Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “DNA Primase”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 307 records · Page 17Linked to original sources
PubMed1985

Initiation of DNA synthesis by the calf thymus DNA polymerase-primase complex.

The calf thymus DNA polymerase-alpha-primase complex purified by immunoaffinity chromatography catalyzes the synthesis of RNA initiators on phi X174 single-stranded viral DNA that are efficiently elongated by the DNA polymerase. Trace amounts of ATP and GTP are incorporated into products that are full length double-stranded circular DNAs. When synthetic polydeoxynucleotides are used as templates, initiation and DNA synthesis occurs with both poly(dT) and poly(dC), but neither initiation nor DNA synthesis was observed with poly(dA) and poly(dI) templates. Nitrocellulose filter binding and sucrose gradient centrifugation studies show that the DNA polymerase-primase complex binds to deoxypyrimidine polymers, but not to deoxypurine polymers. Using d(pA)-50 with 3'-oligo(dC) tails and d(pI)-50 with 3'-oligo(dT) tails, initiator synthesis and incorporation of deoxynucleotide can be demonstrated when the average pyrimidine sequence lengths are 8 and 4, respectively. These results suggest that purine polydeoxynucleotides are used as templates by the DNA polymerase only after initiation has occurred on the oligodeoxypyrimidine sequence and that the pyrimidine stretch required by the primase activity is relatively short. Analysis of initiator chain length with poly(dC) as template showed a series of oligo(G) initiators of 19-27 nucleotides in the absence of dGTP, and 5-13 nucleotides in the presence of dGTP. The chain length of initiators synthesized by the complex when poly(dT) or oligodeoxythymidylate-tailed poly(dI) was used can be as short as a dinucleotide. Analysis of the products of replication of oligo(dC)-tailed poly(dA) shows that initiator with chain length as low as 4 can be used for initiation by the polymerase-primase complex.

Animals↗
PubMed1994

Characterization of the macromolecular synthesis (MMS) operon from Listeria monocytogenes.

The macromolecular synthesis (MMS) operon consists of three genes: rpsU, which encodes the S21 ribosomal protein in Bacillus subtilis (Bs), rpsU is replaced by orfP23 which encodes a protein of unknown function), dnaG, encoding the DNA primase involved in the initiation of chromosome replication, and rpoD, which encodes the principal sigma subunit of RNA polymerase. The operon was cloned in three segments from Listeria monocytogenes (Lm), initially using a probe designed from a highly conserved region of RpoD. Analysis of the nucleotide sequence revealed three genes: orfP17 (whose product, P17, is homologous to Bs P23), dnaG and rpoD. The Lm DnaG resembles the primase from Escherichia coli through the first two-thirds of the sequence. C-terminal similarity was observed between DnaG from Lm and Bs. Lm RpoD is similar to Bs SigA, shares identical DNA-binding domains with SigA, and is a member of the sigma 43 subgroup of the sigma 70 family.

Amino Acid Sequence↗
PubMed1995

Effects of base analog substitutions in the noncoding dC of the 3'-d(CTG)-5' template recognition site of the bacteriophage T7 primase.

The 63-kDa gene 4 protein (DNA primase) of bacteriophage T7 catalyzes the synthesis of the oligoribonucleotides pppACC(C/A) and pppACAC at single-stranded DNA recognition sites 3'-d[CTGG-(G/T)]-5' and 3'-d(CTGTG)-5', respectively. At these sites, the 3'-terminal deoxycytidine residue is conserved but noncoding; the 3'-dC residue is required to initiate catalytic synthesis of oligoribonucleotides, yet it is not used as a template residue for the synthesis of a complementary G residue in the RNA primer. We have examined the interactions between T7 primase and the functional groups of the 3'-dC residue by measuring the ability of the primase to catalyze the synthesis of oligoribonucleotides on synthetic single-stranded 20-mer templates [e.g., 3'-d(GCTATGGTGACTGGTAGTCG)-5'] that contain analogs of dC in the conserved pentanucleotide recognition site. Recognition sites containing 5-methyldeoxycytidine (m5dC) or 1-(beta-D-2'-deoxyribosyl)-2-pyrimidinone (dH4C) substitutions for dC support oligoribonucleotide synthesis whereas those containing deoxythymidine (dT) and deoxyuridine (dU) substitutions do not. Oligoribonucleotide synthesis on the native template (containing dC) is inhibited competitively by the template containing a dT residue in the primase recognition site, 3'-[(N10)TTGGT(N5)]-5', with an apparent Ki of 1.30 +/- 0.04 microM. Templates containing dU residues, 3'-[(N10)UTGGT(N5)]-5' and 3'-[(N9)UTTGGT-(N5)]-5', affect both the apparent Km and Vmax parameters for oligoribonucleotide synthesis on the 3'-[(N10)CTGGT(N5)]-5' template.

Bacteriophage T7↗
PubMed1983

Reactions in vitro of the DNA polymerase-primase from Xenopus laevis eggs. A role for ATP in chain elongation.

A form of DNA polymerase alpha was purified several thousandfold from a protein extract of Xenopus laevis eggs. The enzyme effectively converts, in the presence of ribonucleoside triphosphates, a circular single-stranded phage fd DNA template into a double-stranded DNA form and, therefore, must be associated with a DNA primase. We first show by gel electrophoresis in the presence of sodium dodecyl sulfate that both enzymatic activities, DNA polymerase and primase, most probably reside on a greater than 100 000-Da subunit of the DNA polymerase holoenzyme. We then assayed the polymerase-primase at various template/enzyme ratios and found that the DNA complementary strand sections synthesized in vitro belong to defined size classes in the range of 600-2000 nucleotides, suggesting preferred start and/or stop sites on the fd DNA template strand. We show that the stop sites coincide with stable hairpin structures in fd DNA. We have used a fd DNA template, primed by a restriction fragment of known size, to show that the polymerase-primase stops at the first stable hairpin structure upstream from the 3'-OH primer site when the reaction was carried out at 0.1 mM ATP. However, at 2 mM ATP the enzyme was able to travers this and other stop sites on the fd DNA template strand leading to the synthesis of 2-4 times longer DNA strands. Our results suggest a role for ATP in the polymerase-primase-catalyzed chain-elongation reaction.

Adenosine Triphosphate↗
PubMed2002

Control of complex formation of DNA polymerase alpha-primase and cell-free DNA replication by the C-terminal amino acids of the largest subunit p180.

DNA polymerase alpha-primase is a heterotetrameric complex essential for simian vacuolating virus 40 (SV40) DNA replication. We show that the C-terminal 67 amino acid residues of the human p180 subunit are essential for SV40 DNA replication as they are required for binding of the p68 subunit and play a role in the interaction with the primase subunits, p48 and p58. Furthermore, we demonstrate that exchanging these residues to those of mouse origin can only partially rescue the SV40 DNA replication activity of DNA polymerase alpha-primase.

Animals↗
PubMed1991

Influence of poly(ADP-ribose) polymerase on the enzymatic synthesis of SV40 DNA.

The influence of poly(ADP-ribose) polymerase (PARP) on the replication of DNA containing the SV40 origin of replication has been examined. Extensive replication of SV40 DNA can be carried out in the presence of T antigen, topoisomerase I, the multimeric human single strand DNA-binding protein (HSSB), and DNA polymerase alpha-DNA primase (pol alpha-primase) complex (the monopolymerase system). In the monopolymerase system, both small products (Okazaki fragments), arising from lagging strand synthesis, and long products, arising from leading strand synthesis, are formed. The synthesis of long products requires the presence of relatively high levels of pol alpha-primase complex. In the presence of PARP, the synthesis of long products was blocked and only small Okazaki fragments accumulated, arising from the replication of the lagging strand template. The inhibition of leading strand synthesis by PARP can be effectively reversed by supplementing the monopolymerase system with the multimeric activator 1 protein (A1), the proliferating cell nuclear antigen (PCNA) and PCNA-dependent DNA polymerase delta (the dipolymerase system). The inhibition of leading strand synthesis in the monopolymerase system was caused by the binding of PARP to the ends of DNA chains, which blocked their further extension by pol alpha. The selective accumulation of Okazaki fragments was shown to be due to the coupled synthesis of primers by DNA primase and their immediate extension by pol alpha complexed to primase. PARP had little effect on this coupled reaction, but did inhibit the subsequent elongation of products, presumably after pol alpha dissociated from the 3'-end of the DNA fragments. PARP inhibited several other enzymatic reactions which required free ends of DNA chains. PARP inhibited exonuclease III, DNA ligase, the 5' to 3' exonuclease, and the elongation of primed DNA templates by pol alpha. In contrast, PARP only partly competed with the elongation of primed DNA templates by the pol delta elongation system which required SSB, A1, and PCNA. These results suggest that the binding of PARP at the ends of nascent DNA chains can be displaced by the binding of A1 and PCNA to primer ends. HSSB can be poly(ADP-ribosylated) in vivo as well as in vitro. However, the selective effect of PARP in blocking leading strand synthesis in the monopolymerase system was shown to depend primarily on its DNA binding property rather than on its ability to synthesize poly(ADP-ribose).

Autoantigens↗
PubMed1990

Release of RNA polymerase from vero cell mitochondria after herpes simplex virus type 1 infection.

Infection of Vero cells with herpes simplex virus type 1 results in the appearance in soluble extracts of a DNA primase activity. The partially purified enzyme, Mr, approximately 100,000, is identical in resistance to alpha-amanitin, pH profile, Mg2+ dependence, salt sensitivity, and KmATP to the catalytic core of Vero cell mitochondrial RNA polymerase. Moreover, the products synthesized are those expected of an RNA polymerase rather than a DNA primase. Inasmuch as the enzyme is not present in soluble extracts of uninfected Vero cells, we presume that the specific appearance of RNA polymerase in extracts of herpesvirus-infected cells results from infection-induced disruption of the mitochondrial membrane, followed by release of the enzyme into the cytosol.

Animals↗
PubMed1995

Isolation and characterization of an in vitro DNA replication system from maize mitochondria.

An in vitro DNA replication system from maize mitochondria has been isolated and characterized. Maize mtDNA polymerase activity was purified about 1100-fold through DEAE cellulose and Heparin-Sepharose columns. In addition to the DNA polymerase activity, this in vitro replication system also contained topoisomerase I, DNA primase and RNA polymerase activities. Optimal conditions for enzyme activity, preferred templates and inhibitors were determined in order to further characterize this in vitro replication system; this system was devoid of any detectable extramitochondrial activity as determined by: a) the mt origin of the DNA polymerase activity as evidenced by studies using different templates and inhibitors, b) absence of chloroplast or nuclear DNA, glucose -6-P-dehydrogenase (known to be present only in the cytosol and chloroplasts) and photosynthetic pigments in the mitochondrial fraction and c) the ability of maize mt topoisomerase I to relax positively supercoiled DNA.

Chromatography, Affinity↗
PubMed1987

Identification of multiple cellular factors required for SV40 replication in vitro.

The replication of simian virus 40 has been studied by using cell-free extracts derived from human 293 cells. Fractionation of this extract has led to the identification of three fractions that are required for efficient DNA synthesis. Initial fractionation of the crude extract by phosphocellulose chromatography has produced two fractions, I and II, neither of which is able to support replication separately, but when they are combined, efficient synthesis is restored. Both fractions are required, with SV40 T antigen, for the formation of a presynthesis complex at the SV40 origin. The major replication enzymes, DNA polymerase, DNA primase and the topoisomerases I and II all reside in fraction II. Fraction I has been subdivided into two subfractions (A and B) by DEAE-cellulose chromatography. Fraction A is essential for replication and is required for presynthesis complex formation. Fraction B stimulates DNA replication and is only required at the elongation stage. This multicomponent system has provided the foundation for identification of individual components that are required for DNA replication in vitro.

Antigens, Polyomavirus Transforming↗
PubMed2002

Molecular mimicry of an HLA-B27-derived ligand of arthritis-linked subtypes with chlamydial proteins.

HLA-B27 is strongly associated with spondyloarthropathies, including ankylosing spondylitis and reactive arthritis. The latter disease is triggered by various Gram-negative bacteria. A dodecamer derived from the intracytoplasmic tail of HLA-B27 was a natural ligand of three disease-associated subtypes (B*2702, B*2704, and B*2705) but not of two (B*2706 and B*2709), weakly or not associated to spondyloarthropathy. This peptide was strikingly homologous to protein sequences from arthritogenic bacteria, particularly to a region of the DNA primase from Chlamydia trachomatis. A synthetic peptide with this bacterial sequence bound in vitro disease-associated subtypes equally as the natural B27-derived ligand. The chlamydial peptide was generated by the 20 S proteasome from a synthetic 28-mer with the sequence of the corresponding region of the bacterial DNA primase. Molecular modeling suggested that the B27-derived and chlamydial peptides adopt very similar conformations in complex with B*2705. The results demonstrate that an HLA-B27-derived peptide mimicking arthritogenic bacterial sequences is a natural ligand of disease-associated HLA-B27 subtypes and suggest that the homologous chlamydial peptide might be presented by HLA-B27 on Chlamydia-infected cells.

Amino Acid Sequence↗
PubMed1994

The cellular DNA polymerase alpha-primase is required for papillomavirus DNA replication and associates with the viral E1 helicase.

Persistent infection by papillomaviruses involves the maintenance of viral DNA as a nuclear plasmid, the replication of which requires host DNA polymerases. The role of the cellular DNA polymerase alpha-primase holoenzyme was probed by using soluble extracts from rodent cells that replicate bovine papilloma virus 1 and human papilloma virus 6b DNA in the presence of the viral E1 helicase and the E2 transcription factor. Monoclonal antibodies directed against the catalytic 180-kDa subunit of polymerase alpha inhibit DNA synthesis in this system. Addition of purified human polymerase alpha-primase holoenzyme to neutralized extracts restores their DNA synthetic activity. The amino-terminal 424 amino acids of E1 forms a specific protein complex with the p180 polymerase subunit. Immune complexes can be isolated with antibodies directed against E1 that contain a DNA polymerase activity. Moreover, this polymerase activity can be neutralized by anti-polymerase alpha antibodies. Permissivity barriers were not encountered in this in vitro system, as bovine E1 can interface with the murine and human replication apparatus. Although the large tumor antigens encoded by simian virus 40 and polyoma share limited primary sequence homology with the papillomavirus E1 proteins, the organization of functional motifs at the level of primary protein structure is remarkably similar. In addition to their origin-specific DNA-binding activity, each of these helicases may function to help recruit the cellular polymerase alpha-primase complex to the viral replication origin.

Animals↗
PubMed1986

Molecular cloning into Tn5 and integration in the Pseudomonas aeruginosa chromosome: a tool for heterologous gene expression.

The DNA primase gene of the promiscuous IncP-1 conjugative plasmid RP1, encoding two polypeptides of 118 and 80 kDa, was inserted into the transposon Tn5 in Escherichia coli. The derivative transposon, Tn2523, was then transposed to a temperature-sensitive replication mutant of the promiscuous IncP-1 conjugative plasmid R68 at permissive temperature and the plasmid transferred to Pseudomonas aeruginosa strain PAO. The latter strain was then grown at non-permissive temperature to identify transposition of Tn2523 into the P. aeruginosa chromosome. Immunological and enzymic analysis showed the expression of functional primase polypeptides in the constructed P. aeruginosa strain. This strain also restored wild-type conjugational transfer proficiency, by complementation, to mutants of the IncP-1 plasmid R18 affected in transfer from P. aeruginosa to P. stutzeri or to Acinetobacter calcoaceticus due to transposon Tn7 insertion mutations in the primase gene. This strategy of cloning into a transposon and integration into the bacterial chromosome should facilitate genetic manipulation and studies of gene expression in a range of Gram-negative bacteria.

Chromosomes, Bacterial↗
PubMed1997

Cnr protein, the negative regulator of bacteriophage P4 replication, stimulates specific DNA binding of its initiator protein alpha.

Bacteriophage P4 DNA replication depends upon the phage-encoded alpha protein, which has DNA helicase and DNA primase activity and can specifically bind to the replication origin (ori) and to the cis replicating region (crr). The P4 Cnr protein functions as a negative regulator of P4 replication, and P4 does not replicate in cells that overexpress cnr. We searched for P4 mutants that suppressed this phenotype (Cnr resistant [alpha cr]). Eight independent mutants that grew in the presence of high levels of Cnr were obtained. None of these can establish the plasmid state. Each of these mutations lies in the DNA binding domain of gp alpha that occupies the C terminus of the protein. Five different sequence changes were found: T675M, G732V (three times), G732W (twice), L733V, and L737V. A TrxA-Cnr fusion protein does not bind DNA by itself but stimulates the ori and crr binding abilities of alpha protein in vitro. The alpha cr mutant proteins were still able to bind specifically to ori or crr, but specific DNA binding was less stimulated by the TrxA-Cnr protein. We present evidence that Cnr protein interacts with the gp alpha domain that binds specifically to DNA and that gp(alpha)cr mutations impair this interaction. We hypothesize that gp alpha-Cnr interaction is essential for the control of P4 DNA replication.

Binding Sites↗
PubMed2001

The RepA protein of plasmid pSC101 controls Escherichia coli cell division through the SOS response.

Although plasmid copy number varies widely among different plasmid species, normally copy number is maintained within a narrow range for any given plasmid. Such copy number control has been shown to occur by regulation of the rate of plasmid DNA replication. Here we report a novel mechanism by which the pSC101 plasmid also can detect an imbalance between the cellular level of its replication protein, RepA, and plasmid-borne RepA binding sites to inhibit bacterial DNA replication and delay host cell division when RepA is in relative excess. We show that delayed cell division occurs by RepA-mediated induction of the SOS response and can be reversed by over-expression of the host DNA primase, DnaG. The effects of RepA excess are prevented by introducing a surfeit of RepA binding sites. The mechanism reported here may help to limit variation in plasmid copy number and allow repopulation of cells with plasmids when copy number falls--potentially pre-empting plasmid loss in cultures of dividing cells.

Binding Sites↗
PubMed1994

The herpes simplex virus type 1 origin-binding protein interacts specifically with the viral UL8 protein.

The products of herpes simplex virus type 1 (HSV-1) genes UL5, UL8 and UL52 form a complex in virus-infected cells that exhibits both DNA helicase and DNA primase activities. UL8 protein was purified from insect cells infected with a recombinant baculovirus and used to generate monoclonal antibodies (MAbs). MAb 0811 was shown to recognize the UL8 protein in both Western blots and immunoprecipitation assays and to co-precipitate the other two proteins in the complex from insect cells triply infected with recombinants expressing the UL5, UL8 and UL52 polypeptides. Experiments performed using extracts from doubly infected cells indicated that UL8 could interact separately with both the UL5 and UL52 proteins. Similar experiments using a recombinant virus that expressed the HSV-1 origin-binding protein (OBP), UL9, demonstrated a direct physical interaction between the helicase-primase complex and OBP which involved the UL8 subunit. The C-terminal DNA-binding domain of OBP is dispensable for this interaction, as evidenced by the ability of MAb 0811 to co-precipitate a truncated UL9 protein, containing only the N-terminal 535 amino acids, with UL8.

Animals↗
PubMed1988

Fidelity of a human cell DNA replication complex.

We have measured the fidelity of bidirectional, semiconservative DNA synthesis by a human DNA replication complex in vitro. Replication was performed by extracts of HeLa cells in the presence of simian virus 40 (SV40) large tumor antigen by using a double-stranded phage M13mp2 DNA template containing the SV40 origin of replication and either of two different target sequences for scoring mutations in the lacZ alpha-complementation gene, which encodes the alpha region (specifying the amino-terminal portion) of beta-galactosidase. Replicative synthesis was substantially more accurate than synthesis by the human DNA polymerase alpha-DNA primase complex purified from HeLa cell extracts by immunoaffinity chromatography, suggesting that additional factors or activities in the extract may increase fidelity during bidirectional replication. However, by using a sensitive opal codon reversion assay, single-base substitution errors were readily detected in the replication products at frequencies significantly higher than estimated spontaneous mutation rates in vivo. These data suggest that additional fidelity factors may be present during chromosomal replication in vivo and/or that the fidelity of replication alone does not account for the low spontaneous mutation rates in eukaryotes.

Antigens, Polyomavirus Transforming↗
PubMed1995

Identification and molecular analysis of Lactococcus lactis rpoD operon.

The complete nucleotide sequence of an open reading frame (ORF) preceding the Lactococcus lactis rpoD gene is reported. It was suggested that this ORF encodes Lactococcus lactis DNA primase and that the L. lactis rpoD operon consists of only two genes. Northern hybridization analysis showed that i) there are four mRNAs transcribing the rpoD gene (from upstream, M1-M4), ii) only the 3.7-kb transcript M1 includes the entire rpoD operon, iii) the shortest transcript M4 exists at both logarithmic and stationary phases of growth while the other three transcripts appear only at logarithmic phase, and iv) no apparent induction at the transcriptional level but transient repression of M1 was found when the growth temperature was shifted from 30 degrees C to 42 degrees C. 5'-ends of all four mRNAs were identified by primer extension analyses.

Amino Acid Sequence↗
PubMed2006

Thermus thermophilus bacteriophage phiYS40 genome and proteomic characterization of virions.

We determined the sequence of the 152,372 bp genome of phiYS40, a lytic tailed bacteriophage of Thermus thermophilus. The genome contains 170 putative open reading frames and three tRNA genes. Functions for 25% of phiYS40 gene products were predicted on the basis of similarity to proteins of known function from diverse phages and bacteria. phiYS40 encodes a cluster of proteins involved in nucleotide salvage, such as flavin-dependent thymidylate synthase, thymidylate kinase, ribonucleotide reductase, and deoxycytidylate deaminase, and in DNA replication, such as DNA primase, helicase, type A DNA polymerase, and predicted terminal protein involved in initiation of DNA synthesis. The structural genes of phiYS40, most of which have no similarity to sequences in public databases, were identified by mass spectrometric analysis of purified virions. Various phiYS40 proteins have different phylogenetic neighbors, including myovirus, podovirus, and siphovirus gene products, bacterial genes and, in one case, a dUTPase from a eukaryotic virus. phiYS40 has apparently arisen through multiple acts of recombination between different phage genomes as well as through acquisition of bacterial genes.

Amino Acid Sequence↗