Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “RNA modifications”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 307 records · Page 17Linked to original sources
PubMed1972

Functional modification of 16S ribosomal RNA by kethoxal.

Kethoxal reacts with 30S ribosomal subunits to give totally inactive particles, as measured by in vitro protein synthesis. It is postulated that functional modification occurs at the binding site for transfer RNA since (a) loss of specific binding of transfer RNA, but not binding of messenger RNA, is simultaneous with loss of protein synthesis, and (b) loss of activity is inhibited by bound transfer RNA. By means of in vitro reconstitution and labeling techniques, it is found that loss of transfer RNA-binding activity is correlated with the modification of six or seven guanine residues in 16S RNA.

Aldehydes↗
PubMed2005

Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA.

DNA and RNA stimulate the mammalian innate immune system through activation of Toll-like receptors (TLRs). DNA containing methylated CpG motifs, however, is not stimulatory. Selected nucleosides in naturally occurring RNA are also methylated or otherwise modified, but the immunomodulatory effects of these alterations remain untested. We show that RNA signals through human TLR3, TLR7, and TLR8, but incorporation of modified nucleosides m5C, m6A, m5U, s2U, or pseudouridine ablates activity. Dendritic cells (DCs) exposed to such modified RNA express significantly less cytokines and activation markers than those treated with unmodified RNA. DCs and TLR-expressing cells are potently activated by bacterial and mitochondrial RNA, but not by mammalian total RNA, which is abundant in modified nucleosides. We conclude that nucleoside modifications suppress the potential of RNA to activate DCs. The innate immune system may therefore detect RNA lacking nucleoside modification as a means of selectively responding to bacteria or necrotic tissue.

Antigens, CD↗
PubMed2002

Unconventional rules of small nuclear RNA transcription and cap modification in trypanosomatids.

This review focuses on the spliced leader (SL) RNA and uridylic acid-rich small nuclear RNAs (U-snRNAs) involved in pre-mRNA processing in trypanosomatid protozoa, with particular emphasis on the mechanism of transcription and cap formation. The SL RNA plays a central role in mRNA biogenesis by providing the unique cap 4 structure to the 5' end of all mRNAs by trans-splicing. The trimethylguanosine capped U-snRNAs, on the other hand, represent an unusual example among eukaryotic snRNAs in that they are transcribed by RNA polymerase III. This implies the existence of a distinctive mechanism for capping enzyme selection by the transcriptional machinery. Furthermore, the transcription units of U-snRNA genes offer yet another example of the variety of choices that have been established during eukaryotic evolution, namely that an upstream tRNA gene or tRNA-like gene provides extragenic promoter elements for a downstream small RNA gene.

Animals↗
PubMed1990

Catalytic activity of vaccinia mRNA capping enzyme subunits coexpressed in Escherichia coli.

RNA triphosphatase, RNA guanylyltransferase, and RNA (guanine-7)-methyltransferase activities are associated with the vaccinia virus mRNA capping enzyme, a heterodimeric protein containing polypeptides of Mr 95,000 and Mr 31,000. The genes encoding the large and small subunits (corresponding to the D1 and the D12 ORFs, respectively, of the viral genome) were coexpressed in Escherichia coli BL21 (DE3) under the control of a bacteriophage T7 promoter. Guanylyltransferase activity (assayed as the formation of a covalent enzyme-guanylate complex) was detected in soluble lysates of these bacteria. A 1000-fold purification of the guanylyltransferase was achieved by ammonium sulfate precipitation and chromatography using phosphocellulose and SP5PW columns. Partially purified guanylytransferase synthesized GpppA caps when provided with 5'-triphosphate-terminated poly(A) as a cap acceptor. In the presence of AdoMet the enzyme catalyzed concomitant cap methylation with 99% efficiency. Inclusion of S-adenosyl methionine increased both the rate and extent of RNA capping, permitting quantitative modification of RNA 5' ends. Guanylyltransferase sedimented as a single component of 6.5 S during further purification in a glycerol gradient; this S value is identical with that of the heterodimeric capping enzyme from vaccinia virions. Electrophoretic analysis showed a major polypeptide of Mr 95,000 cosedimenting with the guanylyltransferase. RNA triphosphatase activity cosedimented exactly with guanylyltransferase. Methyltransferase activity was associated with guanylyltransferase and was also present in less rapidly sedimenting fractions. The methyltransferase activity profile correlated with the presence of a Mr 31,000 polypeptide. These results indicate that the D1 and D12 gene products are together sufficient to catalyze all three enzymatic steps in cap synthesis. A model for the domain structure of this enzyme is proposed.

Centrifugation, Density Gradient↗
PubMed1997

Modification of human U4 RNA requires U6 RNA and multiple pseudouridine synthases.

Small nuclear RNAs (snRNA), cofactors in the splicing of pre-mRNA, are highly modified. In this report the modification of human U4 RNA was studied using cell extracts and in vitro synthesized, and therefore unmodified, U4 RNA. The formation of pseudouridine (Psi) at positions 4, 72 and 79 in U4 RNA was dependent on an RNA-containing cofactor, since the activities in the extracts were micrococcal nuclease (MN) sensitive. Extracts were fractionated on glycerol gradients and there was a broad peak of reconstitution activity centered at 14 S. Reconstitution was not due to additional enzymatic activity, since the peak fraction was MN sensitive. Oligodeoxynucleotide-mediated RNase H digestion of U6 RNA in the extracts inhibited formation of Psi in U4 RNA. From glycerol gradient analysis we determined that exogenously added U4 RNA that is associated with U6 RNA (sedimentation velocity 16 S) was significantly higher in Psi content than U4 RNA not associated with U6 RNA (8 S). Competitive inhibitors of Psi synthases, 5-fluorouridine-containing (5-FU) wild-type and mutant U4 RNAs, were used to investigate formation of Psi in U4 RNA. Deletions and point mutations in these 5-FU-containing U4 RNAs affected their ability to inhibit Psi synthase in vitro. With the aid of these potent inhibitors it was determined that at least two separate activities modify the uridines at these positions.

Base Sequence↗
PubMed2005

Positional effect of chemical modifications on short interference RNA activity in mammalian cells.

A systematic study on the effect of 2'-sugar modifications (2'-F (2'-F-2'-deoxy-nucleoside residues), 2'-O-Me (2'-O-methyl-nucleoside residues), and 2'-O-MOE [2'-O-(2-methoxyethyl)]-nucleoside residues) in the antisense and sense strands of short interference RNA (siRNA) was performed in HeLa cells. The study of the antisense strand of siRNAs demonstrated that activity depends on the position of the modifications in the sequence. The siRNAs with modified ribonucleotides at the 5'-end of the antisense strand were less active relative to the 3'-modified ones. The 2'-F sugar was generally well-tolerated on the antisense strand, whereas the 2'-O-Me showed significant shift in activity depending on the position of modification. The 2'-O-MOE modification in the antisense strand resulted in less active siRNA constructs regardless of placement position in the construct. The incorporation of the modified residues, e.g., 2'-O-Me and 2'-O-MOE, in the sense strand of siRNA did not show a strong positional preference. These results may provide guidelines to design effective and stable siRNAs for RNA interference mediated therapeutic applications.

Animals↗
PubMed2005

Gene silencing in rat-liver and limb grafts by rapid injection of small interference RNA.

Genetic modification is a promising therapeutic strategy for organ transplantation. In previous studies, we introduced a nonviral method of gene transfer to donor grafts using an organ-selective injection technique to up-regulate gene expression. Based on the attractive methodology of RNA interference for silencing a particular gene expression, we applied our catheter-based injection method to transfer small interference RNA (siRNA)-green fluorescence protein (GFP) into liver and limb grafts. We first quantified the interfering activity after the systemic delivery of siRNA in the liver of Alb-DsRed2 transgenic (Tg) rats using in vivo bioimaging system. Then, using GFP Tg Lewis rats as donors, transient down-regulation of the GFP expression was achieved both in liver- and limb-transplantation models by the preoperative rapid injection of siRNA. Genetic modification by siRNA may provide new therapeutic options for down-regulation of endogenous antigenicity.

Animals↗
PubMed1979

An improved rapid enzymatic method of RNA sequencing using chemical modification.

A version of rapid gel sequencing procedure based on the analysis of partial endonuclease hydrolizates of chemically modified 5'-32P-labelled RNA is suggested. Complete and selective modification of cytidilic residues by a methoxyamine-bisulfite mixture leads to the unfolding of the RNA secondary structure and, due to this effect, to the generation of a more uniform set of fragments after partial RNAase hydrolysis. The position of cytidines in an RNA sequence can be determined by restricting the hydrolysis of phosphodiester bonds between the modified CMP residues and their 3'-neighbours with T2 and A RNAases. The method was verified with tRNATrp (yeast) and 5S RNA (rat liver and yeast).

Animals↗
PubMedDate not supplied

[Modification of the RNA-polymerase of Escherichia coli by diethylpyrocarbonate].

E. coli DNA dependent RNA polymerase was modified by diethylpyrocarbonate. Optical and kinetic properties of the reaction were studied. More than 90% of RNA polymerase activity is inhibited by introduction of 9--11 ethoxyformyl groups per enzyme molecule without loss of its ability to bind DNA template. Furthermore the modified enzyme is able to form tight complexes with DNA and to compete with native enzyme for the formation of rifampicin-resistant complex. The ratio of the complex formation constants for the native and modified enzyme was determined to be equal to 10. The enzyme modified to such extent loses the activity in DNA dependent RNA as well as pppApU synthesis. Vmax value rather than Km value for both ATP and UTP decreases following the modification reaction. Incubation of the enzyme modified to the 10% of residual activity with 0.2 M hydroxylamine for 2 hours results in restoration of RNA polymerase activity. Most but not all of the modified histidyl residues restore their native structure. Two of 13 histidyl residues were modified irreversibly due to Bamberger's cleavage reaction, but these two residues were found to be unessential for RNA polymerase activity. Reaction with higher concentration of the diethylpyrocarbonate induces modification of more than 15--20 histidyl residues and leads to irreversible inactivation of the enzyme. Nevertheless the modification of the additional histidyl redidues was reversible as well as the modification of the first 11 residues. RNA polymerase modified to such extent loses the ability to bind DNA. Preformation of the initiated ternary complex of RNA polymerase with template and product fails to protect the enzyme from reversible inactivation at a low reagent concentration, but markedly decreases the rate of the irreversible and unspecific modification of sulfhydryl or amino groups of the enzyme. Reaction with the ternary complex results in reversible inactivation of the enzyme with respect to elongation of RNA chains as well as the pyrophosphate exchange reaction. The complex itself was, however, completely stable under the reaction conditions and the enzyme subunit structure was also conserved after the reaction. Evidently, the mild modification of the histidyl residues with diethylpyrocarbonate selectively inhibits RNA chain elongation.

Chemical Phenomena↗
PubMed1997

Eukaryotic ribosomal RNA: the recent excitement in the nucleotide modification problem.

Eukaryotic ribosomal RNA (rRNA) contains numerous modified nucleotides: about 115 methyl groups and some 95 pseudouridines in vertebrates; about 65 methyl groups and some 45 pseudouridines in Saccharomyces cerevisiae. All but about ten of the methyl groups are ribose methylations. The remaining ten are on heterocyclic bases. The ribose methylations occur very rapidly upon the primary rRNA transcript in the nucleolus, probably on nascent chains, and they appear to play an important role in ribosome maturation, at least in vertebrates. All of the methyl groups occur in the conserved core of rRNA. However, there is no consensus feature of sequence or secondary structure for the methylation sites; thus the nature of the signal(s) for site-specific methylations had until recently remained a mystery. The situation changed dramatically with the discovery that many of the ribose methylation sites are in regions that are precisely complementary to small nucleolar RNA (snoRNA) species. Experimental evidence indicates that structural motifs within the snoRNA species do indeed pinpoint the precise nucleotides to be methylated by the putative 2'-O-methyl transferase(s). Regarding base methylations, the gene DIM1, responsible for modification of the conserved dimethyladenosines near the 3' end of 18S rRNA, has been shown to be essential for viability in S. cerevisiae and is suggested to play a role in the nucleocytoplasmic transport of the small ribosomal subunit. Recently nearly all of the pseudouridines have also been mapped in the rRNA of several eukaryotic species. As is the case for ribose methylations, most pseudouridine modifications occur rapidly upon precursor rRNA, within core sequences, and in a variety of local primary and secondary structure environments. In contrast to ribose methylation, no potentially unifying process has yet been identified for the enzymic recognition of the many pseudouridine modification sites. However, the new data afford the basis for a search for any potential involvement of snoRNAs in the recognition process.

Adenosine↗
PubMed1983

Incorporation of 3H-amino acids into proteins in a partially purified fraction of axoplasm: evidence for transfer RNA-mediated, post-translational protein modification in squid giant axons.

Transfer RNA (tRNA) has been demonstrated to be present in axons of both invertebrates and the higher vertebrates, but nothing is known of its role in the metabolism of the axon. The present experiments were performed to determine whether tRNA functions in axons as a participant in post-translational protein modification of endogenous proteins. RNA was extracted from the axoplasm of squid giant axons and incubated with a variety of 3H-amino acids, aminoacyl-tRNA synthetases (obtained from squid optic lobe), and an appropriate reaction mixture. All of the amino acids tested were bound to an RNA fraction, but this reaction did not occur when samples were incubated in the presence of ribonuclease or in the absence of axoplasmic RNA. When radioactive RNA was chromatographed by polyacrylamide gel electrophoresis, the radioactivity comigrated with known tRNA markers, suggesting the presence of 3H-aminoacylated tRNA. Aminoacylation of RNA could also be demonstrated by incubating fresh axoplasm with labeled amino acids and a reaction mixture, minus exogenous aminoacyl-tRNA synthetases. These findings indicate the presence in axoplasm of a variety of species of aminoacyl-tRNAs as well as their corresponding synthetase enzymes. In the latter experiment no radioactivity was found associated with the protein fraction. This was also the finding when 3H-aminoacylated tRNA was either injected directly into the axon or incubated with extruded axoplasm. Thus, under the conditions described above, there is no evidence of transfer of amino acids from tRNA to proteins. In other experiments, axoplasm was pooled to a volume of 50 to 100 microliters, homogenized gently, and centrifuged at 150,000 X g for 1 hr. Some of the high speed supernatant was incubated with labeled amino acids and an appropriate reaction mixture, and the remainder was passed through an S-200 Sephacryl column before incubation with the same reaction mixture. There was no incorporation of amino acids into protein in the high speed supernatant fraction. However, in the S-200 purified fraction 3H-labeled Arg, Lys, Tyr, Leu, and Asp were all incorporated into proteins in amounts of 44, 30, 7, 5 and 3.5 times heat-inactivated controls. The reaction is not inhibited by Ca2+ or Ca2+-activated proteases, but appears to be dependent on the presence of tRNA. The addition of amino acids to protein is not protein synthesis since the reactions occurred in a partially purified fraction of the 150,000 X g supernatant, a fraction devoid of ribosomes and free amino acids.(ABSTRACT TRUNCATED AT 400 WORDS)

Amino Acids↗
PubMed1979

Protected deoxyribonucleoside-3' aryl phosphodiesters as key intermediates in polynucleotide synthesis. Construction of an icosanucleotide analogous to the sequence at the ends of Rous sarcoma virus 35S RNA.

Several modifications have been incorporated into the phosphotriester strategy for chemical synthesis of oligodeoxyribonucleotides. These include high-yield methods of preparation and isolation of O5', N-protected deoxyribonucleoside-3' p-chlorophenyl phosphates which serve as key intermediates, and the elimination of some superfluous manipulation and purification steps commonly used in the process of synthesizing oligonucleotide blocks. In addition, two new arylsulfonyl nitroimidazole derivatives have been prepared and found to be highly effective agents for internucleotide bond formation. These techniques have been applied in construction of the iconsamer d(G-C-C-A-T-T-T-T-A-C-C-A-T-T-C-A-C-C-A)-rC, equivalent to a ribonucleotide sequence located at both the 5' and 3' ends of Rous sarcoma virus 35S RNA.

Avian Sarcoma Viruses↗
PubMed2026

A critical appraisal of base-resolution m6A profiling techniques.

N6-methyladenosine (m6A) is the most prevalent internal modification in eukaryotic mRNA, influencing RNA fate and gene regulation. Early antibody-based approaches enabled transcriptome-wide profiling but lacked resolution and quantitative accuracy. Newer approaches now achieve base-resolution m6A detection using improved crosslinking, chemical or enzymatic conversion, and single-molecule sequencing. Antibody-free methods provide quantitative stoichiometry from minimal input, while nanopore direct RNA sequencing offers real-time, single-molecule readouts across entire transcriptomes. Collectively, these methods form a versatile toolkit that integrates global mapping with precise site-level analysis, advancing knowledge of context-dependent m6A regulation in physiology and disease. This review compares their principles, strengths, and limitations to guide method selection and highlight how next-generation epitranscriptomic tools are paving the way for clinical and therapeutic applications.

Humans↗
PubMed1979

Secondary structure of the 5' end of bacteriophage MS2 RNA Methoxyamine and kethoxal modification.

To refine the secondary structure model of the 5' end of the bacteriophage MS2 genome, 32P-labeled MS2 RNA was partially digested with T1 RNase or with Cm-RNase and the 5'-end fragment was isolated, renatured and submitted to treatment with methoxyamine or kethoxal. The resulting modified RNA was digested with T1 RNase and the products were separated by minifingerprinting. Methoxyamine-induced modification of exposed cytidines was detected by differential mobility of modified oligonucleotides, while kethoxal-induced alteration of exposed guanosines was monitored by resistance to T1 ribonuclease digestion. The positions of the modified residues are discussed in terms of an improved secondary structure model proposed for the 5' end of the viral RNA. The structure itself is discussed in relation to sequence conservation and biological function.

Aldehydes↗
PubMed2006

Controlling activation of the RNA-dependent protein kinase by siRNAs using site-specific chemical modification.

The RNA-dependent protein kinase (PKR) is activated by binding to double-stranded RNA (dsRNA). Activation of PKR by short-interfering RNAs (siRNAs) and stimulation of the innate immune response has been suggested to explain certain off-target effects in some RNA interference experiments. Here we show that PKR's kinase activity is stimulated in vitro 3- to 5-fold by siRNA duplexes with 19 bp and 2 nt 3'-overhangs, whereas the maximum activation observed for poly(I)*poly(C) was 17-fold over background under the same conditions. Directed hydroxyl radical cleavage experiments indicated that siRNA duplexes have at least four different binding sites for PKR's dsRNA binding motifs (dsRBMs). The location of these binding sites suggested specific nucleotide positions in the siRNA sense strand that could be modified with a corresponding loss of PKR binding. Modification at these sites with N2-benzyl-2'-deoxyguanosine (BndG) blocked interaction with PKR's dsRBMs and inhibited activation of PKR by the siRNA. Importantly, modification of an siRNA duplex that greatly reduced PKR activation did not prevent the duplex from lowering mRNA levels of a targeted message by RNA interference in HeLa cells. Thus, these studies demonstrate that specific positions in an siRNA can be rationally modified to prevent interaction with components of cellular dsRNA-regulated pathways.

Binding Sites↗
PubMed1982

Sequence determination of rat U5 RNA using a chemical modification procedure for counteracting sequence compression.

Using post-labeling techniques, the nucleotide sequence of a major species of U5 RNA isolated from rat liver was determined to be: XpppAmUmACUCUGGUUUCUCUUCAGAUCGUAUAAAUCUUUCGmCCUUmUpsiACmNAAAGAUpsiUCCGUGGAGAGGA ACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGA(G)CAAGGCUOH. The 5'-end of the RNA is blocked with a cap structure. In addition to the modified nucleotides around the 5'-end (XpppAmUmA), U5 RNA contains Gm at position 38, Um at position 42, psi at position 44, Cm at position 46, N at position 47, and psi at position 54 as modified nucleotides. U5 RNA is present as a mixture of several species with microheterogeneity, whose lengths are 117, 118, or 119 nucleotides. The major species, with 117 nucleotides, comprised approximately 60% of the total U5 RNA. A region near the 3'-end forms a stable second structure, which causes sequence compression on electrophoresis in polyacrylamide gel. To surmount with this obstacle, we developed a chemical modification procedure with sodium bisulfite prior to partial hydrolysis in formamide, which allows denaturation of the secondary structure in polyacrylamide gel containing 7 M urea. The procedure provides a good system for checking RNA sequences determined by electrophoresis in polyacrylamide gel which might have apparent deletions on account of sequence compression.

Animals↗
PubMed1999

Structural origins of the exonuclease resistance of a zwitterionic RNA.

Nuclease resistance and RNA affinity are key criteria in the search for optimal antisense nucleic acid modifications, but the origins of the various levels of resistance to nuclease degradation conferred by chemical modification of DNA and RNA are currently not understood. The 2'-O-aminopropyl (AP)-RNA modification displays the highest nuclease resistance among all phosphodiester-based analogues and its RNA binding affinity surpasses that of phosphorothioate DNA by 1 degrees C per modified residue. We found that oligodeoxynucleotides containing AP-RNA residues at their 3' ends competitively inhibit the degradation of single-stranded DNA by the Escherichia coli Klenow fragment (KF) 3'-5' exonuclease and snake venom phosphodiesterase. To shed light on the origins of nuclease resistance brought about by the AP modification, we determined the crystal structure of an A-form DNA duplex with AP-RNA modifications at 1.6-A resolution. In addition, the crystal structures of complexes between short DNA fragments carrying AP-RNA modifications and wild-type KF were determined at resolutions between 2.2 and 3.0 A and compared with the structure of the complex between oligo(dT) and the D355A/E357A KF mutant. The structural models suggest that interference of the positively charged 2'-O-substituent with the metal ion binding site B of the exonuclease allows AP-RNA to effectively slow down degradation.

Base Sequence↗