Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “DNA structure”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 37 records · Page 2Linked to original sources
PubMed1986

Detection, sequence patterns and function of unusual DNA structures.

Unusual DNA structures were detected by an electrophoretic procedure in which DNA fragments were separated according to size on agarose gels and then by shape on polyacrylamide gels. Fragments from yeast centromeres migrated faster in polyacrylamide than predicted from their base composition and size and this property was attributed to a nonrandom distribution of oligomeric A tracts that exhibited minima at 10-11 base intervals. Fragments from seven loci in 107 kb of DNA migrated anomalously slow and these fragments contained blocks of A2-6 in a 10-11 base periodicity which is indicative of bent DNA. The most pronounced bent sequences were found within yeast ARS1 and centered at 245 and 240 bp from the left and right ends of the adenovirus genome. Each sequence is approximately 150 bp away from a replication origin and the adenovirus sequences are within 50 bp of enhancers. Nuclear matrix attachment sites, which are also adjacent to enhancers, contain sequences characteristic of bent DNA. These results suggest that bent structures reside at the base of DNA loops in chromosomes.

Base Sequence↗
PubMed1995

Triplex DNA structures.

A DNA triplex is formed when pyrimidine or purine bases occupy the major groove of the DNA double Helix forming Hoogsteen pairs with purines of the Watson-Crick basepairs. Intermolecular triplexes are formed between triplex forming oligonucleotides (TFO) and target sequences on duplex DNA. Intramolecular triplexes are the major elements of H-DNAs, unusual DNA structures, which are formed in homopurine-homopyrimidine regions of supercoiled DNAs. TFOs are promising gene-drugs, which can be used in an anti-gene strategy, that attempt to modulate gene activity in vivo. Numerous chemical modifications of TFO are known. In peptide nucleic acid (PNA), the sugar-phosphate backbone is replaced with a protein-like backbone. PNAs form P-loops while interacting with duplex DNA forming triplex with one of DNA strands leaving the other strand displaced. Very unusual recombination or parallel triplexes, or R-DNA, have been assumed to form under RecA protein in the course of homologous recombination.

Animals↗
PubMed2004

The thermodynamics of DNA structural motifs.

DNA secondary structure plays an important role in biology, genotyping diagnostics, a variety of molecular biology techniques, in vitro-selected DNA catalysts, nanotechnology, and DNA-based computing. Accurate prediction of DNA secondary structure and hybridization using dynamic programming algorithms requires a database of thermodynamic parameters for several motifs including Watson-Crick base pairs, internal mismatches, terminal mismatches, terminal dangling ends, hairpins, bulges, internal loops, and multibranched loops. To make the database useful for predictions under a variety of salt conditions, empirical equations for monovalent and magnesium dependence of thermodynamics have been developed. Bimolecular hybridization is often inhibited by competing unimolecular folding of a target or probe DNA. Powerful numerical methods have been developed to solve multistate-coupled equilibria in bimolecular and higher-order complexes. This review presents the current parameter set available for making accurate DNA structure predictions and also points to future directions for improvement.

Algorithms↗
PubMed1988

Actinomycin D induced DNase I cleavage enhancement caused by sequence specific propagation of an altered DNA structure.

Two DNA hexadecamers containing one central 5'-GC-3' base step have been examined by footprinting methodology in the presence and absence of actinomycin D. The results of these studies, coupled with imino proton NMR measurements indicate that the antitumor drug causes a change in DNA conformation at a distance from the actinomycin intercalation site in a molecule of sequence d[ATATATAGCTATATAT] that does not occur in d[AAAAAAAGCTTTTTTT]. The experiments demonstrate that DNase I rate enhancements associated with actinomycin D binding are caused by ligand alteration of equilibrium DNA structure.

Base Composition↗
PubMed1993

Z-DNA structure of a modified DNA hexamer at 1.4-A resolution: aminohexyl-5'-d(pCpGp[br5C]pGpCpG).

Oligonucleotides with modification at the 5'-end have been used for various biochemical applications. As a first step to better assess the effects of those modifications on DNA conformation, we determined at 1.4-A resolution the left-handed Z-DNA structure of a DNA hexamer, aminohexyl-5'-d(pCpGp[br5C]pGpCpG), by X-ray diffraction analysis. This hexamer was crystallized in the monoclinic C2 (a = 51.13 A, b = 18.44 A, c = 34.67 A, and beta = 120.9 degrees) space group. Its structure has been refined by the restrained least-squares refinement to a final R factor of 0.164 using 3727 [> 2.0 sigma (F)] observed reflections. The overall conformation of the double helix resembles that of the canonical Z-DNA. The terminal 5'-phosphate groups of the dC residues adopt conformations (beta approximately 180 degrees and gamma approximately 60 degrees) similar to phosphodiester's conformation of the internal dC residues. Two types of interhelical stackings are observed, one of which may serve as a model for a single-strand nick in the backbone of DNA double helix. A barium ion is found to bridge two side-by-side Z-DNA helices by coordinating to the O6 and N7 atoms of two guanines simultaneously. This "cross-linking" ability of barium ion may be a useful property in promoting the reversible aggregation of nucleic acids.

Barium↗
PubMed2006

[DNA structure from A to Z--biological implications of structural diversity of DNA].

Deoxyribonucleic acid (DNA) is a biopolymer of nucleotides, usually adopting a double-stranded helical form in cells, with complementary base pairing holding the two strands together. The most stable is B-DNA conformation, although numerous other double helical structures can occur under specific conditions (A-DNA, Z-DNA, P-DNA). The existence of multiple-stranded (triplex, tetraplex) forms in vivo and their biological function in cells are subject of intensive studies.

Base Composition↗
PubMed1986

Micrococcal nuclease as a DNA structural probe: its recognition sequences, their genomic distribution and correlation with DNA structure determinants.

We have analyzed micrococcal nuclease (MNase) DNA cleavage patterns at the sequence level by examining 2.3 X 10(3) base-pairs of data derived from the Drosophila melanogaster 44D larval cuticle locus. Within this region, MNase preferentially cleaved 140 sites. Clusters of these sites appear to generate the preferential MNase eukaryotic DNA cleavage sites seen on agarose gels at roughly 100 to 300 base-pair intervals. These clusters of preferential cleavage sites rarely occur within gene coding regions. The analysis revealed that duplex DNA sequences preferentially cleaved by MNase are generally determined by a single strand sequence: d(A-T)n, where n greater than or equal to 1, flanked by a 5' dC or dG. Cleavage of the other strand is generally staggered 5' by several nucleotides and occurs even if such sequences are absent on that strand. An empirical predictive DNA cleavage model derived from a statistical analysis of the sequence level data was applied to seven eukaryotic gene loci of known sequence. The predicted patterns were in good general agreement with the previously observed eukaryotic gene/spacer cleavage pattern. Statistical analysis also revealed that sites of predicted preferential DNA cleavage occur less frequently in protein coding regions than for randomized sequences of the same length and nucleotide content. Comparison of the MNase cleavage patterns to the sequence-dependent pattern of binding energies between duplex DNA strands indicates that MNase preferentially cleaves sequences with low helix stability.

Animals↗
PubMed2002

A new peculiar DNA structure: NMR solution structure of a DNA kissing complex.

The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degrees C) was found slightly higher than the one of the corresponding RNA dimer (32 degrees C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100 degree with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5 A. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20 degrees between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.

Base Sequence↗
PubMed1992

Three-stranded DNA structure; is this the secret of DNA homologous recognition?

A novel type of triple-stranded DNA structure was proposed by several groups to play a crucial role in homologous recognition between single- and double-stranded DNA molecules. In this still putative structure a duplex DNA was proposed to co-ordinate a homologous single strand in its major groove side. In contrast to the well-characterized pyrimidine-purine-pyrimidine triplexes in which the two like strands are antiparallel and which are restricted to poly-pyrimidine-containing stretches, the homology-specific triplexes would have like strands in parallel orientation and would not be restricted to any particular sequence provided that there is a homology between interacting DNA molecules. For many years the stereo-chemical possibility of forming homology-dependent three- or four-stranded DNA structures during the pairing stage of recombination reactions was seriously considered in published papers. However, only recently has there been a marked increase in the number of papers that have directly tested the formation of triple-stranded DNA structures during the actual pairing stage of the recombination reaction. Unfortunately the results of these tests are not totally clear cut; while some laboratories presented experimental evidence consistent with the formation of triplexes, others studying the same or very similar systems offered alternative explanations. The aim of this review is to present the current state of the central question in the mechanism of homologous recombination, namely, what kind of DNA structure is responsible for DNA homologous recognition. Is it a novel triplex structure or just a classical duplex?

DNA↗
PubMed1999

The N-terminal domain of the human Rad51 protein binds DNA: structure and a DNA binding surface as revealed by NMR.

Human Rad51 protein (HsRad51) is a homolog of Escherichia coli RecA protein, and functions in DNA repair and recombination. In higher eukaryotes, Rad51 protein is essential for cell viability. The N-terminal region of HsRad51 is highly conserved among eukaryotic Rad51 proteins but is absent from RecA, suggesting a Rad51-specific function for this region. Here, we have determined the structure of the N-terminal part of HsRad51 by NMR spectroscopy. The N-terminal region forms a compact domain consisting of five short helices, which shares structural similarity with a domain of endonuclease III, a DNA repair enzyme of E. coli. NMR experiments did not support the involvement of the N-terminal domain in HsRad51-HsBrca2 interaction or the self-association of HsRad51 as proposed by previous studies. However, NMR tiration experiments demonstrated a physical interaction of the domain with DNA, and allowed mapping of the DNA binding surface. Mutation analysis showed that the DNA binding surface is essential for double-stranded and single-stranded DNA binding of HsRad51. Our results suggest the presence of a DNA binding site on the outside surface of the HsRad51 filament and provide a possible explanation for the regulation of DNA binding by phosphorylation within the N-terminal domain.

BRCA2 Protein↗
PubMed1998

Trinucleotide repeat DNA structures: dynamic mutations from dynamic DNA.

Models for the disease-associated expansion of (CTG)n.(CAG)n, (CGG)n.(CCG)n, and (GAA)n.(TTC)n trinucleotide repeats involve alternative DNA structures formed during DNA replication, repair and recombination. These repeat sequences are inherently flexible and can form a variety of hairpins, intramolecular triplexes, quadruplexes, and slipped-strand structures that may be important intermediates and result in their genetic instability.

Base Composition↗
PubMed1995

SSCP primer design based on single-strand DNA structure predicted by a DNA folding program.

To predict alterations in single-strand DNA mobility in non-denaturing electrophoretic gels, Zuker's RNA folding program was modified. Energy files utilized by the LRNA RNA folding algorithm were modified to emulate folding of single-strand DNA. Energy files were modified to disallow G-T base pairing. Stacking energies were corrected for DNA thermodynamics. Constraints on loop nucleotide sequences were removed. The LRNA RNA folding algorithm using the DNA fold energy files was applied to predict folding of PCR generated single-strand DNA molecules from polymorphic human ALDH2 and TPH alleles. The DNA-Fold version 1.0 program was used to design primers to create and abolish SSCP mobility shifts. Primers were made that add a 5' tag sequence or alter complementarity to an internal sequence. Differences in DNA secondary structure were assessed by SSCP analysis and compared to single-strand DNA secondary structure predictions. Results demonstrate that alterations in single-strand DNA conformation may be predicted using DNA-Fold 1.0.

Aldehyde Dehydrogenase↗
PubMed2003

Rice HMGB1 protein recognizes DNA structures and bends DNA efficiently.

We analyzed the DNA-binding and DNA-bending properties of recombinant HMGB1 proteins based on a rice HMGB1 cDNA. Electrophoretic mobility shift assay demonstrated that rice HMGB1 can bind synthetic four-way junction (4H) DNA and DNA minicircles efficiently but the binding to 4H can be completed out by HMGA and histone H1. Conformational changes were detected by circular dichroism analysis with 4H DNA bound to various concentrations of HMGB1 or its truncated forms. T4 ligase-mediated circularization assays with short DNA fragments of 123 bp showed that the protein is capable of increasing DNA flexibility. The 123-bp DNA formed closed circular monomers efficiently in its presence, similar to that in an earlier study on maize HMG. Additionally, our results show for the first time that the basic N-terminal domain enhances the affinity of the plant HMGB1 protein for 4H DNA, while the acidic C-terminal domain has the converse effects.

Base Sequence↗
PubMed1984

Reaction of the antitumor antibiotic CC-1065 with DNA: structure of a DNA adduct with DNA sequence specificity.

Sequence-dependent variations in DNA revealed by x-ray crystallographic studies have suggested that certain DNA-reactive drugs may react preferentially with defined sequences in DNA. Drugs that wind around the helix and reside within one of the grooves of DNA have perhaps the greatest chance of recognizing sequence-dependent features of DNA. The antitumor antibiotic CC-1065 covalently binds through N-3 of adenine and resides within the minor groove of DNA. This drug overlaps with five base pairs for which a high sequence specificity exists.

Antibiotics, Antineoplastic↗
PubMed2001

Flexibility of the genetic code with respect to DNA structure.

MOTIVATION: The primary function of DNA is to carry genetic information through the genetic code. DNA, however, contains a variety of other signals related, for instance, to reading frame, codon bias, pairwise codon bias, splice sites and transcription regulation, nucleosome positioning and DNA structure. Here we study the relationship between the genetic code and DNA structure and address two questions. First, to which degree does the degeneracy of the genetic code and the acceptable amino acid substitution patterns allow for the superimposition of DNA structural signals to protein coding sequences? Second, is the origin or evolution of the genetic code likely to have been constrained by DNA structure? RESULTS: We develop an index for code flexibility with respect to DNA structure. Using five different di- or tri-nucleotide models of sequence-dependent DNA structure, we show that the standard genetic code provides a fair level of flexibility at the level of broad amino acid categories. Thus the code generally allows for the superimposition of any structural signal on any protein-coding sequence, through amino acid substitution. The flexibility observed at the level of single amino acids allows only for the superimposition of punctual and loosely positioned signals to conserved amino acid sequences. The degree of flexibility of the genetic code is low or average with respect to several classes of alternative codes. This result is consistent with the view that DNA structure is not likely to have played a significant role in the origin and evolution of the genetic code.

Amino Acids↗
PubMed2005

Structural DNA nanotechnology: an overview.

Structural DNA nanotechnology uses unusual DNA motifs to build target shapes and arrangements. These unusual motifs are generated by reciprocal exchange of DNA backbones, leading to branched systems with many strands and multiple helical domains. The motifs may be combined by sticky-ended cohesion, involving hydrogen bonding or covalent interactions. Other forms of cohesion involve edge sharing or paranemic interactions of double helices. A large number of individual species have been developed by this approach, including polyhedral catenanes, such as a cube and a truncated octahedron; a variety of single-stranded knots; and Borromean rings. In addition to these static species, DNA-based nanomechanical devices have been produced that are targeted ultimately to lead to nanorobotics. Many of the key goals of structural DNA nanotechnology entail the use of periodic arrays. A variety of two-dimensional DNA arrays have been produced with tunable features, such as patterns and cavities. DNA molecules have been used successfully in DNA-based computation as molecular representations of Wang tiles, whose self-assembly can be programmed to perform a calculation. Structural DNA nanotechnology appears to be at the cusp of a truly exciting explosion of applications, which can be expected to occur by the end of the current decade.

Animals↗