Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Poly G”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 289 records · Page 16Linked to original sources
PubMed1996

Detection of the peptidyltransferase activity of a dipeptide, alanylhistidine, in the absence of ribosomes.

It was shown that a dipeptide, alanylhistidine, can act as a catalyst for the peptidyl transfer reaction in the absence of ribosomes between the amino acid moieties of phenylalanyl, lysyl, prolyl, and glycyl tRNAs depending on their model templates, poly U, poly A, poly C, and poly G, respectively. A template effect was observed: The peptidyl transfer reaction between tRNAGly molecules (anticodon GCC) occurred in the presence of poly G but not in the presence of poly C. The reaction was most efficient for the best stacked poly A (tRNALys) and least efficient for the worst stacked poly U (tRNAPhe).

Catalysis↗
PubMed1992

The rate-limiting step in yeast PGK1 mRNA degradation is an endonucleolytic cleavage in the 3'-terminal part of the coding region.

Insertion of an 18-nucleotide-long poly(G) tract into the 3'-terminal untranslated region of yeast phosphoglycerate kinase (PGK1) mRNA increases its chemical half-life by about a factor of 2 (P. Vreken, R. Van der Veen, V. C. H. F. de Regt, A. L. de Maat, R. J. Planta, and H. A. Raué, Biochimie 73:729-737, 1991). In this report, we show that this insertion also causes the accumulation of a degradation intermediate extending from the poly(G) sequence down to the transcription termination site. Reverse transcription and S1 nuclease mapping experiments demonstrated that this intermediate is the product of shorter-lived primary fragments resulting from endonucleolytic cleavage immediately downstream from the U residue of either of two 5'-GGUG-3' sequences present between positions 1100 and 1200 close to the 3' terminus (position 1251) of the coding sequence. Similar endonucleolytic cleavages appear to initiate degradation of wild-type PGK1 mRNA. Insertion of a poly(G) tract just upstream from the AUG start codon resulted in the accumulation of a 5'-terminal degradation intermediate extending from the insertion to the 1100-1200 region. RNase H degradation in the presence of oligo(dT) demonstrated that the wild-type and mutant PGK1 mRNAs are deadenylated prior to endonucleolytic cleavage and that the half-life of the poly(A) tail is three- to sixfold lower than that of the remainder of the mRNA. Thus, the endonucleolytic cleavage constitutes the rate-limiting step in degradation of both wild-type and mutant PGK1 transcripts, and the resulting fragments are degraded by a 5'----3' exonuclease, which appears to be severely retarded by a poly(G) sequence.

Base Sequence↗
PubMed1999

HmbR, a hemoglobin-binding outer membrane protein of Neisseria meningitidis, undergoes phase variation.

Neisseria meningitidis uses hemoglobin (Hb) as an iron source via two TonB-dependent outer membrane receptors, HmbR and HpuB. Analysis of 25 epidemiologically unrelated clinical isolates from serogroups A, B, C, and Y revealed that 64% strains possessed both Hb receptor genes. Examination of the hmbR expression pattern in strains in which the hpuB gene was genetically inactivated revealed two distinct Hb utilization phenotypes. Five strains retained the ability to grow as a confluent lawn, while seven grew only as single colonies around Hb discs. The single-colony phenotype observed for some hpuB mutants is suggestive of phase variation of hmbR. The length of the poly(G) tract starting at position +1164 of hmbR absolutely correlated with the two Hb utilization phenotypes. All five strains that grew as confluent lawns around Hb discs possessed either 9 or 12 consecutive G residues. All seven strains that grew as single colonies around Hb discs had poly(G) tracts of a length other than 9 or 12. These single-colony variants that arose around the Hb discs had poly(G) tracts with either 9 or 12 consecutive G residues restoring the hmbR reading frame. Inactivation of hmbR in these strains resulted in a loss of Hb utilization, demonstrating that the change in the hmbR gene was responsible for the phenotypic switch. The switching rates from hmbR phase off to phase on were approximately 5 x 10(-4) in four serogroup C strains, 2 x 10(-2) in the serogroup A isolate, and 7 x 10(-6) in the serogroup B isolate.

Animals↗
PubMed2004

Selective inhibition of c-Myb DNA-binding by RNA polymers.

BACKGROUND: The transcription factor c-Myb is expressed in hematopoietic progenitor cells and other rapidly proliferating tissues, regulating genes important for proliferation, differentiation and survival. The DNA-binding domain (DBD) of c-Myb contains three tandemly arranged imperfect repeats, designated Myb domain R1, R2 and R3. The three-dimensional structure of the DBD shows that only the second and third Myb domains are directly involved in sequence-specific DNA-binding, while the R1 repeat does not contact DNA and only marginally affects DNA-binding properties. No structural information is available on the N-terminal 30 residues. Since deletion of the N-terminal region including R1 plays an important role in oncogenic activation of c-Myb, we asked whether this region confers properties beyond DNA-binding to the neighbouring c-Myb DBD. RESULTS: Analysis of a putative RNA-binding function of c-Myb DBD revealed that poly(G) preferentially inhibited c-Myb DNA-binding. A strong sequence-selectivity was observed when different RNA polymers were compared. Most interesting, the poly(G) sensitivity was significantly larger for a protein containing the N-terminus and the R1-repeat than for the minimal DNA-binding domain. CONCLUSION: Preferential inhibition of c-Myb DNA binding by poly(G) RNA suggests that c-Myb is able to interact with RNA in a sequence-selective manner. While R2 and R3, but not R1, are necessary for DNA-binding, R1 seems to have a distinct role in enhancing the RNA-sensitivity of c-Myb.

DNA↗
PubMed1984

Interaction of the 1 alpha,25-dihydroxyvitamin D3 receptor with RNA and synthetic polyribonucleotides.

The interaction of the 1 alpha,25-dihydroxyvitamin D3 receptor with RNA and synthetic polynucleotides has been examined by using receptor from rachitic chicken intestine. Total intestinal RNA inhibited the binding of receptor to calf thymus DNA-cellulose with an efficiency equivalent to single-stranded DNA. A comparison of the inhibitory activity of several polyribonucleotides gave the following order of activities: poly(I) = poly(G) greater than or equal to double-stranded DNA greater than single-stranded DNA = poly(U). Poly(A), poly(C), and the ribonucleoside monophosphates AMP, GMP, CMP, and UMP had minimal activity. A preference for single-stranded homopolymers was observed [i.e., poly(I) and poly(U) were active, whereas poly(I):poly(C) and poly(U):poly(A) were not]. The ability of nucleic acids to displace receptor from DNA-cellulose was also measured. Both poly(G) and poly(I) were more active than double-stranded DNA in this assay. Furthermore, differences were noted between intestinal RNA fractions separated on the basis of poly(A) content. Receptor also bound to immobilized intestinal RNA and polynucleotides. The KCl concentration necessary to disrupt binding to a given polynucleotide generally paralleled the activity of that molecule in DNA-cellulose inhibition and displacement assays. These results suggest that the 1 alpha,25-dihydroxyvitamin D3 receptor can interact with RNA as well as DNA.

Animals↗
PubMed2006

Photoelectrochemical oxidation of DNA by ruthenium tris(bipyridine) on a tin oxide nanoparticle electrode.

Selective photoelectrochemical oxidation of DNA was achieved by ruthenium tris(bipyridine) immobilized on a tin oxide nanoparticle electrode. The metal complex was covalently attached to a protein, avidin, which adsorbed strongly on the tin oxide electrode by electrostatic interaction. Upon irradiation with 473-nm light, anodic photocurrent was generated in a blank electrolyte and was enhanced significantly after addition of poly(guanadylic acid) (poly-G) into the electrolyte. The current increased progressively with the nucleotide concentration, suggesting the enhancement effect was related to poly-G. The action spectrum indicates that the photocurrent was initiated by light absorption of the ruthenium compound immobilized on the electrode. Among the various polynucleotides examined, poly-G produced the largest photocurrent increase, followed by poly-A, single-stranded DNA, chemically damaged DNA, and double-stranded DNA, whereas poly-C and poly-U showed little effect. The combined experimental data support the hypothesis that the photoexcited Ru2+ species injects an electron into the semiconductor and produces Ru3+, which is then reduced back to Ru2+ by guanine and adenine bases in DNA, resulting in the recycling of the metal complex and enhanced photocurrent. The photoelectrochemical reaction can be employed as a new method for the detection of DNA damage.

2,2'-Dipyridyl↗
PubMed1996

Tryptophan intercalation in G, C containing polynucleotides: Z to B conversion of poly [d(G-5M C)] in low salt induced by a tetra peptide.

Binding of a tetra peptide, lysyl tryptophenyl glycyl lysine O-ter butyl ester (KWGK) with duplex forms of G, C containing polynucleotides, Poly [d(G-C)], Poly [d(G-5M C)], Poly (dG), Poly (dC) and E.coli DNA were studied under low salt conditions using UV absorption, fluorescence, and circular dichroic (C.D) spectroscopy. On addition of the peptide (upto a P/N mole ratio of 0.5), the Poly [d(G-5M C)] under low salt (1 mM Na Cl) conditions, was converted from Z to B-form as shown by the inversion of C.D spectra. The two binding constants (K1 and K2) were determined from fluorescence spectroscopy of which K2 estimates the intercalation of the tryptophenyl side chain between the base pairs of DNA and K1 estimates the electrostatic interactions between the lysyl side chains and phosphate groups. The strength of intercalation is: Z-form of Poly [d(G-5M C)] >> B form of Poly [d(G-5M C)] >> E.Coli DNA > Poly (dG).Poly (dC). This means that peptide seems to have strong preference for Z compared to B-form and for alternating over non-alternating G, C Sequences. This suggests that tryptophan intercalation may act as a discriminating factor in recognizing Z and B-forms and may have a potential role in Protein-Nucleic acid interactions that are important for transcription.

Binding Sites↗
PubMed2004

Stimulation of peripheral blood and intestinal mucosa cells by synthetic CpG oligodeoxynucleotides.

The breakdown of tolerance to autologous bacterial flora has been implicated as a major factor contributing to the initiation and perpetuation of chronic inflammation in inflammatory bowel diseases (IBD). To test whether bacterial DNA is at the origin of inflammation in IBD, we have examined the response of lamina propria (LPMC) or peripheral mononuclear cells (PBMC) and purified T cells from IBD patients and control patients to stimulations with a set of oligodeoxynucleotides (ODNs) characterized by the presence or absence of cytosine-guanosine dinucleotides (CpG) and/or 3' poly-guanosine (poly-G) extension. Furthermore we have evaluated the costimulatory activities of these ODNs on T cells activated via CD2 or CD3 pathway. We demonstrated that CpG ODNs induce higher proliferation of LPMC from inflammatory intestinal mucosa compared to healthy mucosa. We confirmed that CpG ODNs do not directly costimulate peripheral blood T cells activated by CD3 pathway. Finally, we revealed that CpG or non-CpG ODNs with 3' poly-G extension inhibit completely CD2 activation of purified PB or LP T-cells whereas only CpG ODNs without poly-G extension enhance proliferation and IFN-gamma production of PB T cells stimulated by CD2 pathway only in presence of NK and NK T cells. Our data suggest that NK T cells may be the primary target of ODNs and play a crucial role in indirect T-cell activation by ODN.

CD2 Antigens↗
PubMedDate not supplied

Structure and dynamics of two elastin-like polypentapeptides studied by NMR spectroscopy.

The structure and dynamics of two synthetic elastin-like polypentapeptides, poly(G(1)V(1)G(2)V(2)P) and poly(AV(1)GV(2)P), were studied in D(2)O and H(2)O at various temperatures by using (1)H, (2)H,(13)C, and (15)N NMR spectra, relaxations, and PGSE self-diffusivity measurement. Signal assignments were made using COSY, NOESY, HXCORR, HSQC, HMBC, and SSLR INEPT techniques. Temperature-induced conformation changes were studied using (3)J(NHCH) couplings, NOESY connectivity, chemical shifts, and signal intensities. Hydrodynamic radii were derived from self-diffusion coefficients measured by the pulsed-gradient spin-echo (PGSE) method. Selective hydration (hydrophilic or hydrophobic) was explored using NOESY and ROESY spectral methods and longitudinal and transverse (1)H relaxation of HOD and quadrupolar (2)H relaxation of D(2)O. Four different physical states were discerned in different temperature regions for both polymers: state I of a rather extended, statistically shaped and fully hydrated polymer below the critical temperature (approximately 299-300 K); state II, a relatively coiled and globular but disordered preaggregation state, developing in a rather narrow region, 300-303 K, in the case of poly(AV(1)GV(2)P) and in a broader region, overlapping with the next one, in poly(G(1)V(1)G(2)V(2)P); state III, a tightly coiled, more compact state in the region 303-313 K; and, finally, state IV, an aggregated (and eventually flocculating and sedimenting) state beyond 313 K. States II-IV coexist in varying proportions in the whole temperature range above 299 K. A structure characterized by a beta-turn stabilized by H-bonding between the Ala carbonyl and Val(2) NH groups of poly(AV(1)GV(2)P) was detected by NOESY just above the transition temperature. States II and III are progressively more stripped of their hydration sheath but retain some molecules of water confined and relatively immobilized in their coils.

Carbon Isotopes↗
PubMed1998

New sequence-specific human ribonuclease: purification and properties.

A new sequence-specific RNase was isolated from human colon carcinoma T84 cells. The enzyme was purified to electrophoretical homogeneity by pH precipitation, HiTrapSP and Superdex 200 FPLC. The molecular weight of the new enzyme, which we have named RNase T84, is 19 kDa. RNase T84 is an endonuclease which generates 5'-phosphate-terminated products. The new RNase selectively cleaved the phosphodiester bonds at AU or GU steps at the 3' side of A or G and the 5' side of U. 5'AU3' or 5'GU3' is the minimal sequence required for T84 RNase activity, but the rate of cleavage depends on the sequence and/or structure context. Synthetic ribohomopolymers such as poly(A), poly(G), poly(U) and poly(C) were very poorly hydrolysed by T84 enzyme. In contrast, poly(I) and heteroribopolymers poly(A,U) and poly(A,G,U) were good substrates for the new RNase. The activity towards poly(I) was stronger in two colon carcinoma cell lines than in three other epithelial cell lines. Our results show that RNase T84 is a new sequence-specific enzyme whose gene is abundantly expressed in human colon carcinoma cell lines.

Adenocarcinoma↗
PubMed1985

Interaction of nucleophiles with the enzymatically-activated carcinogen, N-hydroxy-2-acetylaminofluorene, and with the model ester, N-acetoxy-2-acetylaminofluorene.

A new method was devised to study adduct formation of N-acetyl-L-methionine (N-Ac-met) with activated species of the carcinogen N-hydroxy-2-acetylaminofluorene (N-OH-2-AAF). Following degradation of the adducts, the isomeric methylthio derivatives of 2-acetylaminofluorene (2-AAF) and 2-aminofluorene (2-AF) were separated and quantified by h.p.l.c. With the use of this method the nucleophilicity of N-Ac-met toward enzymatically produced N-acetoxy and N-sulfonoxy derivatives of 2-AF and 2-AAF, respectively, and toward the synthetic model ester, N-acetoxy-2-acetylaminofluorene (N-OAc-2-AAF), was determined. For comparison, the interaction of tRNA and polyguanylic acid (poly G) with the above compounds was measured by standard procedures. tRNA was an efficient acceptor of enzymatically formed N-acetoxy and N-sulfonoxy derivatives as well as of N-OAc-2-AAF. The nucleophilicity of N-Ac-met toward enzymatically formed N-sulfonoxy-2-AAF was comparable with that of tRNA. However, its reactivity with N-OAc-2-AAF and enzymatically generated N-acetoxy-2-aminofluorene (N-OAc-2-AF) was only 20% of that of tRNA. Poly G was as reactive as tRNA toward synthetic N-OAc-2-AAF and enzymatically generated N-OAc-2-AF but was only 25% as efficient as tRNA or N-Ac-met in accepting enzymatically formed N-sulfonoxy-2-AAF. The difference in the interaction of the three nucleophiles with N-OAc-2-AAF and N-OAc-2-AF compared with N-sulfonoxy-2-AAF indicate that N-OAc-2-AAF is not a general model of the ultimate electrophilic metabolites of 2-AAF. Studies of the kinetics of the interaction of N-OAc-2-AAF with N-Ac-met, tRNA and poly G demonstrated dependence of adduct formation on nucleophile concentration, indicative of a bimolecular mechanism. Arylamidonium or nitrenium ions are therefore not necessarily the ultimate electrophilic metabolites of 2-AAF obligatory for interaction with cellular nucleophiles. There was no evidence that nitrenium ions are intermediates in the cytosolic reduction of N-OH-2-AAF to 2-AAF.

2-Acetylaminofluorene↗
PubMed2004

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells.

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.

Adjuvants, Immunologic↗
PubMed2003

Frameshift mutations in the bax gene are not involved in development of ovarian endometrioid carcinoma.

The purpose of this study was to determine whether mutations in the Bax gene play a role in the development of ovarian endometrioid carcinoma with a microsatellite instability phenotype. We analyzed a total of 60 tumor specimens, 49 ovarian endometrioid carcinomas and 11 concurrent endometrial endometrioid carcinomas from 49 patients. Fourteen ovarian endometrioid carcinomas and 6 endometrial endometrioid carcinomas showed a microsatellite instability-high phenotype. Tumor and normal-tissue specimens from eight patients with a microsatellite instability-high phenotype colorectal carcinoma were included in this study as controls. The presence or absence of a mutation in the poly (G) 8 tract of the Bax gene was determined by polymerase chain reaction followed by direct DNA sequence analysis. A 1-base pair deletion at the poly (G) 8 tract and no expression of Bax and Bcl-2 proteins were identified in one microsatellite instability-high endometrial endometrioid carcinoma. Immunohistochemical staining for Bax and Bcl-2 proteins was negative on the tumor specimen that had this 1-base pair deletion. No mutations were found in the synchronous microsatellite instability-high ovarian endometrioid carcinoma from the same patient. In contrast, four (50%) of the eight microsatellite instability-high sporadic colorectal carcinomas had a mutation in the poly (G) 8 tract. Although Bax plays an important role in carcinogenesis of the colorectum with microsatellite instability-high phenotype, Bax may not play a direct role in the genesis of ovarian endometrioid carcinoma, regardless of microsatellite instability status.

Biomarkers, Tumor↗
PubMed2006

In vitro and in vivo differential expression of rainbow trout (Oncorhynchus mykiss) Mx isoforms in response to viral haemorrhagic septicaemia virus (VHSV) G gene, poly I:C and VHSV.

Three different Mx isoforms are known to be present in rainbow trout, however, to date, neither their mechanism of action nor their regulation have been established. Because most previous studies have focused only on one Mx isoform of the three present in rainbow trout, the expression of all isoforms was simultaneously studied in this work in response to the viral haemorrhagic septicaemia virus (VHSV) G gene, poly I:C or VHSV. Thus, RT-PCR assays were specifically designed to amplify each of the Mx1, Mx2 and Mx3 transcripts induced both in vitro (RTG-2 cell line and head kidney leucocytes) and in vivo (muscle, head kidney, spleen and liver). Regardless of the inducer used, in vitro results showed that while in RTG-2 cells Mx3 was predominantly induced, all three isoforms were similarly induced in head kidney leukocytes. In vivo, regardless of the inducer used a predominant expression of Mx3 transcripts was also observed in muscle but expression of all three Mx isoforms or predominantly Mx1 and Mx2 was found in head kidney and spleen. Mx expression in the liver was however more dependent on the inducer used. In conclusion, the results obtained demonstrated, for the first time, that both in vitro and in vivo the expression of the different Mx genes is differentially regulated. Moreover, this is also the first report showing Mx induction after cell transfection with a plasmid coding for the VHSV-G protein.

Animals↗
PubMedDate not supplied

Interaction of Rhodium(II) carboxylates with molecules of biologic importance.

Rhodium(II) acetate, propionate, and butyrate showed a considerable variation in their antitumor activity against Ehrlich ascites tumor cells in mice, with the butyrate complex being the most active. The three complexes markedly inhibited DNA synthesis of Ehrlich ascites tumor cells in vivo. Rhodium (II) butyrate was the most potent inhibitor followed by the propionate complex. One hour after administration, rhodium(II) propionate and butyrate induce more uridine-5-3H incorporation into RNA than is seen in the controls. Equilibrium dialysis studied showed that rhodium(II) acetate-1-14C binds to single stranded DNA, poly-A, ribonuclease A, and bovine serum albumin but not to highly polymerized native calf thymus DNA, poly-G, or poly-C. In these cases binding occurred at the two axial positions of rhodium(II) acetate to a nitrogen donor in the ligands. The formation constants of the rhodium(II) acetate and propionate complexes with 5'-adenosine monophosphate were determined. The rhodium(II) propionate complex was more stable. Sedimentation and viscosity measurements of poly-A and poly-A/rhodium(II) acetate complexes indicate a high degree of intramolecular crosslinking in the rhodium(II) acetate/poly-A complex. The rhodium(II) carboxylate complexes were also found to be potent inhibitors of purified DNA polymerase I and RNA polymerase from Escherichia coli.

Acetates↗
PubMed2004

Epstein-Barr virus nuclear antigen 1 is a DNA-binding protein with strong RNA-binding activity.

Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA-1) plays key roles in both the regulation of gene expression and the replication of the EBV genome in latently infected cells. To characterize the RNA-binding activity of EBNA-1, it was demonstrated that EBNA-1 binds efficiently to RNA homopolymers that are composed of poly(G) and weakly to those composed of poly(U). All three RGG boxes of EBNA-1 contributed additively to poly(G)-binding activity and could mediate RNA binding when attached to a heterologous protein in an RNA gel mobility-shift assay. In vitro-transcribed EBV and non-EBV RNA probes revealed that EBNA-1 bound to most RNAs examined and the affinity increased as the content of G and U increased, as demonstrated in competition assays. Among these probes, the 5' non-coding region (NCR) (nt 131-278) of hepatitis C virus RNA appeared to be the strongest competitor for EBNA-1 binding to the EBV-encoded small nuclear RNA 1 (EBER1) probe, whereas a mutant 5' NCR RNA with partially disrupted secondary structure was a weak competitor. Furthermore, the interaction of endogenous EBNA-1 and EBER1 in EBV-infected cells was demonstrated by a ribonucleoprotein immunoprecipitation assay. These results revealed that EBNA-1 is a DNA-binding protein with strong binding activity to a relatively broad spectrum of RNA and suggested an additional biological impact of EBNA-1 through its ability to bind to RNA.

DNA-Binding Proteins↗
PubMed1989

Binding of 7H-dibenzo[c,g]carbazole to polynucleotides and DNA in vitro.

The N-heterocyclic aromatic pollutant, 7H-dibenzo[c,g]carbazole (DBC), is a potent carcinogen having both local and systemic effects. The overall objective of this research was to investigate the nature of the covalent binding of DBC with nucleic acids in vitro. DBC was shown to bind to polynucleotides, RNA and DNA in an in vitro rat or hamster microsomal enzyme assay, exhibiting a preferential binding to polyguanylic acid (poly[G]). Benzo[a]pyrene (BaP) binding to these same nucleic acids was determined simultaneously and was approximately 10-fold higher than DBC binding under identical experimental conditions. DBC-nucleic acid binding was shown to be dependent upon the presence of a microsomal activating system, the results being similar for rat or hamster liver microsomes. This microsome-dependent binding was unaffected by the addition of epoxide hydrase activity modifiers but was almost completely inhibited by alpha-naphthoflavone. The nature of DBC-nucleic acid binding was investigated using fluorescence spectroscopy. Benzo[c]carbazole and 5,5,6,6-tetrahydrodibenzo[c,g]carbazole were synthesized as representatives of the effect of disruption of the DBC pi-electron system on fluorescence excitation and emission. DBC-poly[G] adducts were isolated from binding assay mixtures and separated by HPLC. Results indicated that there are at least three different DBC-poly[G] adducts formed in vitro. The emission spectra of isolated adducts were similar in shape to that of DBC; however, the adduct spectra were shifted 5-10 nm toward longer wavelengths. This suggests that the bound DBC species have intact pi-electron systems. Results are consistent with binding through the nitrogen position as well as binding through the 1,2,3,4-ring of the molecule.

Animals↗