Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Response Elements”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 325 records · Page 18Linked to original sources
PubMed2003

A binuclear zinc transcription factor binds the host isoflavonoid-responsive element in a fungal cytochrome p450 gene responsible for detoxification.

The PDA1 gene of the filamentous fungus Nectria haematococca MPVI (anamorph: Fusarium solani) encodes pisatin demethylase, a cytochrome P450. Pisatin is a fungistatic isoflavonoid produced by garden pea (Pisum sativum), a host for this fungus. Pisatin demethylase detoxifies pisatin and functions as a virulence factor for this fungus. Pisatin induces PDA1 expression both in cultured mycelia as well as during pathogenesis on pea. The regulatory element within PDA1 that provides pisatin-responsive expression was identified using a combination of in vivo functional analysis and in vitro binding analysis. The 40 bp pisatin-responsive element is located 635 bp upstream of the PDA1 transcription start site. This element was sufficient to provide strong pisatin-induced expression to a minimal promoter in vivo and was required for pisatin regulation of the PDA1 promoter. A gene encoding a DNA-binding protein specific to this 40 bp element was isolated from a N. haematococca cDNA library using the yeast one-hybrid screen. The cloned gene possesses sequence motifs found in the binuclear zinc (Cys 6-Zn 2) family of transcription factors unique to fungi. The results suggest that it is a regulator of this fungal cytochrome P450 gene and may provide pisatin-responsive regulation.

Antiprotozoal Agents↗
PubMed1995

Ligand-dependent and -independent transactivation by thyroid hormone receptor beta 2 is determined by the structure of the hormone response element.

Chicken thyroid hormone receptor beta 2 (cTR beta 2) is likely to serve specific functions in gene regulation since it possesses a unique N-terminal domain and is expressed in very few tissues. We demonstrate here that TR beta 2 exhibits distinct transactivation properties which are dependent on the availability of ligand and on the structure of the hormone response element. First, a strong ligand-independent transactivation was observed with hormone response elements composed of direct repeats and everted repeats. Second, TR beta 2 was induced by triiodothyronine to transactivate more efficiently than TR beta 0 on palindromic and everted-repeat types of hormone response elements. However, coexpression of the retinoid X receptor reduced the strong transactivation by TR beta 2 but not by TR beta 0 via palindromic response elements, suggesting that TR beta 2 can transactivate as a homodimer. Finally, the N terminus of TR beta 2 contains two distinct transactivation regions rich in tyrosines, which are essential for transactivation. Our results thus show that the activity of the novel transactivating region of TR beta 2 is dependent on the organization of the half-sites in the response element.

Amino Acid Sequence↗
PubMed1996

Identification of an estrogen response element activated by metabolites of 17beta-estradiol and raloxifene.

17beta-Estradiol modulates gene transcription through the estrogen receptor and the estrogen response element in DNA. The human transforming growth factor-beta3 gene was shown to be activated by the estrogen receptor in the presence of estrogen metabolites or estrogen antagonists. Activation was mediated by a polypurine sequence, termed the raloxifene response element, and did not require the DNA binding domain of the estrogen receptor. Interaction of the estrogen receptor with the raloxifene response element appears to require a cellular adapter protein. The observation that individual estrogens modulate multiple DNA response elements may explain the tissue-selective estrogen agonist or antagonist activity of compounds such as raloxifene.

Base Sequence↗
PubMed2001

Tyrphostin [correction of Tryphostin] AG879, a tyrosine kinase inhibitor: prevention of transcriptional activation of the electrophile and the aromatic hydrocarbon response elements.

To investigate a possible role of phosphorylation in the signal transduction pathways responsible for transcriptional regulation of drug-metabolizing enzymes, we tested seven specific tyrosine kinase inhibitors (tyrphostins) for their effects on NAD(P)H:quinone oxidoreductase-1 (NQO1) mRNA levels in mouse hepatoma Hepa-1c1c7 (Hepa-1) cells and chose to study AG879 further. The potent electrophile tert-butylhydroquinone (tBHQ) is known to activate NQO1 gene transcription via the electrophile response element (EPRE). Among the tyrphostins tested, tyrphostin AG879 was unique in preventing the accumulation of tBHQ-induced NQO1 mRNA; this effect was dependent on the AG879 dose and was also sensitive to the time when AG879 was added relative to the beginning of tBHQ treatment. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (dioxin; TCDD) is known to activate Cyp1a1 gene transcription by way of aromatic hydrocarbon response elements (AHREs). We found that AG879 also prevents, to a lesser extent, the AHRE-mediated induction of CYP1A1 and NQO1 mRNA by dioxin. Zinc or cadmium is known to activate metallothionein (Mt1) gene transcription via the metal response element (MRE). AG879 induced MT1 mRNA, and AG879 did not block zinc- or cadmium-induced MT1 mRNA, indicating that the effects of AG879 on NQO1 or CYP1A1 mRNA levels cannot be generalized to all transcripts. Using transient transfection of EPRE-, AHRE-, or MRE-driven luciferase reporter gene constructs in Hepa-1 cells, we showed that the inhibitory effects of AG879 occurred at the level of EPRE- and AHRE-mediated transcription, but that AG879 did not affect the MRE-driven transcriptional response. These data suggest that AG879 might inhibit an unknown tyrosine kinase(s) whose activity is essential for EPRE- and AHRE-mediated trans-activation of certain mammalian genes. These results also indicate that some sharing of common signal transduction pathways might exist in the regulation of genes involved in drug metabolism that also respond to oxidative stress.

Animals↗
PubMed2002

Spontaneous calcium oscillations control c-fos transcription via the serum response element in neuroendocrine cells.

In excitable cells the localization of Ca2+ signals plays a central role in the cellular response, especially in the control of gene transcription. To study the effect of localized Ca2+ signals on the transcriptional activation of the c-fos oncogene, we stably expressed various c-fos beta-lactamase reporter constructs in pituitary AtT20 cells. A significant, but heterogenous expression of c-fos beta-lactamase was observed in unstimulated cells, and a further increase was observed using KCl depolarization, epidermal growth factor (EGF), pituitary adenylate cyclase-activating polypeptide (PACAP), and serum. The KCl response was almost abolished by a nuclear Ca2+ clamp, indicating that a rise in nuclear Ca2+ is required. In contrast, the basal expression was not affected by the nuclear Ca2+ clamp, but it was strongly reduced by nifedipine, a specific antagonist of l-type Ca2+ channels. Spontaneous Ca2+ oscillations, blocked by nifedipine, were observed in the cytosol but did not propagate to the nucleus, suggesting that a rise in cytosolic Ca2+ is sufficient for basal c-fos expression. Inactivation of the c-fos promoter cAMP/Ca2+ response element (CRE) had no effect on basal or stimulated expression, whereas inactivation of the serum response element (SRE) had the same marked inhibitory effect as nifedipine. These experiments suggest that in AtT20 cells spontaneous Ca2+ oscillations maintain a basal c-fos transcription through the serum response element. Further induction of c-fos expression by depolarization requires a nuclear Ca2+ increase.

Animals↗
PubMed1997

Interactions of estrogen- and thyroid hormone receptors on a progesterone receptor estrogen response element (ERE) sequence: a comparison with the vitellogenin A2 consensus ERE.

The identification of hormone response elements in the promoter regions of hormonally regulated genes has revealed a striking similarity between the half-site of the estrogen-response element (ERE) and a consensus sequence constituting the thyroid hormone-response element. Because of the potential for thyroid hormone (T3) to affect estrogen (E)- and progesterone-dependent female reproductive behavior via EREs, we have begun to investigate the activity of an ERE identified in the progesterone receptor (PR) proximal promoter and its interactions with the estrogen receptor (ER) and thyroid hormone receptors (TR). In addition, we have compared ER and TR interactions on the PR ERE construct with that of the vitellogenin A2 (vit A2) consensus ERE. Electrophoretic mobility shift assays demonstrated that TR binds to the PR ERE as well as to the consensus ERE sequence in vitro. Further, these two EREs were differentially regulated by T3 in the presence of TR. T3 in the presence of TR alpha increased transcription from a PR ERE construct approximately 5-fold and had no inhibitory effect on E induction. Similarly, T3 also activated a beta-galactosidase reporter construct containing PR promoter sequences spanning -1400 to +700. In addition, the TR isoforms beta1 and beta2 also stimulated transcription from the PR ERE construct by 5- to 6-fold. A TR alpha mutant lacking the ability to bind AGGTCA sequences in vitro failed to activate transcription from the PR ERE construct, demonstrating dependence on DNA binding. In contrast to its actions on the PR ERE construct, TR alpha did not activate transcription from the vit A2 consensus ERE but rather attenuated E-mediated transcriptional activation. Attenuation from the vit A2 consensus ERE is not necessarily dependent on DNA binding as the TR alpha DNA binding mutant was still able to inhibit E-dependent transactivation. In contrast to TR alpha, the isoforms TRbeta1 and TRbeta2 failed to inhibit E-induced activation from the vit A2 consensus ERE. These results demonstrate that the PR ERE construct differs from the vit A2 consensus ERE in its ability to respond to TRs and that divergent pathways exist for activation and inhibition by TR. Since ERs, PRs, and TRs are all present in hypothalamic neurons, these findings may be significant for endocrine integration, which is important for reproductive behavior.

Animals↗
PubMed2002

Open reading frame 50 protein of Kaposi's sarcoma-associated herpesvirus directly activates the viral PAN and K12 genes by binding to related response elements.

Open reading frame (ORF) 50 protein is capable of activating the entire lytic cycle of Kaposi's sarcoma-associated herpesvirus (KSHV), but its mechanism of action is not well characterized. Here we demonstrate that ORF 50 protein activates two KSHV lytic cycle genes, PAN (polyadenylated nuclear RNA) and K12, by binding to closely related response elements located approximately 60 to 100 nucleotides (nt) upstream of the start of transcription of the two genes. The 25-nt sequence 5' AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. The responsive region of DNA can be transferred to a heterologous minimal promoter. Extensive point mutagenesis showed that a span of at least 20 nt is essential for a response to ORF 50 protein. However, a minimum of six positions within this region were ambiguous. The related 26-nt responsive element in the K12 promoter (K12p), 5' GGAAATGGGTGGCTAACCCCTACATA, shares 20 nt (underlined) with the comparable region of PANp. The divergence is primarily at the 3' end. The DNA binding domain of ORF 50 protein, encompassing amino acids 1 to 490, fused to a heterologous activation domain from herpes simplex virus VP16 [ORF 50(1-490)+VP] can mediate activation of reporter constructs bearing these response elements. Most importantly, ORF 50(1-490)+VP can induce PAN RNA and K12 transcripts in transfected cells. ORF 50(1-490)+VP expressed in human cells binds specifically to duplex oligonucleotides containing the responsive regions from PANp and K12p. These DNA-protein complexes were supershifted by antibody to VP16. ORF 50(1-490) without a VP16 tag also bound to the response element. There was a strong correlation between DNA binding by ORF 50 and transcriptional activation. Mutations within PANp and K12p that impaired transactivation by ORF 50 or ORF 50(1-490)+VP also abolished DNA binding. Only one of eight related complexes formed on PANp and K12p oligonucleotides was due to ORF 50(1-490)+VP. The other complexes were due to cellular proteins. Two KSHV lytic-cycle promoters are activated by a similar mechanism that involves direct recognition of a homologous response element by the DNA binding domain of ORF 50 protein in the context of related cellular proteins.

Base Sequence↗
PubMed2000

Ligand-triggered stabilization of vitamin D receptor/retinoid X receptor heterodimer conformations on DR4-type response elements.

Nuclear receptors integrate an incoming signal in the form of a nuclear hormone by undergoing a conformational change that results via co-activator proteins in an activation of the basal transcriptional machinery. The vitamin D(3) receptor is the nuclear receptor for 1alpha,25-dihydroxyvitamin D(3 )(1alpha,25(OH)(2)D(3)) and is known to function as a heterodimer with the retinoid X receptor on DR3-type 1alpha,25(OH)(2)D(3) response elements. Here, it could be demonstrated that DR4-type response elements are at least as effective as DR3-type 1alpha,25(OH)(2)D(3) response elements. Gel shift clipping analysis showed that vitamin D(3) receptor-retinoid X receptor heterodimers form in response to 1alpha, 25(OH)(2)D(3) and retinoid X receptor ligands, the pan-agonist 9-cis retinoic acid (9cRA) and the retinoid X receptor-selective retinoid CD2425, different conformations on the DR4-type element of the rat Pit-1 gene. Interestingly, on this response element the heterodimeric complexes of retinoid X receptor with the thyroid hormone receptor, the retinoic acid receptor and the benzoate ester receptor also displayed characteristic individual ligand-dependent complex formation. On the level of complex formation, utilizing DNA affinity and functional assays, only vitamin D(3) receptor-retinoid X receptor heterodimers showed a synergistic interaction of both ligands. However, the sensitivity of vitamin D(3) receptor-retinoid X receptor heterodimers to 1alpha,25(OH)(2)D(3) was found to be much higher than to retinoid X receptor ligands. Taken together, this study demonstrates a unique interaction potential of vitamin D(3) receptor and retinoid X receptor but also establishes DR4-type response elements as multi-functional DNA binding sites with a potential to integrate various hormone signalling pathways.

Animals↗
PubMed1999

Cyclic AMP-responsive element binding protein in brain mitochondria.

Cyclic AMP-responsive element binding protein (CREB) is critically involved in many important brain functions, including the formation of long-term memory. CREB is the best characterized member of a family of transcription factors (CREB/ATF family) recognized to be important nuclear targets for intracellular signal transduction systems. Here we show, by using different approaches, that CREB is unexpectedly localized to mitochondria of the rat brain. Controlled subcellular fractionation of hippocampus and cerebral cortex showed that both synaptic and nonsynaptic mitochondria exhibited immunoreactivity to the phosphorylated form of CREB (pCREB). Moreover, CREB extracted from synaptic mitochondria is able to be phosphorylated by the catalytic subunit of protein kinase A and dephosphorylated by protein phosphatase 1 or 2B. DNA mobility shift assays showed the presence of binding activity to the calcium-cyclic AMP-responsive element in mitochondrial extracts from hippocampus; this binding complex was specifically supershifted by an anti-CREB antibody. Immunoelectron microscopic analysis of hippocampal subcellular fractions revealed that pCREB immunoreactivity is localized in close association with the inner mitochondrial membrane. These results, together with recent findings describing the presence and phosphorylation of CREB in developing dendrites, suggest that CREB may participate in different mechanisms involved in the communication between extracellular signals and the expression of genes.

Animals↗
PubMed1998

Multiple parameters determine the specificity of transcriptional response by nuclear receptors HNF-4, ARP-1, PPAR, RAR and RXR through common response elements.

A number of nuclear receptors, including retinoic acid receptors (RARs), retinoid-X receptors (RXRs), hepatocyte nuclear factor 4 (HNF-4), chicken ovalbumin upstream promoter transcription factor I (COUP-TFI), apolipoprotein regulatory protein 1 (ARP-1) and peroxisome proliferator-activated receptor (PPAR), bind to response elements comprised of two core motifs, 5'-RG(G/T)TCA, or a closely related sequence separated by 1 nt (DR1 elements). The potential role of the precise sequence of the core motif as well as the spacer nucleotide in determining specificity and promiscuity of receptor-response element interactions was investigated. We show here that nucleotides at base positions 1, 2 and 4 of the core motif as well as the spacer nucleotide determine the binding preference of HNF-4 and ARP-1 homodimers and RAR:RXR and PPAR:RXR heterodimers. In transfection experiments transcriptional activation by HNF-4 and PPAR:RXR and repression by ARP-1 correlated with the relative in vitro binding affinity provided the element was located within the proper promoter context. Furthermore, promoter context also determined whether an element that binds to HNF-4 and PPAR:RXR with equal affinity functions as an HNF-4 response element or PPAR response element. Thus, apart from the element-specific differences in affinity for the receptors, additional promoter-specific transcription factors that interact with HNF-4 and PPAR:RXR determine the specificity of transcriptional response through DR1-type elements.

Animals↗
PubMed1994

A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements.

We have identified and characterized a new orphan member of the nuclear hormone receptor superfamily, called MB67, which is predominantly expressed in liver. MB67 binds and transactivates the retinoic acid response elements that control expression of the retinoic acid receptor beta 2 and alcohol dehydrogenase 3 genes, both of which consist of a direct repeat hexamers related to the consensus AGGTCA, separated by 5 bp. MB67 binds these elements as a heterodimer with the 9-cis-retinoic acid receptor, RXR. However, MB67 does not bind or activate other retinoic acid response elements with alternative hexamer arrangements or any of several other wild-type and synthetic hormone response elements examined. The transactivation of retinoic acid response elements by MB67 is weaker than that conferred by the retinoic acid receptors but does not require the presence of all-trans retinoic acid, 9-cis-retinoic acid, or any exogenously added ligand. We propose that MB67 plays an important role in the complex network of proteins that govern response to retinoic acid and its metabolites.

Amino Acid Sequence↗
PubMed1996

Retinoid X receptor isotype identity directs human vitamin D receptor heterodimer transactivation from the 24-hydroxylase vitamin D response elements in yeast.

Unlike estrogen and progesterone receptors that operate as homodimers on response elements, retinoid X receptors (RXRs) and vitamin D receptors (VDRs) can function as heterodimers. Studies concerning the significance of heterodimeric partnerships are usually performed utilizing mammalian or insect cells. These cells express endogenous nuclear receptors, making it impossible to assign a role for one receptor subtype over another while studying the function of transfected receptor(s). Yeast lacks endogenous VDRs and RXRs and their ligands and provides a unique cellular context to study nuclear receptor function. We examined the interaction between human VDR and human RXR alpha, mouse RXR beta 2, and mouse RXR gamma to identify physiologically important receptor interactions. DNA binding studies on consensus, osteocalcin, or the rat 24-hydroxylase vitamin D response elements (VDREs) indicated that although RXR complexes can form on the consensus DNA elements, RXR:VDR heterodimers preferentially interact with the natural VDREs. The interaction is RXR isotype-specific and affected by ligands. Transactivation studies using the rat 24-hydroxylase VDREs indicated that VDR preferentially associated with RXR alpha or RXR gamma to stimulate transcription, and the activity was potentiated by ligand. Although RXR beta 2:VDR bound tightly to DNA, the resulting heterodimer transactivated poorly. The regulation of the 24-hydroxylase promoter observed in yeast is similar with respect to transactivation potential of specific VDRE and fold activation observed in osteosarcoma cells. Ligand binding to both receptors in a RXR:VDR complex is required for maximal transcriptional activity, indicating that the isotype-specific RXR partner significantly contributes to the ability of RXR:VDR heterodimers to transactivate from target response elements in yeast.

Animals↗
PubMed2001

Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

Activating Transcription Factor 6↗
PubMed1993

Transcriptional regulation of the rat NAD(P)H:quinone reductase gene. Characterization of a DNA-protein interaction at the antioxidant responsive element and induction by 12-O-tetradecanoylphorbol 13-acetate.

We have previously identified a novel xenobiotic responsive element, which has been termed the antioxidant responsive element (ARE), in the 5'-flanking region of the rat quinone reductase gene (Favreau, L. V., and Pickett, C. B. (1991) J. Biol. Chem. 266, 4556-4561). This element is responsible for basal level expression of the gene as well as transcriptional activation by phenolic antioxidants and metabolizable planar aromatic compounds. In this communication, we demonstrate that hydrogen peroxide can act as an inducer through the ARE sequence, a phenomenon recently demonstrated for the glutathione S-transferase Ya subunit gene (Rushmore, T. H., Morton, M. R., and Pickett, C. B. (1991) J. Biol. Chem. 266, 11632-11639). To further characterize the quinone reductase ARE, we demonstrate by DNase I footprinting that in crude Hep G2 nuclear extracts a trans-acting factor exists which interacts with a region of DNA found within the 31-nucleotide ARE sequence. Furthermore, electrophoretic mobility shift assays demonstrate the presence of a specific DNA-protein complex which can be competed only by double-stranded oligonucleotides containing the ARE sequences from the quinone reductase and glutathione S-transferase Ya subunit genes. Methylation interference and protection assays indicate that several guanine residues found in the sequence GTGACTTGGC are involved in the binding of the nuclear factor(s) to the DNA. Although electrophoretic mobility shift assays indicate that the rat quinone reductase ARE does not contain a high affinity recognition site for in vitro translated c-Jun and c-Fos, 12-O-tetradecanoylphorbol 13-acetate can act as an inducer through the ARE sequence in Hep G2 cells.

Animals↗
PubMed1992

Unusual structure of the human immunodeficiency virus type 1 trans-activation response element.

The trans-activation response element (TAR) of human immunodeficiency virus type 1 is a structured RNA consisting of the first 60 nucleotides of all human immunodeficiency virus type 1 RNAs. Computer analyses and limited structural analyses indicated that TAR consists of a stem-bulge-loop structure. Mutational analyses showed that sequences in the bulge are required for Tat binding, whereas sequences in both the bulge and the loop are required for trans activation. In this study, we probed the structures of TAR and various mutants of TAR with chemical probes and RNases and used these methods to footprint a Tat peptide on TAR. Our data show that the structure of wild-type TAR is different from previously published models. The bulge, a Tat-binding site, consists of four nucleotides. The loop is structured, rather than simply single stranded, in a fashion reminiscent of the structures of the tetraloop 5'-UUCG-3' and the GNRA loop (C. Cheong, G. Varani, and I. Tinoco, Jr., Nature [London] 346:680-682, 1990; H.A. Heus and A. Pardi, Science 253:191-193, 1991). RNA footprint data indicate that three bases in the bulge are protected and suggest that a conformational change occurs upon Tat binding.

Base Sequence↗
PubMed1992

Direct interaction of CREB protein with 21 bp Tax-response elements of HTLV-ILTR.

The three 21-bp repeats (Tax-responsive elements) of the long terminal repeat (LTR) of the human T-cell leukemia virus (HTLV-I) mediates the response of the Tax protein. All three Tax-responsive elements (TREs) contain a TGACG motif, reminiscent of the CREB/ATF-binding site TGACGTCA. DNA-affinity chromatography with the 5'-TRE resulted in a previous study in proteins of about 32, 36 to 42, 50 and 110 kDa. Here we demonstrate that the 42 kDa protein is the cAMP-response element-binding (CREB) protein. This is shown by phosphorylation of the proteins eluted from the DNA-affinity column with protein kinase A (PKA) in vitro and subsequent indirect immunoprecipitation with a CREB-specific antiserum raised against an internal CREB-specific peptide. This method allows detection of phosphorylated proteins by autoradiography with high sensitivity and is superior to metabolic labeling. One of the phosphorylated proteins co-migrates with immuno-affinity-purified CREB protein--also phosphorylated in vitro--and competes with the peptide antigen, which proves the specificity of the reaction. The purified CREB protein leads to specific DNA-protein complexes in DNA mobility-shift analyses with all three TREs. Comparison of these TRE-CREB complexes with those formed by nuclear extracts from the HTLV-I-transformed T-cell line C81-66-45 indicates that additional cellular factors contribute to the complexes, especially to the middle TRE. This is also shown by using CREB-depleted instead of complete nuclear extracts for DNA mobility-shift assays. Antibodies against CREB but not Tax affect the mobility of the DNA-protein complex.

Base Sequence↗
PubMed1987

Metal-responsive elements act as positive modulators of human metallothionein-IIA enhancer activity.

The human metallothionein IIA (hMT-IIA) gene contains two enhancer elements whose activity is induced by heavy-metal ions such as Cd2+. To determine the nature of the relationship between the metal-responsive elements and the element(s) responsible for the basal activity of the enhancers, the basal-level enhancer element(s), the hMT-IIA enhancers were subjected to mutational analysis. We show that deletion of the metal-responsive elements had no effect on the basal activity of the enhancer but prevented further induction by Cd2+. On the other hand, replacement of the basal-level enhancer element with linker DNA led to inactivation of the enhancer both before and after treatment with Cd2+. Therefore, the metal-responsive elements seems to act as a positive modulator of enhancer function in the presence of heavy-metal ions. In addition to the two enhancers, the hMT-IIA promoter contained one other element, the GC box, required for its basal expression. Unlike deletion of the basal-level enhancer element, replacement of the GC box with linker DNA had no effect on the ability of the promoter to be induced by Cd2+.

Base Sequence↗
PubMed1998

13C relaxation and dynamics of the purine bases in the iron responsive element RNA hairpin.

The iron responsive element (IRE) RNA hairpin contains a conserved six-nucleotide loop. The NMR structure of this loop showed that the positions of four of its bases are not tightly constrained, while the remaining two are hydrogen-bonded [Laing, L. G., and Hall, K. B. (1996) Biochemistry 35, 13586]. To investigate the flexibility of the RNA in the loop and in the stem, 13C NMR relaxation methods have been used to describe the dynamics of the purine bases. IRE hairpins containing [13C]guanosine and [13C]adenosine are used in NMR experiments to measure T1, T1rho, and NOE values of the bases as a function of temperature (20-37 degreesC). Data are analyzed using the Lipari-Szabo model-free formalism [Lipari, G., and Szabo, A. (1982) J. Am. Chem. Soc. 104, 4546] to determine order parameters and time scales of the motion. Results indicate that the purine bases in the stem have order parameters that are independent of temperature, although they show evidence of both fast (6-40 ps) motions and slower motions at 37 degreesC. The three purines in the loop exhibit increasingly complex motions with long (nanoseconds) correlation times as the temperature increases, suggesting that the loop structure has become disordered.

Base Composition↗