Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Dryopteris”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2Linked to original sources
PubMed2006

Spore fitness components do not differ between diploid and allotetraploid species of Dryopteris (Dryopteridaceae).

BACKGROUND AND AIMS: Although allopolyploidy is a prevalent speciation mechanism in plants, its adaptive consequences are poorly understood. In addition, the effects of allopolyploidy per se (i.e. hybridization and chromosome doubling) can be confounded with those of subsequent evolutionary divergence between allopolyploids and related diploids. This report assesses whether fern species with the same ploidy level or the same altitudinal distribution have similar germination responses to temperature. The effects of polyploidy on spore abortion and spore size are also investigated, since both traits may have adaptive consequences. METHODS: Three allotetraploid (Dryopteris corleyi, D. filix-mas and D. guanchica) and three related diploid taxa (D. aemula, D. affinis ssp. affinis and D. oreades) were studied. Spores were collected from 24 populations in northern Spain. Four spore traits were determined: abortion percentage, size, germination time and germination percentage. Six incubation temperatures were tested: 8, 15, 20, 25 and 32 degrees C, and alternating 8/15 degrees C. KEY RESULTS: Allotetraploids had bigger spores than diploid progenitors, whereas spore abortion percentages were generally similar. Germination times decreased with increasing temperatures in a wide range of temperatures (8-25 degrees C), although final germination percentages were similar among species irrespective of their ploidy level. Only at low temperature (8 degrees C) did two allotetraploid species reach higher germination percentages than diploid parents. Allotetraploids showed faster germination rates, which would probably give them a competitive advantage over diploid parents. Germination behaviour was not correlated with altitudinal distribution of species. CONCLUSIONS: The results of this study suggest that (i) relative fitness of allopolyploids at sporogenesis does not differ from that of diploid parents and (ii) neither does allopolyploidization involve a change in the success of spore germination.

Dryopteris↗
PubMed2003

Antioxidant activity of two phloroglucinol derivatives from Dryopteris crassirhizoma.

The rhizome of Dryopteris crassirhizoma NAKAI exhibited significant antioxidant activity, as assessed by the 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activity in vitro. Two phloroglucinol derivatives, flavaspidic acids PB (1) and AB (2), were isolated from the rhizome of D. crassirhizoma by a bioassay-guided fractionation. 1H-, 13C-NMR, and UV analysis were used to determine the structures. Furthermore, the two compounds were tested for their antioxidant activities, such as their DPPH radical scavenging, superoxide radical scavenging, and lipid peroxidation (LPO) inhibitory activities. Compounds 1 and 2 exhibited potent antioxidant activity against the LPO inhibitory test with IC(50) values of 12.9 and 13.1 microM, respectively, compared with alpha-tocopherol (IC(50); 15.6 microM) and butylated hydroxy anisole (BHA, IC(50); 10.8 microM), while the two compounds had a moderated effect on the DPPH radical scavenging activity (IC(50); 71.7, 76.3 microM) as well as superoxide radical scavenging activity (IC(50); 58.6, 64.4 microM). The potent activity of the flavaspidic acids (1, 2) on inhibiting LPO might be due to possible stabilization as a result of chelating with iron.

Animals↗
PubMed2006

[Study on terpene of Dryopteris fragrans L].

OBJECTIVE: To study the terpene of Dryopteris fragrans. METHODS: Isolation and purification were carried out on repeated silica gel, Sephadex LH-20 column chromatography and prepare HPLC. The structures of the compounds were determined by physicochemical properties and spectral analysis. RESULTS: Four compounds were isolated and identified as 10-hydroxyl-15-oxo-alpha-cadinol (I), albicany acetate (II), alpha-cadinene (III), albicanol (IV). CONCLUSION: Compounds I is isolated from this plant for the first time.

Dryopteris↗
PubMed2006

[Studies on phloroglucinol derivatives of Dryopteris fragrans L].

OBJECTIVE: To study the phloroglucinol derivatives of Dryopteris fragrans. METHODS: Isolation and purification were carried out on repeated silica gel, Sephadex LH-20 column chromatography and prepare HPLC. The structures of the compounds were determined by physicochemical properties and spectral analysis. RESULTS: Four compounds were isolated and identified as aspidin PB (I), dryofragin (II), aspidinol (III), aspidin BB (IV). CONCLUSION: Compounds IV is isolated from this plant for the first time.

Chromatography, High Pressure Liquid↗
PubMed1995

Polar distribution of annexin-like proteins during phytochrome-mediated initiation and growth of rhizoids in the ferns Dryopteris and Anemia.

Although the calcium requirement of phytochrome-mediated fern spore germination and early rhizoid growth is well established, the calcium-binding proteins that serve as transducers for these responses are not known. Here we report the presence of annexin-like proteins in germinating spores of Dryopteris filix-mas (L.) Schott and Anemia phyllitidis (L.) Sw. and evidence that they may be important participants in early photomorphogenic changes in gametophytes. Immunolocalization and immunoblot assays of these proteins were carried out using polyclonal antibodies raised either against a 35-kDa annexin-like protein from pea or against anchorin CII from chicken. Western-blot analysis showed that crude protein extracts obtained from both species after red-light treatment contained two cross-reactive protein bands with molecular weights around 70 kDa. These proteins were annexin-like in that they bound to a phosphatidylserine affinity column in a calcium-dependent fashion. Using this column, two protein bands around 70 kDa, i.e. 67 and 73 kDa, were partially purified together with proteins at 36 kDa and a doublet at 54 kDa. Proteins of these latter molecular weights are suggested to be members of the annexin family, but no cross-reactivity could be found between these and the two antibodies used in our investigations. Immunodetectable levels of these proteins were observed only after light-mediated induction of spore germination. Imaging of the immuno-localization patterns observed with both antibodies showed that the annexin-like proteins are concentrated at the extreme tips of the rhizoids in D. filix-mas and A. phyllitidis during rhizoid initiation and all stages of elongation. We suggest that these proteins may play a major role in the tip-oriented exocytosis events that are critical for the initiation and growth of fern rhizoids.

Annexins↗
PubMed1975

Evidence for the association of acyl transferases with the production of nuclear evaginations in maturing eggs of the fern Dryopteris filix-mas.

Utilizing the ability of free CoA to reduce ferricyanide, evidence is presented that acyl transferase activity is associated with the nuclear envelope in the maturing egg of the fern Dryopteris filix-mas. This activity is particularly marked in the nuclear evaginations. This strengthens the view that the evaginations are distinct structures formed by localized growth of the envelope, and not transient extensions of the nucleus.

Acyltransferases↗
PubMed2003

Electrophoretic evidence for homoeologous chromosome pairing in the apogamous fern species Dryopteris nipponensis (Dryopteridaceae).

Segregation of genotypes through homoeologous chromosome pairing in the apogamous species Dryopteris nipponensis was tested by electrophoretic analysis. Of 284 progeny examined (250 gametophytes and 34 sporophytes), from the parental sporophyte with the Pgi-2 genotype abc, five showed different genotypes from that of the parent (three aac, one bbc and one bcc). This is the first evidence for genetic segregation in the progeny of apogamous fern species.

Chromosome Pairing↗
PubMed1996

Anti-tumor promoting activity of Dryopteris phlorophenone derivatives.

As a part of screening studies for cancer chemopreventive agents (anti-tumor promoters) 33 Dryopteris phlorophenone derivatives have been evaluated. The compounds tested comprised of monomeric acylphloroglucinols (e.g. desaspidinol, aspidinol) as well as dimeric (e.g. aspidin, desaspidin), trimeric (e.g. filixic acids), and tetrameric (e.g. dryocrassin) phlorophenone, wherein hexacyclic rings are bound together by a methylene bridge. These compounds were examined for their in vitro anti-tumor promoting effect on Epstein-Barr virus antigen activation induced by the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA). The two dimeric compounds aspidin and desaspidin, which were found to be the most active among the tested phlorophenones, were also examined in vivo on two stage mouse skin carcinogenesis, and found to show significant inhibitory effect on 7,12-dimethylbenz[alpha]anthracene (DMBA)-TPA tumor promotion.

Animals↗
PubMed1988

Localization of the active principles of the male fern (Dryopteris filix-mas (L.) Schott.) by fluorescence microscopy.

The active principles of the male fern, Dryopteris filix-mas (L.) Schott., consisting of a mixture of phloroglucinol derivatives called "crude filicin", are localized by means of fluorescence microscopy under U.V. 365 nm and monochromatic blue 435-490 nm lights. Crude filicin is autofluorescent, and therefore may be easily localized in the internal glandular hairs of the intercellular spaces of rhizome and leaf bases parenchyma, without pre-treatment of sections. Localization is confirmed both morphologically and chemically, and is possible on a fresh material, as well as on a desiccated one. The test allows also a complete anatomical examination of sections, and may be useful, for its easiness and quickness, in further taxonomic or pharmacognostic studies.

Butyrophenones↗
PubMed1991

Phytochrome-mediated germination and early development in spores of Dryopteris filix-mas L.: phase-specific and non phase-specific inhibition by staurosporine.

The alkaloid staurosporine, currently known as the most potent inhibitor of protein kinase C, PKC, was tested for its ability to inhibit phytochrome-mediated spore germination in Dryopteris filix-mas L., evaluated by the induction of chlorophyll synthesis. Approximately half-maximal inhibition was obtained at a concentration of 10(-5) M. This effect of staurosporine was phase-specific and was found during the same period in which the presence of extracellular calcium is necessary for realization of the light signal. Furthermore, the ability of staurosporine to prevent progression of a germinated spore into early gametophyte development, evaluated by the accumulation of chlorophyll, was examined. Again, staurosporine (10(-5) M) significantly diminished chlorophyll accumulation, determined quantitatively in vivo by single-cell measurements, in a non-phase specific way. The fact that the phase-specific inhibitory effect of staurosporine in preventing germination was coincident with the phase-specific requirement of Ca2+ suggests that both Ca2+ and staurosporine affect the same step in the signal-transduction chain. A phosphorylation event catalysed by PKC or any Ca2+ -dependent protein kinase is proposed as the target of staurosporine and Ca2+.

Alkaloids↗
PubMed1990

L-methionine decarboxylase from Dryopteris filix-mas: purification, characterization, substrate specificity, abortive transamination of the coenzyme, and stereochemical courses of substrate decarboxylation and coenzyme transamination.

L-Methionine decarboxylase from the male fern Dryopteris filix-mas has been purified 256-fold from acetone powder extracts to very near homogeneity. The enzyme is membrane-associated and requires detergent for solubilization during the initial extraction. The enzyme is a homodimer of subunit Mr 57,000 and shows a pH optimum at approximately 5.0 with 20 mM (2S)-methionine as substrate. The specific activity, kcat, for methionine is approximately 50 mol s(-1) (mol of active site)(-1) at pH 4.5 and below. A wide range of straight- and branched-chain (2S)-alkylamino acids are substrates for the enzyme. The values for the rate of decarboxylation, Vmax, and for the apparent Michaelis constant, Km, however, vary with structure and with the chirality at C-3. The pH dependence of V and V/K has been examined for three substrates: (2S)-methionine, valine, and leucine. Pyridoxal 5'-phosphate (PLP) is required for activity, and in the absence of excess PLP, the activity of the enzyme in incubations reduced with respect to time. The addition of PLP fully restores the activity, indicating that an abortive decarboxylation-transamination accompanies the normal decarboxylation reaction. The occurrence of the abortive reaction was confirmed by showing that [35S]methionine is converted to labeled 3-(methylthio)propionaldehyde while [4'-3H]PLP is converted to labeled pyridoxamine 5'-phosphate (PMP). The decarboxylation of (2S)-methionine gave 3-(methylthio)-1-aminopropane. Preparation of the N-camphanamide derivative of the amine allowed the C-1 methylene protons to be distinguished by 1H NMR spectroscopy. Synthetic samples of the camphanamide were prepared in which each of the C-1 methylene protons was replaced by deuterium. When (2S)-methionine and the C-2 deuteriated isotopomer were incubated with the enzyme in deuterium oxide and protium oxide, respectively, and the products were converted to their camphanamide derivatives and analyzed by 1H NMR spectroscopy, it was evident that decarboxylation occurred with retention of configuration at C-2. When the decarboxylation of six other substrates was studied, examination of the N-camphanamide derivatives of the amines indicated that decarboxylation occurred stereospecifically and, by analogy, with retention of configuration at C-2. When tritiated pyridoxal phosphate was incubated with the enzyme, tritiated pyridoxamine phosphate was formed. Analysis of the chirality of the methylene group at C-4' indicated that, during abortive transamination, protonation occurred from the 4'-si face of the coenzyme, the same stereochemical result as that obtained for several bona fide transaminase enzymes.(ABSTRACT TRUNCATED AT 400 WORDS)

Carboxy-Lyases↗
PubMed2002

Unusual properties of plastocyanin from the fern Dryopteris crassirhizoma.

The effect of pH on the (1)H NMR spectrum, reduction potential, and self-exchange rate constant of the novel plastocyanin (PCu) from the fern plant Dryopteris crassirhizoma has been studied. The results are compared with those for the higher-plant PCu from parsley. In the (1)H NMR spectrum of D. crassirhizoma PCu(I), there is no sign that either of the His ligands is protonated at pH* down to 5.4. The reduction potentials of D. crassirhizoma and parsley PCu are 382 and 379 mV, respectively, at pH 7.4. When the pH value is decreased, the reduction potential of parsley PCu is seen to increase quite dramatically, consistent with protonation at His87 in PCu(I). A pK(a) of 5.8 is obtained from the electrochemistry data, consistent with a value of 5.6 determined by NMR. The reduction potential of D. crassirhizoma PCu exhibits a much less pronounced dependence on pH. The self-exchange rate constant of D. crassirhizomaPCu(I) is 3.4 x 10(3) M(-1) s(-1) at pH* 7.9. This is the smallest self-exchange rate constant reported to date for a PCu and can be rationalized by considering the altered distribution of charged residues on the surface of the D. crassirhizoma protein compared to the charge distributions of other higher-plant PCus. The self-exchange rate constant increases to 9 x 10(3) M(-1) s(-1) at pH* 5.4, consistent with enhanced protein-protein association at lower pH*, and the absence of His87 protonation in D. crassirhizoma PCu(I) in the accessible pH range.

Dose-Response Relationship, Drug↗
PubMed1999

Structure comparison between oxidized and reduced plastocyanin from a fern, Dryopteris crassirhizoma.

The X-ray crystal structures of oxidized and reduced plastocyanin obtained from the fern Dryopteris crassirhizoma have been determined at 1.7 and 1.8 A resolution, respectively. The fern plastocyanin is unique in the longer main chain composed of 102 amino acid residues and in the unusual pH dependence due to the pi-pi stacking interaction around the copper site [Kohzuma, T., et al. (1999) J. Biol. Chem. 274, 11817-11823]. Here we report the structural comparison between the fern plastocyanin and other plastocyanins from cyanobacteria, green algae, and other higher plants, together with the structural changes of fern plastocyanin upon reduction. Glu59 hydrogen bonds to the OH of Tyr83, which is thought to be a possible conduit for electrons, in the oxidized state. However, it moves away from Tyr83 upon reduction like poplar plastocyanin.

Amino Acid Sequence↗
PubMed2001

Historical bottlenecks decrease genetic diversity in natural populations of Dryopteris cristata.

The reconstruction of recent historical population sizes allowed us to investigate the influence of random evolutionary processes on present-day genetic diversity in populations of Dryopteris cristata. This long-lived, allotetraploid fern is rare and endangered in the study area at the southwestern border of its European distribution. Random amplified polymorphic DNA (RAPD) diversity of 280 individuals from 14 populations of D. cristata was extraordinarily low, suggesting an ancient bottleneck in the species' history. Analysis of molecular variance (AMOVA) of 25 different RAPD multiband phenotypes revealed significant genetic variation among three geographical regions (15%) and among populations within regions (34%); 51% of total variance was attributed to variation within populations. High population differentiation indicated limited gene flow among populations, and genetic divergence was not correlated with geographical distance. There was no relationship between genetic variation within population, estimated as molecular variance, and present-day population size. Populations with recent historical bottlenecks of fewer than 25 individuals showed a substantial and significant reduction in genetic variation, compared with populations without bottlenecks. Comparatively high levels of genetic variation were still maintained in small remnants (60-110 individuals) of formerly large populations. Average deviations of frequencies of widespread polymorphic markers within populations from their frequencies in the whole dataset were significantly higher in small or recently bottlenecked populations than in constantly large populations, thus providing evidence for random sampling effects during genetic bottlenecks and drift in small populations. The present investigation demonstrates the importance of population history for understanding present-day genetic diversity within natural populations, as well as for conservation biology.

DNA, Plant↗
PubMed1982

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.

Base Sequence↗
PubMed1982

The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata.

The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.

Base Sequence↗
PubMed1992

Detection and partial sequence of phytochrome genes in the ferns Anemia phyllitidis (L.)Sw (Schizaeaceae) and Dryopteris filix-mas L. (Polypodiaceae) by using polymerase-chain reaction technology.

Phytochrome controls several developmental steps during formation and differentiation of the fern gametophyte, including spore germination, morphogenesis of the gametophyte or differentiation of the sexual cells. To obtain information about the amino acid sequence and the regulation of phytochrome expression at the gene level, two degenerated oligonucleotides against well conserved amino acid regions were designed after an optimal alignment of the known phytochrome sequences. These primers were tested against DNA isolated from Arabidopsis thaliana, and the polymerase-chain reaction (PCR) products were cloned and sequenced. The DNA fragment produced with this method proved to be identical with a phytochrome-A-gene fragment from A. thaliana, and hence this fragment was used in further experiments to prove whether amplified DNA from fern species contains phytochrome-like DNA. With this procedure we successfully detected and cloned gene fragments both from gametophytes of Anemia phyllitidis and Dryopteris filix-mas, cultured for 7 days under vegetative conditions. In addition, poly(A)+ RNA was prepared from 7-day-old gametophytes of A. phyllitidis, induced to differentiate antheridia under generative conditions. This poly(A)+ RNA was transcribed into complementary DNA and used together with both phytochrome specific primers in a PCR experiment. We thereby obtained another DNA fragment. These data strongly suggest that A. phyllitidis has at least two phytochrome genes, and that at least one of them is expressed in light-grown gametophytes.

Amino Acid Sequence↗