Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Quantitative PCR”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 343 records · Page 19Linked to original sources
PubMed2000

Quantitative PCR analysis of HbF inducers in primary human adult erythroid cells.

The development and evaluation of drugs to elevate fetal hemoglobin in the treatment of the genetic diseases of hemoglobin would be facilitated by the availability of reliable cell assays. We have used real-time, quantitative polymerase chain reaction (PCR) analyses of globin messenger RNA (mRNA) levels in a biphasic, erythropoietin-dependent primary culture system for human adult erythroid cells in order to assay compounds for their ability to modulate levels of adult (beta) and fetal (gamma) globin mRNA. Complementary DNA synthesized from total RNA extracted at timed intervals from aliquots of cells were assayed throughout the period that the culture was studied. gamma-globin mRNA levels were found to be much lower (less than 1%) than beta-globin mRNA levels. At concentrations of agents chosen for minimal effect on cell division, we find that the 3 drugs studied, 5-azacytidine (5 micromol/L), hydroxyurea (40 micromol/L), and butyric acid (0.5 mmol/L), significantly increase gamma-globin mRNA levels. Interestingly, hydroxyurea also had a small stimulatory effect on beta-globin mRNA levels, while butyric acid caused a twofold inhibition of beta-globin mRNA levels, and 5-azacytidine had little effect on beta-globin mRNA levels. The net result of all 3 drugs was to increase the gamma/(gamma + beta) mRNA ratios by threefold to fivefold. These data suggest that the mechanism is distinct for each drug. The profile of butyric-acid-induced changes on globin gene expression is also quite distinct from changes produced by trichostatin A, a known histone deacetylase inhibitor. Quantitative PCR analyses of human erythroid cells should prove useful for studying the mechanism(s) of action of known inducers of gamma-globin and identifying new drug candidates.

Adult↗
PubMed2000

Measurement of DNA copy number at microsatellite loci using quantitative PCR analysis.

This report describes the development and validation of quantitative microsatellite analysis (QuMA) for rapid measurement of relative DNA sequence copy number. In QuMA, the copy number of a test locus relative to a pooled reference is assessed using quantitative, real-time PCR amplification of loci carrying simple sequence repeats. Use of simple sequence repeats is advantageous because of the large numbers that are mapped precisely. In addition, all markers are informative because QuMA does not require that they be polymorphic. The utility of QuMA is demonstrated in assessment of the extent of deletions of chromosome 2 in leukemias arising in radiation-sensitive inbred SJL mice and in analysis of the association of increased copy number of the putative oncogene ZNF217 with reduced survival duration in ovarian cancer patients.

Animals↗
PubMed2000

Improved assessment of minimal residual disease in B cell malignancies using fluorogenic consensus probes for real-time quantitative PCR.

PCR of clonally rearranged immunoglobulin heavy chain (IgH) gene sequences is increasingly used for detection of minimal residual disease (MRD) in lymphoid malignancies. Inherent quantitating problems are the main drawbacks of traditional PCR technologies. These limitations have been overcome by the recently developed real-time quantitative PCR (RQ PCR) technology. However, clinical application of the few published RQ PCR assays targeting immune gene rearrangements is hampered by the expensive and time-consuming need for individual hybridization probes for each patient. We have developed a new RQ PCR strategy targeting clonally rearranged IgH sequences that solves this problem. The method uses only two different JH hybridization probes and four downstream JH primers homologous to consensus germline JH gene segments. In combination with an allele-specific upstream (ASO) primer the consensus JH probes and primers allow quantitation of about 90% of possible IgH rearrangements. In a series of 22 B-lineage ALL the new assay allowed the detection of one to 10 blasts in a background of 10(5) normal cells. To prove the clinical utility we quantified MRD in 23 follow-up samples of six ALL patients with the new assay in comparison with a published RQ PCR technique that used individually designed primer/probe sets. We showed that the sensitivity of the new RQ PCR assay was slightly higher for four of the six cases and about 100-fold higher for one case, enabling detection of an increasing MRD level as an indicator of subsequent relapse 44 weeks earlier compared to the ASO probe assay in this particular patient. The results suggest, that the novel RQ PCR assay is a rapid, technically simple, reliable, and sensitive alternative to traditional quantification assays and simplifies current approaches of monitoring MRD in clinical trials.

Base Sequence↗
PubMed2003

Diagnosis of invasive mold infection by real-time quantitative PCR.

We report the design and evaluation of a quantitative real-time polymerase chain reaction (PCR) assay to diagnose invasive mold infection (IMI) by detecting mold DNA in the serum. This assay detected 200 fg to 20 ng (5-log range) mold DNA and permitted a cutoff of 110 fg (3 genomes). Human or candidal DNA was not amplified. Specificity also was demonstrated by negative results in all 35 patients (76 serum samples) with unlikely IMI at the cutoff. For patients with possible, probable, and documented IMI diagnosed by a combination of clinical, microbiologic, and histologic criteria, this real-time PCR showed positivity in 40% (12/30), 68% (19/28), and 85% (11/13) cases, respectively, in testing of multiple serum samples. The overall serum positivity rate for these patients was 15.1% (73/483). Quantitative analysis of the positive serum samples estimated the bodily circulating mold burden to be 1.6 x 10(5) genomes (5.3 ng) by geometric mean with 4.2 x 10(7) genomes (1,400 ng) the highest. These results suggest that for the diagnosis of IMI, this real-time PCR may be a promising alternative to other invasive methods. Further evaluation is underway.

Aspergillosis↗
PubMed2003

Assessment of removal of human cytomegalovirus from blood components by leukocyte depletion filters using real-time quantitative PCR.

To assess removal of cytomegalovirus (CMV) by leukocyte depletion (LD) filters, we developed a spiking model of latent virus using peripheral blood mononuclear cells (PBMCs) infected by coculture with CMV-infected human fibroblasts. Infected PBMCs were purified by dual magnetic column selection and then spiked into whole blood units or buffy coat pools prior to LD by filtration. CMV load and fibroblast contamination were assessed using quantitative CMV DNA real-time PCR and quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) of mRNA encoding the fibroblast-specific splice variant of prolyl-4-hydroxylase, respectively. After correcting for fibroblast-associated CMV, the mean CMV load was reduced in whole blood by LD from 7.42 x 10(2) to 1.13 copies per microliter (2.81(10)log reduction) and from 3.8 x 10(2) to 4.77 copies per microliter (1.9(10)log reduction) in platelets. These results suggest that LD by filtration reduces viral burden but does not completely remove CMV from blood components.

Base Sequence↗
PubMed2002

Evaluation of HER2/neu status by real-time quantitative PCR in breast cancer.

Over-expression of the human epidermal growth factor receptor-2 (HER2/neu) has been observed in many cancers, and is associated with a poor prognosis. Recent adjuvant treatment with anti-HER2 monoclonal antibodies in breast cancer has increased the demand for an evaluation of the HER2/neu status in breast cancer. The aim of this study was to investigate the HER2/neu status in breast cancer by a real-time quantitative polymerase chain reaction (PCR) method using LightCycler (Roche Diagnostics, Mannheim, Germany). DNA samples from the fresh tumor tissues of 27 patients with breast cancer were analyzed in parallel using immunohistochemistry (IHC) and the other prognostic parameters including estrogen receptor, progesterone receptor, cytokeratin, and DNA ploidy. Ten (37%) out of 27 cases tested were positive for HER2/neu, while 16 (73%) out of 22 tested positive through an IHC study. The correlation between the DNA aneuploidy and the positive results for HER2/neu were only observed using the real-time PCR method (p < 0.05). There was no significant correlation between the HER2/neu status and the S-phase fractions of the DNA ploidy or other parameters. This study demonstrated that there is marked discordance in the results for the HER2/neu status according to the various methods used. Real-time quantitative PCR for HER2/neu appears to be clinically useful due to its simplicity and ability to produce rapid results.

Breast Neoplasms↗
PubMedDate not supplied

Serial quantitative PCR analysis of bone marrow samples from breast cancer patients to monitor systemic micrometastases.

BACKGROUND: We have previously developed a quantitative calibrated PCR assay to measure cytokeratin 19 (CK19) expression in haematopoietic tissue in order to detect systemic micrometastases. PATIENTS AND METHODS: Serial measurements of CK19 expression in bone marrow of patients with primary breast cancer were performed at operation, at 3 weeks and 6 months postoperatively. RESULTS: Reference values for CK19 expression were established by analysing bone marrow samples from 48 healthy female volunteers or patients without epithelial cancer. Samples from breast cancer patients with CK19 values above the upper reference limit were considered positive. Bone marrow samples taken at operation were positive in 29 out of 141 patients (20.6%) and remained positive in 12, turned negative in 4 and were unavailable in 13 at 6 months postoperatively. CONCLUSION: Serial measurements increase the reliability of detecting micrometastases perioperatively. Further studies are in progress to evaluate the relationship between elevated CK19 values and clinical outcome.

Adult↗
PubMed2001

Quantitative changes in gene expression of glutamate receptor subunits/subtypes in the vestibular nucleus, inferior olive and flocculus before and following unilateral labyrinthectomy in the rat: real-time quantitative PCR method.

Spontaneous recovery from the oculomotor and postural symptoms of unilateral labyrinthectomy (UL) is known as vestibular compensation, which is a useful model for investigation of the mechanisms of lesion-induced CNS plasticity. In the present study, to elucidate the molecular biological basis of vestibular compensation, we investigated changes in the mRNA expression of glutamate receptor subunit/subtypes in the rat central vestibular system, including the vestibular nucleus complex (VNC), inferior olive (IO), and cerebellar flocculus following UL, using a real-time quantitative polymerase chain reaction (PCR) method. In normal control animals, regional differences in the expression of several glutamate receptor subunit/subtypes, e.g., NR1 and NR2A subunits of the N-methyl-D-aspartic acid (NMDA) receptor, GluR2 and KA2 subtypes of non-NMDA receptors, and mGluR1 and mGluR7 metabotropic glutamate receptors, were consistent with previous results from studies using in situ hybridization histochemistry, suggesting that the real-time quantitative PCR method was a reliable procedure for evaluation of changes in mRNA expression. In the vestibular nucleus complex, NR2A, GluR2 and mGluR7 mRNA were ipsilaterally downregulated by 6 h following UL (P<0.05, P<0.05 and P<0.01, respectively). In the inferior olive, no changes in gene expression were observed. In the ipsilateral flocculus, KA2 mRNA expression was increased by 50 h post-UL (P<0.05). However, in the contralateral flocculus, mGluR1 mRNA was downregulated by 6 h post-UL (P<0.005). Both the increase in KA2 mRNA expression in the ipsilateral flocculus and the decrease in mGluR1 mRNA expression in the contralateral flocculus may have had the effect of reducing Purkinje cell inhibition of ipsilateral VNC neurons, thereby contributing to the rebalancing of spontaneous resting activity between the ipsilateral and contralateral VNCs. It is suggested that such changes in the activities of the floccular-VNC pathways may be important to the vestibular compensation process.

Animals↗
PubMed2004

Direct quantification of Campylobacter jejuni and Campylobacter lanienae in feces of cattle by real-time quantitative PCR.

Campylobacter species are fastidious to culture, and the ability to directly quantify biomass in microbiologically complex substrates using real-time quantitative (RTQ) PCR may enhance our understanding of their biology and facilitate the development of efficacious mitigation strategies. This study reports the use of nested RTQ-PCR to directly quantify Campylobacter jejuni and Campylobacter lanienae in cattle feces. For C. jejuni, the single-copy mapA gene was selected. For C. lanienae, the three-copy 16S rRNA gene was targeted. RTQ-PCR primers were tested alone or they were nested with species-specific primers, and amplification products were detected using the intercalating dye SYBR Green. Nesting did not increase the specificity or sensitivity of C. jejuni quantification, and the limit of quantification was 19 to 25 genome copies ( approximately 3 x 10(3) CFU/g of feces). In contrast, nested RTQ-PCR was necessary to confer specificity on C. lanienae by targeting the 16S rRNA gene. The limit of quantification was 1.8 genome copies ( approximately 250 CFU/g of feces), and there was no discernible difference between the two C. lanienae secondary primer sets evaluated. Detection and quantification of C. jejuni in naturally infested cattle feces by RTQ-PCR were comparable to the results of culture-based methods. In contrast, culturing did not detect C. lanienae in 6 of 10 fecal samples positive for the bacterium and substantially underestimated cell densities relative to nested RTQ-PCR. The results of this study illustrate that RTQ-PCR can be used to directly quantify campylobacters, including very fastidious species, in a microbiologically and chemically complex substrate. Furthermore, targeting of a multicopy universal gene provided highly sensitive quantification of C. lanienae, but nested RTQ-PCR was necessary to confer specificity. This method will facilitate subsequent studies to elucidate the impact of this group of bacteria within the gastrointestinal tracts of livestock and studies of the factors that influence colonization success and shedding.

Animals↗
PubMed2004

Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease.

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.

Adult↗
PubMed2003

Quantitative PCR to evaluate small amounts of BCL2 mRNA in human peripheral T cells: implication of equimolar target and competitor end products.

BACKGROUND: It is difficult to reliably and reproducibly quantitate small amounts of mRNA by conventional PCR. The method we describe here enabled us to more accurately quantitate a small amount of BCL2 mRNA in human peripheral T cells. METHODS: The sample was amplified in four tubes containing three-fold serial dilutions of competitor so that when the PCR products in the four tubes were totaled, the number of target and competitor components were approximately equal. An unknown concentration of target molecules should be assessed only within a narrow range, requiring that several reactions be performed for each sample. RESULTS AND CONCLUSION: With this method, conventional PCR machines can be used to perform quantitative PCR on very small amounts of BCL2, and would be especially useful for samples that contain substance(s) that affect PCR amplification efficiency.

Adolescent↗
PubMed1996

Experience with quantitative PCR for the management of HCMV disease.

Human cytomegalovirus (HCMV) is a major pathogen in newborn children and immunosuppressed individuals. There are various diagnostic methods for HCMV, but all test systems either suffer from limited sensitivity and specificity or are prone to sampling errors. Due to its unequaled sensitivity, strong hopes were pinned on the polymerase chain reaction (PCR) for the early diagnosis of active HCMV infections. However, when monitoring immunocompromised patients, unwanted positive results are often obtained without further evidence of active HCMV infection. To better discriminate between latent and active infections, different methods for the quantitation of viral genomes in clinical samples by PCR have been devised in the past years. Here we discuss the current standing of quantitative PCR in HCMV diagnostics.

Cytomegalovirus Infections↗
PubMed2003

The measurement of adenosine and estrogen receptor expression in rat brains following ovariectomy using quantitative PCR analysis.

In our laboratory we have developed a quantitative-polymerase chain reaction (Q-PCR) strategy to examine the differential expression of adenosine receptor (ADOR), A(1), A(2A), A(2B) and A(3), and estrogen receptors (ER) alpha and beta. Brain and uterine mRNA were first used to optimise specific amplification conditions prior to SYBR Green I real time analysis of receptor subtype expression. SYBR Green I provided a convenient and sensitive means of examining specific PCR amplification product in real time, and allowed the generation of standard curves from which relative receptor abundance could be determined. Real time Q-PCR analysis was then performed, to examine changes in receptor expression levels in brains of adult female Wistar rats 3-month post ovariectomy. Comparison with sham-operated age-matched control rats demonstrated both comparative and absolute-copy number changes in receptor levels. Evaluation of both analytical methods investigated 18S rRNA as an internal reference for comparative gene expression analysis in the brain. The results of this study revealed preferential repression of ADORA(2A) (>4-fold down) and consistent (>2-fold) down-regulation of ADORA(1), ADORA(3), and ER-beta, following ovariectomy. No change was found in ADORA(2B) or ER-alpha. Analysis of absolute copy number in this study revealed a correlation between receptor expression in response to ovariectomy, and relative receptor subtype abundance in the brain.

Animals↗
PubMed1994

Quantitative PCR for detection of femtogram quantities of interleukin-8 mRNA expression.

A quantitative polymerase chain reaction (PCR) assay for mRNA expression of interleukin-8 (IL-8), a neutrophil chemotactant and activator, was developed to examine the expression of this cytokine by colonic mucosa. A synthetic IL-8 RNA deleted in size of native IL-8 mRNA was used as an external control. The synthetic IL-8 RNA was mixed with total RNA from cells and converted to cDNA and amplified by PCR simultaneously. The lower limit of sensitivity for the assay was found to be more than 1 femtogram of IL-8 mRNA. The assay determined IL-8 mRNA expression when the RNA was isolated from either human histiocytic lymphoma cell line U937 cells or human colonic mucosa obtained from colitis patients and healthy controls. The development of the rapid and sensitive assay should provide a means to more fully evaluate the role of this cytokine in diverse disease states with small scale.

Base Sequence↗
PubMed2001

CMV monitoring after peripheral blood stem cell and bone marrow transplantation by pp65 antigen and quantitative PCR.

We prospectively monitored 74 consecutive allogeneic and 50 autologous patients after bone marrow/stem cell transplantation from May 1999 to October 2000 at our institution with quantitative CMV PCR and pp65 antigen assay once weekly from conditioning therapy to days 120 and 80 after transplantation, respectively. Written informed consent was obtained from every patient. CMV prophylaxis consisted of acyclovir during transplant. Additionally all patients received only platelet products from CMV-negative donors. In the case of CMV infection preemptive therapy with gancyclovir was applied. In the case of CMV disease high-dose immunoglobulin was given as well. In the allogeneic setting 16 out of 74 (22%) patients developed a positive PCR. Seven episodes of a positive pp65 antigen assay occurred in six allograft recipients. In the autologous setting no positive assay was found during the whole observation period. Additionally, in 6/16 patients a lymphoproliferative assay was performed during CMV infection. Two patients showed a positive (15 and 5.4) and four a negative (2,1.6,1,1.8) stimulation index.

Adolescent↗
PubMed1996

Quantitative PCR of the immunoglobulin heavy chain gene using genomic DNA.

Techniques currently available enable the detection of clonal rearrangements of the immunoglobulin heavy chain gene using fluorescent PCR technology. It is possible to use this technique to analyse minimal residual disease throughout patient treatment: however, without the development of a quantitative assay, only the presence or absence of a clonal population can be determined. We describe here the development of a quantitative competitive PCR technique using genomic DNA which enables the rate of clearance of disease to be measured. In future, the ability to detect and also quantitate minimal residual disease may enhance the application of molecular investigations in the clinical management of patients.

DNA↗
PubMed2002

Determination of PCR efficiency in chelex-100 purified clinical samples and comparison of real-time quantitative PCR and conventional PCR for detection of Chlamydia pneumoniae.

BACKGROUND: Chlamydia pneumoniae infection has been detected by serological methods, but PCR is gaining more interest. A number of different PCR assays have been developed and some are used in combination with serology for diagnosis. Real-time PCR could be an attractive new PCR method; therefore it must be evaluated and compared to conventional PCR methods. RESULTS: We compared the performance of a newly developed real-time PCR with a conventional PCR method for detection of C. pneumoniae. The PCR methods were tested on reference samples containing C. pneumoniae DNA and on 136 nasopharyngeal samples from patients with chronic cough. We found the same detection limit for the two methods and clinical performance was equal for the real-time PCR and for the conventional PCR method, although only three samples tested positive. To investigate whether the low prevalence of C. pneumoniae among patients with chronic cough was caused by suboptimal PCR efficiency in the samples, PCR efficiency was determined based on the real-time PCR. Seventeen of twenty randomly selected clinical samples had similar PCR efficiency to samples containing pure genomic C. pneumoniae DNA. CONCLUSION: These results indicate that the performance of real-time PCR is comparable to that of conventional PCR, but this needs to be confirmed further. Real-time PCR can be used to investigate the PCR efficiency which gives a rough estimate of how well the real-time PCR assay work in a specific sample type. Suboptimal PCR efficiency of PCR is not a likely explanation for the low positivity rate of C. pneumoniae in patients with chronic cough.

Cation Exchange Resins↗
PubMed2005

Standardization strategy for quantitative PCR in human seminoma and normal testis.

Housekeeping genes are commonly used as endogenous references in quantitative RT-PCR. Ideally these genes are constitutionally expressed by all cell types and do not vary under experimental conditions. Tissues of 9 normal testes and 22 classical pure seminoma were obtained for RNA-extraction. Real-time RT-PCR was used to examine the mRNA-expression of ubiquitin C, beta-actin, GAPDH, 18S ribosomal RNA (18S rRNA) and porphobilinogen-deaminase (PBGD). Additionally, 3 normal testicular tissues and 39 seminoma, including 1 normal testis and 17 seminoma of the RT-PCR group, were utilized for microarray analyses. Ubiquitin C (protein degradation) was down-regulated, GAPDH (carbohydrate metabolism), beta-actin (cytoskeleton), 18S rRNA (ribosome) and PBGD (porphyrin metabolism) were up-regulated in seminoma. A normalization of the target gene data with up-regulated housekeeping genes would equalize or underestimate up-regulated data and overestimate down-regulated data. We demonstrate that none of the investigated housekeeping genes is suitable for normalization of the target gene RT-PCR data, but may be essential for tumor metabolism in human seminoma. Further, we developed a standardization strategy, which is applicable to many experimental investigations.

Biomarkers, Tumor↗