Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “mtDNA content”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2Linked to original sources
PubMed2004

mtDNA/nDNA ratio in 14484 LHON mitochondrial mutation carriers.

Leber's hereditary optic neuropathy (LHON) is a maternally inherited disease caused by mitochondrial DNA (mtDNA) mutations. In this study, the mtDNA/nuclear DNA ratio was evaluated in 11 LHON patients with the 14484 mutation, 13 asymptomatic carriers and 18 non-carrier relatives as controls, to reveal possible relationships between the disease and mtDNA content. DNAs from peripheral blood lymphocytes were subjected to quantitative PCR. Gender differences and age-dependent changes in the mtDNA content were not observed. Significant increase in the mtDNA content was observed only in the asymptomatic carriers (P<0.05). This indicated that individuals whose mtDNA content had increased and been maintained at certain levels were free from LHON development, whereas those whose levels had not, had developed LHON. Since the asymptomatic carriers are the stock of the future LHON patients, monitoring the mtDNA content in patients and their relatives may help to predict the prognosis of the disease.

Adult↗
PubMed2001

Reduction and restoration of mitochondrial dna content after focal cerebral ischemia/reperfusion.

BACKGROUND AND PURPOSE: Oxidative damage of mitochondrial DNA (mtDNA) in the ischemic brain is expected after ischemia/reperfusion injury. A recent study demonstrated limited patterns of mtDNA deletion in the brain after ischemia/reperfusion. We studied the ischemia/reperfusion-induced global changes of mtDNA integrity and its restoration in a rat model of transient focal ischemia in vivo. METHODS: Changes in mtDNA content in the ischemic brain were assessed with the use of a rat stroke model featuring transient severe ischemia confined to the cerebral cortex of the right middle cerebral artery territory for 30 or 90 minutes. A new long polymerase chain reaction method, using mouse DNA as an internal standard, was applied to measure the relative content of intact rat mtDNA. Southern hybridization following alkaline gel electrophoresis was conducted in a parallel study to confirm long polymerase chain reaction results. RESULTS: A reduction in mtDNA content was found after ischemia for 30 and 90 minutes. The mtDNA was restored to near nonischemic levels 24 hours after 30- but not 90-minute ischemia. CONCLUSIONS: These results confirm that ischemia/reperfusion causes mtDNA damages. Restoration of the mtDNA content to nonischemic levels after 30-minute ischemia raises the possibility that mtDNA repair or repletion occurs after brief ischemia.

Animals↗
PubMed2001

Peripheral blood mitochondrial DNA content is related to insulin sensitivity in offspring of type 2 diabetic patients.

OBJECTIVE: To investigate whether the peripheral blood mtDNA (pb-mtDNA) content is decreased and linked to insulin resistance in the offspring of type 2 diabetic patients. RESEARCH DESIGN AND METHODS: A total of 82 offspring of type 2 diabetic patients and 52 age-, sex-, and BMI-matched normal subjects from the Mokdong, Korea, population were selected for this study by stratified, randomized sampling. Of the offspring of diabetic patients, 52 had normal glucose tolerance (NGT), 21 had impaired glucose tolerance (IGT), and 9 had newly diagnosed type 2 diabetes. The pb-mtDNA content was measured by real-time polymerase chain reaction with a mitochondria-specific fluorescent probe, normalized by a nuclear DNA, 285 rRNA gene. The associations between pb-mtDNA content and several parameters of insulin resistance were studied. RESULTS: The pb-mtDNA contents tended to be lower in the 82 offspring of type 2 diabetic patients (1,084.7 +/- 62.6 vs. 1,304.0 +/- 99.2 in the offspring and control subjects, respectively, P = 0.051) and was significantly lower in the combined NGT and IGT offspring group (NGT+IGT, 1,068.0 +/- 67.8, P < 0.05) than in the control subjects. In NGT+IGT offspring, the pb-mtDNA content was significantly correlated with logarithmically transformed insulin sensitivity (r = 0.253, P < 0.05) and was the main predictor of insulin sensitivity. CONCLUSIONS: Quantitative mtDNA status might be a hereditary factor associated with type 2 diabetes and could serve as an indicator for insulin sensitivity.

Adipose Tissue↗
PubMed2003

Quantitation of blood lymphocyte mitochondrial DNA for the monitoring of antiretroviral drug-induced mitochondrial DNA depletion.

OBJECTIVE: To investigate the impact of antiretroviral treatment on the mitochondrial DNA (mtDNA) content of peripheral blood mononuclear cells (PBMCs) from HIV-1-infected patients. DESIGN: As absolute mtDNA copy numbers widely differ between individuals, we performed a longitudinal analysis where the patient's first historical specimen was obtained as a baseline reference for relative comparison with subsequent samples from that patient. METHODS: mtDNA and nuclear DNA quantitation per cell (beta-globin gene copies) were both measured by real-time polymerase chain reaction analysis of whole DNA extracts of 361 serial live-cryopreserved PBMCs collected in former trials and clinical follow-ups from 60 individuals with established or recently acquired HIV-1 infections before and during administration of various antiviral combination therapies. RESULTS: mtDNA amounts were stable or increasing over years of natural HIV-1 infection in untreated patients (n = 7), consistent with our finding of a lack of differences in mtDNA copy numbers in patients with either a long established or recent lentivirus infection. Our quantitation system revealed significant changes in mtDNA copy number depending on the designated triple, quadruple, or quintuple anti-HIV drug combinations. Zidovudine + zalcitabine + ritonavir and zidovudine + lamivudine + didanosine regularly lead to mtDNA depletion in each of the treated patients, whereas none of 7 patients (and 35 cell specimens) receiving a stavudine + lamivudine + indinavir combination had any significant mtDNA content variations. In 7 patients, mtDNA copy numbers returned to pretreatment levels and/or higher levels without any interruption of the previously mtDNA-depleting antiretroviral drug combination. CONCLUSION: Our assay system allowed the detection of significant changes in the mtDNA content of PBMCs from HIV-1-infected patients taking antiretroviral drugs, as has been reported in the literature with other detection systems. Yet, mtDNA copy numbers regularly diminished during administration of some but not all nucleoside analog-containing combinations. This, plus the occasional finding that depleted mtDNA contents spontaneously increased to baseline levels and/or higher levels during uninterrupted treatment, should raise a note of caution about resorting to the PBMC mtDNA marker for monitoring of antiretroviral drug-related mitochondrial toxicities.

Acquired Immunodeficiency Syndrome↗
PubMed2005

Simultaneous detection and quantification of mitochondrial DNA deletion(s), depletion, and over-replication in patients with mitochondrial disease.

Heterogeneous clinical expression of mitochondrial DNA (mtDNA) disorders depends on both qualitative and quantitative changes in mtDNA. We developed a sensitive and effective method that simultaneously detects mtDNA deletion(s) and quantifies total mtDNA content. The percentage of deletions and mtDNA content of 19 patients with single or multiple deletions were analyzed by real-time quantitative polymerase chain reaction (real-time qPCR) using TaqMan probes specific for mtDNA (tRNA leu(UUR), ND4, ATPase8, and D-loop regions) and nuclear DNA (AIB1, beta-2-microglobulin, and beta-actin). The proportion of deletion mutants determined by real-time qPCR was consistent with that determined by Southern analysis. Most patients with mtDNA deletions also demonstrated compensatory mtDNA over-replication. Multiple mtDNA deletions that were not detectable by Southern analysis due to low percentage of each deletion molecule were readily detected and quantified by real-time qPCR. Furthermore, 12 patients with clinical features and abnormal biochemical/histopathological results consistent with mitochondrial respiratory chain disorders without identified mtDNA mutations had either substantially depleted or significantly over-replicated mtDNA content, supporting the diagnosis of mitochondrial disease. Our results demonstrate that both qualitative and quantitative analyses are important in molecular diagnosis of mitochondrial diseases. The presence of deletion(s) and mtDNA depletion or compensatory over-replication can be determined simultaneously by real-time qPCR.

Adolescent↗
PubMed1999

Relationships between muscle mitochondrial DNA content, mitochondrial enzyme activity and oxidative capacity in man: alterations with disease.

Muscle mitochondrial content is tightly regulated, and requires the expression of both nuclear and mitochondrial genes. In addition, muscle mitochondrial content is a major determinant of aerobic exercise capacity in healthy subjects. The current study was designed to test the hypothesis that in healthy humans, muscle mitochondrial DNA (mtDNA) content is correlated with citrate synthase activity (a representative nuclear-encoded mitochondrial enzyme) and aerobic exercise capacity as defined by whole-body peak oxygen consumption (VO2). Furthermore, it was postulated that these relationships might be altered with disease. Twelve healthy and five paraplegic subjects underwent exercise testing and vastus lateralis muscle biopsy sampling. An additional ten healthy subjects and eight patients with unilateral peripheral arterial disease (PAD) underwent exercise testing and gastrocnemius muscle biopsy sampling. Citrate synthase activity and mtDNA content were positively correlated in the vastus lateralis muscles from the healthy subjects. This relationship was similar in muscle from paraplegic subjects. mtDNA content was positively correlated with peak VO2 in the healthy subjects and in the paraplegic subjects in whom peak VO2 had been elicited by functional electrical stimulation of the muscle. In contrast, the PAD subjects demonstrated higher mtDNA contents than would have been predicted based on their claudication-limited peak VO2. Thus, in healthy humans there are strong relationships between muscle mtDNA content and both muscle citrate synthase activity and peak VO2. These relationships are consistent with coordinant nuclear DNA and mtDNA expression, and with mitochondrial content being a determinant of aerobic exercise capacity. The relationships seen in healthy humans are quantitatively similar in paraplegic patients, but not in patients with PAD, a disease which is associated with a metabolic myopathy. The relationships between mtDNA content, mitochondrial enzyme activities and exercise capacity provide insight into the physiologic and pathophysiologic regulation of muscle mitochondrial expression.

Adolescent↗
PubMed2005

Tissue-specific mtDNA lesions and radical-associated mitochondrial dysfunction in human hearts exposed to doxorubicin.

Doxorubicin causes a chronic cardiomyopathy. Although the exact pathogenesis is unknown, recent animal data suggest that somatically acquired alterations of mitochondrial DNA (mtDNA) and concomitant mitochondrial dysfunction play an important role in its onset. In this study, skeletal and myocardial muscles were examined from human autopsies. Compared to controls (n = 8), doxorubicin-exposed hearts (n = 6) showed low absolute enzyme activity of mtDNA-encoded nicotinamide adenine dinucleotide hydrogen dehydrogenase (NADH DH, 79% residual activity, p = 0.03) and cytochrome c oxidase (COX, 59% residual activity, p < 0.001), but not of succinate dehydrogenase (SDH), which is encoded exclusively by nuclear DNA. NADH DH/SDH and COX/SDH ratios were 37% (p < 0.001) and 27% (p < 0.001) of controls. Expression of the mtDNA-encoded subunit II of COX was reduced (82%, p = 0.04), compared to its unchanged nucleus-encoded subunit IV. MtDNA-content was diminished (56%, p = 0.02), but the 'common' mtDNA-deletion was increased (9.2-fold, p = 0.004). Doxorubicin-exposed hearts harboured numerous additional mtDNA rearrangements lacking direct repeats. They contained elevated levels of malondialdehyde (MDA) (p = 0.006, compared to controls), which correlated inversely with the COX/SDH ratio (r = -0.45, p = 0.02) and the mtDNA-content (r = -0.75, p = 0.002), and correlated positively with the levels of the 'common' deletion (r = 0.80, p < 0.001). Doxorubicin-exposed hearts also contained the highest levels of superoxide (p < 0.001, compared to controls), which correlated negatively with the mtDNA-encoded respiratory chain activities, such as the COX/SDH ratio (r = -0.57, p = 0.02) and the NADH/SDH ratio (r = -0.52, p = 0.04), as well as with the mtDNA content (r = -0.69, p = 0.003), and correlated positively with the frequency of the 'common' deletion (r = 0.76, p < 0.001) and the MDA levels (r = 0.86, p < 0.001). Doxorubicin-exposed hearts contained electron-dense deposits within mitochondria. Hearts exposed to other anthracyclines (n = 6) or skeletal muscle (all groups) had no mitochondrial dysfunction. Doxorubicin, unlike other anthracyclines, augments lipid peroxidation, induces mtDNA mutations and decreases mtDNA content in human hearts. These lesions have an impact on mitochondrial function and could be of importance in the pathogenesis of clinical cardiomyopathy.

Adult↗
PubMed2004

Comprehensive molecular diagnosis of mitochondrial disorders: qualitative and quantitative approach.

Mitochondrial disorders can be caused by mutations in nuclear or mitochondrial encoded genes. Point mutations and large deletions in mitochondrial DNA (mtDNA) are responsible for a small portion of the molecular defects in the mitochondrial oxidative phosphorylation system. A significant number of molecular defects of respiratory chain disorders are probably due to mutations in nuclear genes. Molecular diagnosis of mitochondrial disorders has been difficult because of broad genetic and clinical heterogeneity. Mutational analysis of common point mutations of mtDNA such as A3243G, A8344G, and T8993G/C is routinely performed. However, many patients who clearly have clinical manifestations and muscle pathology consistent with oxidative phosphorylation deficiency do not have detectable common mtDNA point mutations. A more comprehensive mutation screening method, temporal temperature gradient gel electrophoresis, was used to scan for unknown mutations in the entire mitochondrial genome. Novel mutations have been discovered but only account for a small portion of patients with suspected mitochondrial RC disorders. Real-time quantitative PCR analysis was used to measure cellular mtDNA content. Abnormal levels of mtDNA were found in many patients with respiratory chain disorders. Molecular analysis revealed that mutations in the thymidine phosphorylase gene are not seen in young patients with severe mtDNA depletion who do not demonstrate clinical features of mitochondrial neurogastrointestinal encephalomyopathy. It was also noted that an increase in the size or number of mitochondria was not necessarily associated with an increase in mtDNA content. On the contrary, in some cases the mtDNA was depleted. Respiratory activity in patients with a defective mitochondrial genome due to either point mutations or deletions may be compensated by amplification of mtDNA. Therefore, a comprehensive molecular analysis of mitochondrial respiratory chain disorders should include qualitative identification of the mutation and quantitative measurement of both the degree of mutant heteroplasmy and the total amount of mtDNA.

DNA Mutational Analysis↗
PubMed2003

Increased mitochondrial DNA content in peripheral blood lymphocytes from HIV-infected patients with lipodystrophy.

We have evaluated mitochondrial (mt) DNA content in CD4 and CD8 peripheral blood lymphocytes (PBLs) from HIV-infected patients taking highly active antiretroviral therapy (HAART) who display different types of adipose tissue alterations. A cross-sectional study was performed in a total of 23 patients with lipodystrophy (LD): nine patients with fat accumulation, six patients with fat loss, eight patients with combined form, who were compared to 11 individuals infected by HIV without LD (HIV-positive) and 10 seronegative controls (CTRL). PBLs were obtained by standard methods, that is, gradient density centrifugation on Ficoll, and CD4 or CD8 cells were positively isolated by magnetic sorting to eliminate the contamination of platelets. mtDNA content was then measured by an original assay based upon real-time PCR. mtDNA content was significantly increased in CD4 T cells from patients with LD, while no differences were present between CD4 and CD8 cells from HIV-positive and CTRL individuals. Nor were any differences found when comparing LD or HIV-positive patients treated with stavudine or zidovudine, or taking D-drugs or non D-drugs. Patients with fat accumulation had significantly higher mtDNA content compared to HIV-positive and CTRL, this phenomenon regarding both CD4 and CD8 PBLs. Considering all HIV-positive patients (including LD), mtDNA content showed a significant, positive correlation with cholesterolaemia but not with triglyceridaemia and glycaemia. Relatively high mtDNA content in LD patients, as well as the correlation between mtDNA content and cholesterol in all HIV-positive subjects, suggest the involvement of mitochondria in such a pathology. However, further studies are needed to confirm these initial observations and ascertain whether the quantification of mtDNA in PBL is a useful and reliable marker to investigate and monitor HAART-related changes in fat distribution.

Adipose Tissue↗
PubMed2004

Changes of mitochondrial DNA content in the male offspring of protein-malnourished rats.

Nutritional deprivation of the fetus and infant is associated with susceptibility to the development of impaired glucose tolerance or type 2 diabetes in adult life. Quantitative changes in mitochondrial DNA (mtDNA) seem to be associated with type 2 diabetes, but the effect of protein malnutrition on mtDNA content is not known. This study investigated the effects of protein malnutrition in fetus and early life on mtDNA content and glucose-insulin metabolism in adult life. Male offspring of dams fed a low-protein (LP) diet (8% casein) during pregnancy and lactation were weaned onto either a control (18% casein) diet (recuperated group, R) or a LP diet, and they were compared with the control group (C). The mtDNA content in the liver was lower in the R and LP groups than in the C group at 5 weeks of age, but higher in the R and LP groups than in the C group at 15 weeks of age. The mtDNA content in skeletal muscle and pancreas was significantly lower in the R and LP groups than in the C group at 25 weeks of age. Fetal-malnourished rats showed decreased pancreatic beta-cell mass and reduced insulin secretory responses to glucose load, but no differences in glucose tolerance or insulin sensitivity. Our findings imply that protein malnutrition in utero causes changes in mtDNA content, impaired beta-cell development, and insulin secretion, which may contribute to the development of type 2 diabetes in later life.

Animals↗
PubMed2002

Evidence of nucleoside analogue reverse transcriptase inhibitor--associated genetic and structural defects of mitochondria in adipose tissue of HIV-infected patients.

To investigate if possible mitochondrial injury can be found in adipose tissue of nucleoside analogue reverse transcriptase inhibitor (NRTI)-treated patients, subcutaneous fat was taken from the buttocks of 24 HIV-positive patients and 8 HIV-negative controls. The content of mitochondrial DNA (mtDNA) was quantified using a Southern blot technique. Fat biopsies were examined by electron microscopy and screened by restriction fragment length polymorphism analysis for the presence of the nt 8344 and 3243 mtDNA point mutations. Age, sex, and body mass index did not differ between the HIV-negative controls, the HIV-positive patients currently treated with NRTIs (NRTI group, n = 19), and the HIV-positive patients without NRTIs (no-NRTI group, n = 5). The mean mtDNA content was 44% lower in the NRTI group compared with the no-NRTI group ( p =.01) but did not differ between the control group and the no-NRTI group. When the HIV-infected patients were stratified to a group with clinical signs of lipoatrophy at the biopsy site (LA group, n = 11) and a group without lipoatrophy (no-LA group, n = 13), the mean mtDNA content in the LA group was 39% lower than that in the no-LA group ( p =.02). No point mutations or deletions were observed. The adipocytes of patients with lipoatrophy contained multiple small lipid vacuoles, and the mitochondria harbored inclusions reminiscent of mtDNA cytopathies. mtDNA depletion and ultrastructural abnormalities of adipocytes suggest a link between mitochondrial damage, the use of NRTIs, and lipoatrophy in HIV-infected patients.

Adipose Tissue↗
PubMed2006

Tissue-specific effect of age and caloric restriction diet on mitochondrial DNA content.

The effect of age and caloric-restriction (CR) diet on mitochondrial DNA (mtDNA) content in different rat tissues was investigated. A decrease of the mtDNA content occurs with aging in liver and soleus muscle, whereas there is no age-related significant change of mtDNA content in brain. CR fully reverses the age-dependent loss of mtDNA in liver and soleus, whereas it results in a significant increase of mtDNA amount above the value of aged ad libitum fed rats in brain. These results further support the tissue-specific effect of CR, likely because of the different dependence of tissues on external nutrient uptake.

Age Factors↗
PubMed2005

Mitochondrial DNA depletion in liver tissue of patients infected with hepatitis C virus: contributing effect of HIV infection?

OBJECTIVES: It has been suggested that chronic hepatitis C virus (HCV) infection depletes mitochondrial DNA (mtDNA) in the liver. Because decreased mtDNA levels were also found in humans infected with HIV, we investigated whether HIV may have aggravated hepatic mtDNA depletion in individuals with HCV infection. METHODS: In this cross-sectional study, liver biopsies were performed in a total of 40 individuals prior to any antiviral therapy. The individuals were recruited from the Hospital Clinic, Barcelona and the HIV Centre, Dusseldorf. Seventeen patients were negative for HIV and HCV and were biopsied for liver enzyme elevation of unknown cause (controls), 14 individuals had chronic HCV but no HIV infection, and nine subjects were coinfected with both viruses. mtDNA and liver histology were centrally assessed. RESULTS: The groups did not differ with respect to age, gender, liver function tests and HCV viral load, where applicable. mtDNA levels were decreased by 19% in the HCV-monoinfected group (P=0.03) and by 27% in the HIV/HCV-coinfected subjects (P=0.02) compared to controls. The mtDNA content, however, did not differ between individuals with HCV monoinfection and HCV/HIV coinfection (P=0.75). The degrees of liver fibrosis, inflammatory activity or steatosis did not correlate with mtDNA content. CONCLUSIONS: Liver mtDNA content is reduced in both HCV-monoinfected and HIV/HCV-coinfected patients. Under the limitations of our study, we could demonstrate only a slight trend towards more pronounced mtDNA depletion in HIV/HCV-coinfected subjects.

Adult↗
PubMed2005

Changes in mitochondrial RNA production in cells treated with nucleoside analogues.

BACKGROUND: To investigate mitochondrial (mt) toxicity of antiretroviral drugs further, we developed a novel real-time PCR-based assay for the quantification of mtRNA. We analysed the effects of stavudine (d4T), didanosine (ddl) and zidovudine (AZT) on the production of mtRNAs in different human cell lines and compared the production with the amount of mtDNA present in the same cells. MATERIALS AND METHODS: HUT78, CEM and U937 cells were exposed to different nucleoside reverse transcriptase inhibitors (NRTIs) for 7 days. Thereafter, nucleic acids were isolated and Taqman-based real-time PCR was used to quantify mtDNA and three different mtRNAs (ND1, CYTB and ND6 gene products). RESULTS: Different amounts of mtRNAs exist in different cell lines. When mtRNA was measured in cells exposed to an NRTI, a marked decrease was observed in cells treated with d4T, but not with ddl or AZT. Changes in mtRNA production did not always correspond to modifications in mtDNA content: 1 microM d4T significantly changed mtRNA but not mtDNA content. CONCLUSIONS: d4T, but not ddl or AZT, significantly alters mtRNA quantity and quality. The method we have developed can reveal changes that are not observed by measuring mtDNA content only, and can be used for ex vivo studies on drug toxicity.

Antiviral Agents↗
PubMed2006

Longitudinal study on mitochondrial effects of didanosine-tenofovir combination.

Tenofovir disoproxil fumarate (TDF) has been reported to be free of adverse effects on mitochondria. We evaluate the effects of the introduction of TDF in a didanosine (ddI)-based highly active antiretroviral therapy (HAART) on mitochondrial DNA (mtDNA) content, mitochondrial mass (MM), and cytochrome c oxidase (COX) activity of the oxidative phosphorylation (OXPHOS) system over a 12-month period. Forty-four asymptomatic HIV patients with undetectable viral load receiving a ddI-based HAART were recruited and switched to ddI plus TDF (ddI + TDF) and nevirapine (n = 22) or maintained with the same baseline ddIbased HAART scheme (n = 22). Peripheral blood mononuclear cells were obtained at 0, 6, and 12 months. COX activity and MM were determined by spectrophotometry and the mtDNA content by quantitative realtime PCR. The mtDNA content showed a progressive decrease over the 12-month period of the study for the two groups with respect to baseline, with such a decrease statistically significant only in the ddI + TDF group (55% decrease, p < 0.001). In addition, the decrease of mtDNA content over time was statistically different between both groups (p < 0.001). Consistently, MM and COX activity decreased significantly at 12 months with respect to baseline only in the ddI < TDF group (28% decrease for MM, p < 0.05; 47% decrease for COX activity, p < 0.001). We conclude that switching to a HAART regimen containing ddI + TDF is associated with evolutive mitochondrial damage expressed as mtDNA depletion, loss of MM, and decrease in COX efficiency. The particular relevance of either ddI, TDF, or any interaction between them in such a mitochondrial dysfunction remains to be established.

Adenine↗
PubMed2004

Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease.

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.

Adult↗
PubMed2005

Increased mitochondrial DNA content in saliva associated with head and neck cancer.

Alterations of the mitochondrial DNA (mtDNA) have been described in human tumors and in other tissues in association with smoking exposure. We did quantitative PCR of cytochrome c oxidase I (Cox I) and cytochrome c oxidase II (Cox II) genes on oral rinse samples obtained from 94 patients with primary head and neck squamous cell carcinoma (HNSC) and a control group of 656 subjects. Mitochondrial DNA/nuclear DNA in saliva from HNSC patients and controls in relationship to smoking exposure, ethanol intake, and tumor stage were examined. Mean levels of Cox I and Cox II in saliva samples were significantly higher in HNSC patients: Cox I, 0.076 [95% confidence interval (95% CI), 0.06-0.09] and Cox II, 0.055 (95% CI, 0.04-0.07) in comparison with controls Cox I, 0.054 (95% CI, 0.05-0.06), P < 0.0001 and Cox II, 0.046 (95% CI, 0.04-0.05), P = 0.003 (t test). MtDNA levels were elevated in primary tumors when compared with matched, pretreatment saliva and significant correlation was noted (Cox I, r = 0.30, P = 0.005 and Cox II r = 0.33, P = 0.002, respectively, Pearson's correlation). On univariate analysis, smoking, age, HNSC diagnosis, and advanced stage of HNSC were associated with higher level of mtDNA content in saliva. Multivariate analysis showed a significant and independent association of HNSC diagnosis, age, and smoking with increasing mtDNA/nuclear DNA for Cox I and Cox II. mtDNA content alteration is associated with HNSC independently of age and smoking exposure, can be detected in saliva, and may be due to elevation in mtDNA content in primary HNSC.

Adolescent↗
PubMed2004

Upregulatory mechanisms compensate for mitochondrial DNA depletion in asymptomatic individuals receiving stavudine plus didanosine.

Nucleoside analogue use is often related to mitochondrial DNA (mtDNA) depletion, but mitochondrial function is preserved in most asymptomatic patients. We determined whether homeostatic mechanisms are able to compensate for this mtDNA depletion in patients receiving stavudine plus didanosine (d4T + ddI), an antiretroviral combination with great in vitro and in vivo capacity to decrease mtDNA. We included 28 asymptomatic HIV-infected individuals: 17 subjects (cases) on a first-line antiretroviral regimen consisting of d4T + ddI as the nucleoside backbone plus nevirapine or nelfinavir for at least 6 months (mean: 16 +/- 8 months) and 11 naive subjects (controls). We assessed the following in peripheral blood mononuclear cells: mitochondrial mass by citrate synthase activity, mtDNA content by real-time polymerase chain reaction, cytochrome c oxidase subunit II (COX-II) expression by Western blot analysis, and COX activity by spectrophotometry. The mitochondrial mass and mtDNA content of cases decreased when compared with controls, whether normalized per cell or per mitochondrion. Conversely, COX-II expression and COX activity were similar in cases and controls. COX-II expression was constant and independent of the mtDNA content, whereas it was closely related to COX activity. We concluded that treatment with dd4T + ddI is associated with decreased mitochondrial mass and mtDNA content but that COX-II expression and COX activity remain unaltered. These data suggest that upregulatory transcriptional or posttranscriptional mechanisms compensate for mtDNA depletion caused by d4T + ddI before profound mtDNA depletion occurs.

Adult↗