoplast, an organelle involved in fatty-acid and isoprenoid metabolism. The genome sequence provides the foundation for future studies of this organism, and is being exploited in the search for new drugs and vaccines to fight malaria.

Animals↗