Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Diethyl Pyrocarbonate”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 343 records · Page 19Linked to original sources
PubMed1995

Inhibition of ligand binding to thromboxane A2/prostaglandin H2 receptors by diethylpyrocarbonate. Protection by receptor ligands and reversal by hydroxylamine.

The potential of histidines to modulate the binding of agonists and antagonists to human platelet thromboxane A2 (TXA2) receptors was investigated. TXA2 receptors were purified from crude platelet membranes via affinity and wheat germ lectin chromatography. Radioligand binding studies were conducted using the TXA2, mimetic [125I]BOP (I-BOP (I-BOP = [1S-(1 alpha,2 beta(5Z),3 alpha(1E, 3R*),4 alpha)]-7-[3-(3-hydroxy-4-(4'-iodophenoxy)-1-butenyl)7-oxabicyclo- [2.2.1]heptan-2-yl]-5-heptenoic acid) and the TXA2 receptor antagonist [125I]SAP (I-SAP = 7-[(1R,2S,3S,5R)-6,6-dimethyl-3-(4-iodobenzene- sulfonylamino)-bicyclo-[3.1.1]hept-2-yl]-(5Z)-heptenoic acid). The histidine modifying reagent diethyl-pyrocarbonate (DEPC) produced a concentration (30-100 microM) dependent inhibition of binding of both [125I]BOP and [125I]SAP. DEPC treatment significantly (P < 0.05, N = 6) decreased the affinity of the receptor for [125I]SAP (Kd = 2.4 +/- 0.4 and 5.4 +/- 0.4 nM, control and DEPC, respectively) without significantly decreasing the Bmax. The effects of DEPC were reversed by hydroxylamine. The inhibition of [125I]BOP and [125I]SAP binding produced by DEPC was reduced significantly by prior incubation of the purified receptors with the TXA2 receptor agonist U-46619 or the TXA2 receptor antagonist SQ 29548. The results strongly support the notion that one or more histidines reside in a domain that can modulate ligand binding to the TXA2 receptor.

Blood Platelets↗
PubMed1994

Metal-catalyzed oxidation of Fe2+ dehydrogenases. Consensus target sequence between propanediol oxidoreductase of Escherichia coli and alcohol dehydrogenase II of Zymomonas mobilis.

We have studied two enzymes of a newly described family of dehydrogenases with high sequence homology, 1,2-propanediol oxidoreductase of Escherichia coli and alcohol dehydrogenase II of Zymomonas mobilis. These enzymes perform their metabolic role under anaerobic conditions; in the presence of oxygen, they show a very similar inactivation pattern by a metal-catalyzed oxidation system. Titration of histidine residues with diethyl pyrocarbonate showed one histidine residue less in the oxidized enzymes. Comparison of subtilisin peptide maps of active and inactivated enzymes showed a difference in one histidine-containing peptide, the sequence of which is YNTPH277GVAN for propanediol oxidoreductase and YNLPH277GV for alcohol dehydrogenase II. This histidine residue lies 10 residues away from a proposed metal-binding site, H263XXXH267, necessary to explain a site-specific free radical mechanism. The three histidine residues here described are strictly conserved in all enzymes of this family. In this report we propose that histidine 277 is a target for oxidation by a metal-catalyzed oxidation system and that this modification leads to the irreversible inactivation of both enzymes.

Alcohol Dehydrogenase↗
PubMed1998

Analysis of a curved DNA constructed from alternating dAn:dTn-tracts in linear and supercoiled form by high resolution chemical probing.

Complex of osmium tetroxide and bipyridine (Os,bipy), KMnO4, and diethyl pyrocarbonate (DEPC) were used to probe curved DNA at single nucleotide resolution. The DNA was constructed from repeated dAn:dTn-blocks with dATATA and dAGAGA interblock sequences. The DNA was probed in the linear and supercoiled form at various salt concentrations. While all purines were available for DEPC attack, the thymines within the blocks were resistant to chemical probing by KMnO4 and Os,bipy. Only the 3'-flanking dTs were available for modification. The thymines within dTC and dTA sequences showed modification indicating that these thymines display an unstacked structure allowing both probes to attack. Under destabilizing conditions, at low ionic strength and superhelical stress, considerable unstacking was observed. We found experimental indications that under these destabilizing conditions unpaired regions might appear, probably within the dATATA sequence.

DNA, Superhelical↗
PubMed2001

In situ hybridization: use of 35S-labeled probes on paraffin tissue sections.

The following protocol is for radioactive in situ hybridization detection of RNA using paraffin-embedded tissue sections on glass microscope slides. Steps taken to inhibit RNase activity such as diethyl pyrocarbonate (DEPC) treatment of solutions and baked glassware are unnecessary. The tissue is fixed using 4% paraformaldehyde, hybridized with (35)S-labeled RNA probes, and exposed to nuclear-track emulsion. The entire procedure takes 2-3 days prior to autoradiography. The time required for autoradiography is variable with an average time of 10 days. Parameters that affect the length of the autoradiography include: (1) number of copies of mRNA in the tissue, (2) incorporation of label into the probe, and (3) amount of background signal. Additional steps involved in the autoradiography process, including development of the emulsion, cleaning of the microscope slides, counterstaining of the tissue, and mounting coverslips on the microscope slides, are discussed. In addition, a general guide to the interpretation of the in situ results is provided.

Acetic Anhydrides↗
PubMed1982

Enzymatic and chemical structure mapping of mouse 28S ribosomal ribonucleic acid contacts in 5.8S ribosomal ribonucleic acid.

Secondary structure mapping experiments using S1 nuclease, RNase T1, and diethyl pyrocarbonate as conformational probes have identified those regions in mouse 5.8S rRNA containing major sites of interaction with 28S rRNA. One site encompasses the 3'-terminal 20 nucleotides and corresponds to the region identified previously as a component of an RNase-resistant 5.8S/28S rRNA junction complex. A second site, located at the 5' terminus, has not been defined precisely but is believed to involve approximately 20--30 nucleotides. The existence of these sites of interaction is supported by comparing sequences of eukaryotic 5.8S and 28S rRNA with those of the prokaryotic 23S rRNA. Evidence for the occurrence of at least three helical regions in the central portion of the mouse 5.8S rRNA molecule is also presented.

Animals↗
PubMed1977

A study of the ionic properties of the essential histidine residue of yeast alcohol dehydrogenase in complexes of the enzyme with its coenzymes and substrates.

1. Initial-rate studies of the reduction of acetaldehyde by NADH, catalysed by yeast alcohol dehydrogenase, were performed at pH 4.9 and 9.9, in various buffers, at 25 degrees C. The results are discussed in terms of the mechanism previously proposed for the pH range 5.9-8.9 [Dickenson & Dickinson (1975) Biochem. J. 147, 303-311]. 2. Acetaldehyde forms a u.v.-absorbing complex with glycine. This was shown not to affect the results of kinetic experiments under the conditions used in this and earlier work. 3. The variation with pH of the dissociation constant for the enzyme-NADH complex, calculated from the initial-rate data, indicates that the enzyme possesses a group with pK7.1 in the free enzyme and pK8.7 in the complex. 4. The pH-dependences of the second-order rate constants for inactivation of the enzyme by diethyl pyrocarbonate were determined for the free enzymes (pK7.1), the enzyme-NAD+ complex (pK approx. 7.1) and the enzyme-NADH complex (pK approx. 8.4). The essential histidine residue may therefore be the group involved in formation and dissociation of the enzyme-NADH complex. 5. Estimates of the rate constant for reaction of acetaldehyde with the enzyme-NADH complex indicate that acetaldehyde may combine only when the essential histidine residue is protonated. The dissociation constants for butan-1-ol and propan-2-ol, calculated on the basis of earlier kinetic data, are, however, independent of pH. 6. The results obtained are discussed in relation to the role of the essential histidine residue in the mechanism of formation of binary and ternary complexes of the enzyme with its coenzymes and substrates.

Acetaldehyde↗
PubMed1995

The fragile X syndrome single strand d(CGG)n nucleotide repeats readily fold back to form unimolecular hairpin structures.

Expansion of a d(CGG)n run within the 5'-untranslated region of the X-linked human gene FMR1 blocks FMR1 transcription, delays its replication, and precipitates the fragile X syndrome. We showed previously that d(CGG)n tracts aggregate into interstrand tetrahelical complexes (Fry, M., and Loeb, L. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4950-4954). Here we show that these sequences also form under physiological conditions in in vitro unimolecular hairpin structures. Folding is demonstrated by temperature-dependent mobility of d(CGG)n oligomers in a nondenaturing polyacrylamide gel, by UV-hyperchromicity of thermally denaturing oligomers, and by UV cross-linking of compact forms of d(CGG)n runs interspersed by thymidine clusters. That the compact d(CGG)n structures are unimolecular is suggested by their zero-order kinetics of formation. Diethyl pyrocarbonate modification reveals a single, 4-5 residue-long central or epicentral unpaired loop in folded d(CGG)n oligomers. The position of this loop remains unchanged by insertion of thymidine clusters into 15- or 33-mer d(CGG) tracts as indicated by KMnO4 probing of unpaired thymidines. The presence of a single loop in folded d(CGG)n oligomers and the accessibility of every guanine to dimethyl sulfate modification suggest that they are hairpin and not tetraplex structures. Modeling indicates that different d(CGG)n hairpins are stabilized by guanine-guanine Hoogsteen hydrogen bonds or by Hoogsteen and Watson-Crick bonds. If formed in vivo, d(CGG)n hairpins could entail slippage and trinucleotide expansion during replication and could obstruct FMR1 gene transcription and replication.

Base Sequence↗
PubMed1994

Reaction of a biscationic distamycin-ellipticine hybrid ligand with DNA. Mode and sequence specificity of binding.

Molecular modeling of complexes between the octanucleotide d(CGATATCG)2 and either a monocationic or biscationic distamycin-ellipticine hybrid molecule predicted that the extra positive charge on the latter conjugate ligand should ensure tight fitting into the minor groove of the duplex without affecting intercalation of the ellipticine chromophore. To test this prediction, we have synthesized a biscationic compound Distel (2+) and investigated its interaction with DNA using various optical and gel electrophoresis techniques. Viscosity, fluorescence lifetime, and circular and linear dichroism measurements bear out the validity of the calculations and show that Distel (2+) does indeed come to lie with its distamycin moiety in the minor groove of DNA and its ellipticine ring intercalated nearby. Linear dichroism experiments with a range of polynucleotides indicate that, unlike its monocationic homologue, the biscationic ligand engages in bidentate binding to AT sequences but not to GC sequences. Footprinting studies employing DNase I and methidiumpropyl-EDTA.FeII as DNA cleaving agents reveal that the biscationic hybrid is notably selective for AT-rich sequences in DNA. The concentrations required to detect a clear footprint at AT sites with Distel (2+) are 4- to 10-fold lower than those required to produce comparable DNase I footprints with distamycin alone. Also, in accord with the energy-minimized model of the hybrid-oligonucleotide complex, chemical probing experiments using diethyl pyrocarbonate and osmium tetroxide reveal that the hybrid causes significant distortion of the DNA helix, explicable in terms of bending of the duplex toward the minor groove, which greatly enhances the reactivity toward probes in the major groove of the DNA. The experimental results help to identify the determinant factors, predominantly steric and electrostatic interactions, which shape the DNA-binding reaction. Thus, molecular modeling has correctly predicted the DNA-binding properties of a doubly charged ligand and shown that appending an auxiliary basic group onto the distamycin moiety was the right way to proceed in order to convert a nonspecific conjugate into a highly specific DNA reader.

Animals↗
PubMed2004

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin.

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.

Base Sequence↗
PubMed1997

Separate bisphosphatase domain of chicken liver 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase: the role of the C-terminal tail in modulating enzyme activity.

The separate bisphosphatase domain (amino acid residues 243-468) of the chicken liver bifunctional enzyme 6-phosphofructo-2-kinase-fructose-2,6-bisphosphatase was expressed in Escherichia coli and purified to homogeneity. The fructose-2, 6-bisphosphatase activity of the separate domain was 7-fold higher than that of the native bifunctional enzyme, and exhibited substrate inhibition characteristic of the native enzyme. The inhibition of the enzymes by fructose 2,6-bisphosphate could be overcome by Pi, glycerol 3-phosphate and GTP. Deletion of 30 amino acid residues from the C-terminus of the separate domain resulted in around a 5-fold increase in the Vmax of the bisphosphatase. Also, the truncated form was more accessible to chemical modification by diethyl pyrocarbonate and N-ethylmaleimide, suggesting a more open structure than the wild-type form. In addition, the mutation of cysteine-389 to alanine increased bisphosphatase activity by 20% and the Km value for fructose 2,6-bisphosphate by 3-fold, and both the point mutation at cysteine-389 and the deletional mutation led to the predominantly insoluble expression of the enzyme. The results indicated that the C-terminal tail plays a role in modulating the enzyme activity and suggested that the difference in the C-terminal tail sequence is responsible for the difference in activity of the chicken and rat liver fructose-2,6-bisphosphatases. It is postulated that an interaction between the C-terminal tail and the active site might be present.

Animals↗
PubMed1995

Expression and purification of two isozymes of clavaminate synthase and initial characterization of the iron binding site. General error analysis in polymerase chain reaction amplification.

Clavaminate synthase is an Fe(2+)-, O2-, and alpha-ketoglutarate-dependent oxygenase that catalyzes three transformations in the biosynthesis of the important beta-lactamase inhibitor clavulanic acid. The genes from Streptomyces clavuligerus encoding two isoenzymes of clavaminate synthase have been over-expressed in Escherichia coli to give soluble proteins whose reactions, kinetic properties, and molecular masses are in excellent agreement with the wild-type isozymes. Preliminary investigation of the active site of clavaminate synthase was undertaken using diethyl pyrocarbonate and N-ethylmaleimide. Each was inhibitory to catalytic activity. Protection from inactivation in the presence of these reagents by Fe2+, O2, and alpha-ketoglutaric acid was thwarted by the rapid self-inactivation of the enzyme in the absence of substrate. However, protection was achieved when Co2+, a potent competitive inhibitor of clavaminate synthase 2 with respect to Fe2+, was substituted. This is consistent with the presence of histidine and cysteine, respectively, at or near the active site and possibly involved in iron binding. In the course of constructing the expression vector, a simply applied general error analysis of the polymerase chain reaction was formulated to calculate the proportion of correctly replicated DNA and guide the design of experiments using this method.

Base Sequence↗
PubMed1997

Site directed mutagenesis of histidine residues in anthrax toxin lethal factor binding domain reduces toxicity.

Anthrax lethal toxin is a mixture of protective antigen (PA, 735 AA) and lethal factor (LF, 776 AA). Earlier studies have shown that 254 residues of lethal factor are sufficient for PA binding to cause internalization (Arora N and Leppla SH, J Biol Chem 268: 3334-3342, 1993). The present study was undertaken to determine residues which are important for binding of LF to PA. LF modification with diethyl pyrocarbonate (DEPC, modifies histidine residue primarily) results in the loss of binding and toxicity in mammalian cells. There are nine histidine residues in the binding domain. To locate the important residue(s), site-directed mutagenesis of these histidines were performed by recombinant methods. Replacement of His42 with Gly42 destablizes the protein and hence it could not be purified. His35 when mutagenized to Gly35 (mLF-DTA) diminishes the toxicity by 20 fold. Time dependent studies show that binding of mLF-DTA was reduced at shorter incubations and longer incubations taper off this difference. Gel shift assay suggested 8-10% less binding of mLF-DTA as compared to LF-DTA. In conclusion His35 is important for binding and His42 is critical and confers proper conformation for LF binding to PA.

Animals↗
PubMed1987

Effects of ribosome dissociation on the structure of the ribosome-associated 5.8S RNA.

Diethyl pyrocarbonate reactivity and thermal denaturation were used to probe potential ribosomal interactions between tRNA and the small 5.8S and 5S rRNAs. Puromycin, an analogue of the terminal aminoacyl-adenosine portion of aminoacyl-tRNA, was observed to increase the accessibility of the 5.8S rRNA, including the highly conserved GAACp sequences. EDTA which releases both tRNA and the 5S rRNA-protein complex resulted in an even greater accessibility in the 5.8S rRNA. The thermal dissociation of whole ribosomes resulted in the release of all three RNAs, with a striking similarity in the denaturation profiles. These results strongly suggest an interdependence in the ribosome-associated structures of the small rRNAs and provide in situ evidence for the various 5S rRNA, 5.8S rRNA, and tRNA containing ribonucleoprotein complexes previously reconstituted through affinity chromatography.

Base Sequence↗
PubMed2001

Evidence for an essential histidine residue in the ascorbate-binding site of cytochrome b561.

Cytochrome b(561) mediates equilibration of the ascorbate/semidehydroascorbate redox couple across the membranes of secretory vesicles. The cytochrome is reduced by ascorbic acid and oxidized by semidehydroascorbate on either side of the membrane. Treatment with diethyl pyrocarbonate (DEPC) inhibits reduction of the cytochrome by ascorbate, but this activity can be restored by subsequent treatment with hydroxylamine, suggesting the involvement of an essential histidine residue. Moreover, DEPC inactivates cytochrome b(561) more rapidly at alkaline pH, consistent with modification of a histidine residue. DEPC does not affect the absorption spectrum of cytochrome b(561) nor does it change the midpoint reduction potential, confirming that histidine modification does not affect the heme. Ascorbate protects the cytochrome from inactivation by DEPC, indicating that the essential histidine is in the ascorbate-binding site. Further evidence for this is that DEPC treatment inhibits oxidation of the cytochrome by semidehydroascorbate but not by ferricyanide. This supports a reaction mechanism in which ascorbate loses a hydrogen atom by donating a proton to histidine and transferring an electron to the heme.

Animals↗
PubMed1993

Interactions of three strands in joints made by RecA protein.

RecA protein from Escherichia coli has been used to form a triple-stranded DNA structure from either single-stranded M13 DNA or a single-stranded oligonucleotide plus a duplex oligonucleotide with a hairpin loop. The secondary structure of purified deproteinized triplex was examined by probing with DNase I, P1 nuclease, potassium permanganate, and diethyl pyrocarbonate. The two strands destined to form heteroduplex DNA showed the same patterns of chemical modification and enzymatic digestion as control duplex DNA, indicating that they formed a normal duplex substructure. However, the nascent outgoing strand showed properties consistent with a novel triplex structure: most of its purine residues, especially adenines, were hyperreactive to all probes. The patterns of digestion by DNase I and P1 nuclease indicated that the nascent outgoing strand was not a freely mobile or single-stranded branch but rather was still interacting with the newly formed heteroduplex DNA. On the basis of the planar base triads proposed previously (Rao et al., 1993) and energy minimization of a third strand in the major groove of B-form DNA, we derived a model that helps to rationalize the properties revealed by chemical and enzymatic probing.

Bacteriophage M13↗
PubMed1989

Single base mismatches in DNA. Long- and short-range structure probed by analysis of axis trajectory and local chemical reactivity.

We have devised a procedure to generate any single base mismatch in a constant sequence context, and have studied these from two points of view. (1) We have examined electrophoretic mobility of 458 base-pair fragments containing approximately centrally located single mismatches, in polyacrylamide gels, compared to fully matched DNA fragments. We found that no single mismatch caused a significant perturbation of gel mobility, and we conclude that all the mismatches may be accommodated within a helical geometry such that there is no alteration of the path of the helix axis in a straight DNA molecule. (2) We have studied all the single mismatches with respect to reactivity to a number of chemical probes. We found that: (a) No mispaired adenine bases are reactive to diethyl pyrocarbonate and are therefore not simply unpaired such that N-7 is exposed. (b) A number of mispaired thymine bases are reactive to osmium tetroxide, and cytosine bases to hydroxylamine. (c) Where crystal or nuclear magnetic resonance structures are available, the reactivity correlates with exposure of the pyrimidine 5,6 double bonds to attack in the major groove as a result of wobble base-pair formation. This is particularly clear for G.T and I.T base-pairs. (d) Reactivity of bases in mismatched pairs can be dependent on sequence context. (e) Reactivity of the C.C mismatch to hydroxylamine is suppressed at low pH, suggesting that a rearrangement of base-pairing occurs on protonation. The results overall are consistent with the formation of stacked intrahelical base-pairs wherever possible, resulting in no global distortion of the DNA structure, but specific enhancement of chemical reactivity in some cases.

Base Composition↗
PubMed1989

Binding of nuclear factor EF-C to a functional domain of the hepatitis B virus enhancer region.

Nuclear factor EF-C is present in extracts prepared from human HepG2 liver cells and from other, nonliver cell lines and binds to the hepatitis B virus and polyomavirus transcriptional enhancer regions in vitro. An inverted repeat (5'-GTTGCNNNGCAAC-3') is located within both binding regions. Diethyl pyrocarbonate interference binding assays and competition binding experiments using altered binding sites demonstrated that EF-C contacts symmetrical nucleotides within the inverted repeat. Mutations that changed the length of the spacer region between the arms of the inverted repeat were introduced in the hepatitis enhancer region. Introduction of 1 or 2 base pairs between the repeats did not affect EF-C binding, but deletion of 1 base pair or introduction of 3 to 9 base pairs reduced binding dramatically. Introduction of 10 base pairs restored partial EF-C binding ability. These and other results suggest that EF-C binding is stabilized by dimerization. In vivo assays for enhancer function using these mutants demonstrated that the EF-C binding site is a functional and important component of the hepatitis B virus enhancer region.

Base Composition↗
PubMed1999

Identification of three cysteines as targets for the Zn2+ blockade of the human skeletal muscle chloride channel.

Currents through the human skeletal muscle chloride channel hClC-1 can be blocked by external application of 1 mM Zn2+ or the histidine-reactive compound diethyl pyrocarbonate (DEPC). The current block by Zn2+ strongly depends on the external pH (pKa near 6.9), whereas the block by DEPC is rather independent of the pH in the range of 5.5 to 8.5. To identify the target sites of these reagents, we constructed a total of twelve cysteine- and/or histidine-replacement mutants, transfected tsA201 cells with them, and investigated the resulting whole-cell chloride currents. The majority of the mutants exhibited a similar sensitivity toward Zn2+ or DEPC as wild type (WT) channels. Block by 1 mM Zn2+ was nearly absent only with the mutant C546A. Four mutants (C242A, C254A, H180A, and H451A) were slightly less sensitive to Zn2+ than WT. Tests with double, triple, and quadruple mutants yielded that, in addition to C546, C242 and C254 are also most likely participating in Zn2+-binding.

Cell Line↗