Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Micrococcus”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 289 records · Page 16Linked to original sources
PubMed1979

Excision repair of gamma-ray-induced alkali-stable DNA lesions with the help of gamma-endonuclease from Micrococcus luteus.

gamma-Endonuclease Y, an enzyme that hydrolyses phosphodiester bonds at alkalistable lesions in gamma-irradiated (N2, tris buffer) DNA, has been partially purified from Micrococcus luteus. The enzyme has a molecular weight of about 19 000, induces single-strand breaks with 3'OH-5'PO4 termini and contains endonuclease activity towards DNA treated with 7-bromomethylbenz(a)anthracene. gamma-Endonuclease Y induces breaks in OsO4-treated poly(dA-dT) and apparently is specific towards gamma-ray-induced base lesions of the t' type. The complete excision repair of gamma-endonuclease Y substrate sites has been performed in vitro by gamma-endonuclease Y, DNA polymerase and ligase.

Coliphages↗
PubMed1980

Properties of an endonuclease activity in Micrococcus luteus acting on gamma-irradiated DNA and on apurinic DNA.

A protein fraction from Micrococcus luteus with endonuclease activity against gamma-irradiated DNA was isolated and characterized. An additional activity on apurinic sites could not be separated, either by sucrose gradient sedimentation or by gel filtration through Sephadex G 100. From gel filtration, a molecular weight of about 25 000 was calculated for both endonuclease activities. The endonuclease activity against gamma-irradiated DNA was stimulated five-fold with 5 mM Mg++, whereas that against apurinic sites was less dependent on the Mg++ concentration. 100 mM KCl inhibited the gamma-ray endonuclease, but not the apurinic endonuclease activity. In gamma-irradiated RNA the protein recognized 1.65 endonuclease sensitive sites per radiation induced single-strand break, among which are 0.45 alkali labile lesions in the nucleotide strand. The affinity of the enzyme for the endonuclease sensitive site was evaluated resulting in a Km-value of 73 nM.

Centrifugation, Density Gradient↗
PubMed1980

DNA-membrane complex restoration in Micrococcus radiodurans after X-irradiation: relation to repair, DNA synthesis and DNA degradation.

The DNA-membrane complex in Micrococcus radiodurans was shown to be essentially constituted of proteins, lipids and DNA. The complex was dissociated immediately after X-irradiation of cells and restored during post-incubation in complete medium. In X-irradiated protoplasts some DNA remained associated with the complex. Restoration of the complex during post-incubation was only seen in a medium favouring DNA polymerase and ligase activities. Under this condition no DNA synthesis occurred, suggesting that complex restoration may involve ligase activity. The complex restoration in the wild type and the X-ray sensitive mutant UV17 of M. radiodurans was strictly dependent on the X-ray dose. It was correlated with survival and DNA degradation but always preceded the onset of DNA synthesis after X-irradiation. At the same dose the complex restoration was about 2 fold lower in mutant than in wild type cells indicating that the restoration of the complex is related to repair capacity. The results are consistent with the idea that the complex protects X-irradiated DNA of M. radiodurans from further breakdown and, subsequently, permits DNA synthesis and repair to occur.

Animals↗
PubMed2005

Bioremediation of contaminated surface water by immobilized Micrococcus roseus.

The problems caused by contaminated surface water have gradually become more serious in recent years. Although various remediation technologies were investigated, unfortunately, no efficient method was developed. In this paper, a new bioremediation technology was studied using Micrococcus roseus, which was immobilized in porous spherical beads by an improved polyvinyl alcohol (PVA) - sodium alginate (SA) embedding method. The experimental results indicated that COD removal rate could reach 64.7 % within 72 hours when immobilized M. roseus beads were used, which was ten times as high as that of free cells. The optimum inoculation rate of immobilized M. roseus beads was 10 % (mass percent of the beads in water sample, g g(-1)). Suitable aeration was proved necessary to enhance the bioremediation process. The immobilized cells had an excellent tolerance to pH and temperature changes, and were also more resistant to heavy metal stress compared with free cells. The immobilized M. roseus beads had an excellent regeneration capacity and could be reused after 180-day continuous usage. The Scanning Electronic Microscope (SEM) analysis showed that the bead microstructure was suitable for M. roseus growth, however, some defect structures should still be improved.

Alginates↗
PubMed1975

A genetic and biochemical study of histidine biosynthesis in Micrococcus luteus.

Histidine auxotrophs of Micrococcus luteus strain ATCC 27141 were induced by treatment of the parent strain with N-methyl-N'-nitro-N-nitrosoguanidine. Auxotrophs were biochemically characterized by examining culture accumulations of histidine intermediates, using paper chromatography and the Bratton-Marshall test, and growth responses to L-histidinol. his(IG) mutants failed to accumulate Pauly-positive imidazoles; his(EAHF) mutants accumulated 5-amino-1-ribosyn-4-imidazole carboxamide; hisB mutants accumulated imidazoleglycerol; hisC mutants accumulated imidazoleacetol; hisD mutants, but did stimulate all other histidine mutants, blocked at earlier steps in the biosynthetic pathway. In addition, imidazoleglycerol phosphate dehydrase activity was assayed in representative mutants of each class. hisB mutants lacked activity for this enzyme.--Two -point, three-point, and cotransformation analyses resolved linkage relationships of histidine genes and in two gene clusters aided in determining their sequences. Histidine biosynthetic genes exist in at least four separate, unlinked regions of the chromosome. One histidine gene cluster linked to a tryptophan gene cluster and appears to be contiguous in the sequence his(IG) -his(EAHF)-trpE-trpC-trpA. A second and unlinked histidine cluster has the tentative gene sequence his(EAHF)-hisB-hisC-his(EAHF). The hisD gene and an unclassified mutant site his-94 are not linked to any of the other histidine genes examined in this study or to each other.

Chromatography, Paper↗
PubMed2004

Dimannosyldiacylglycerol serves as a lipid anchor precursor in the assembly of the membrane-associated lipomannan in Micrococcus luteus.

Based on recent analytical and enzymological studies, a topological model for the role of alpha-D-mannosyl-(1-->3)-alpha-D-mannosyl-(1-->3)-diacylglycerol (Man(2)-DAG) as a lipid anchor precursor and mannosylphosphorylundecaprenol (Man-P-Und) as a mannosyl donor in the assembly of a membrane-associated lipomannan (LM) in Micrococcus luteus has been proposed. In this study, a [(3)H]mannose-suicide selection procedure has been used to identify temperature-sensitive (ts) mutants defective in LM assembly. Two micrococcal mutants with abnormal levels of Man(2)-DAG and LM at the nonpermissive temperature (37 degrees C), mms1 and mms2, have been isolated and characterized. In vivo and in vitro biochemical assays indicate that mms1 cells have a defect in the mannosyltransferase catalyzing the conversion of Man-DAG to Man(2)-DAG, and mms2 has a temperature-sensitive defect in the synthesis of Man-P-Und. Because mms1 cells are depleted of endogenous Man(2)-DAG, membranes from this mutant efficiently converted purified, exogenous [(3)H]Man(2)-DAG to [(3)H]LM by a Man-P-Und-dependent process. An obligatory role for Man-P-Und as a mannosyl donor in the elongation process was also demonstrated by showing that the conversion of exogenous [(3)H]Man(2)-DAG to [(3)H]LM by membranes from mms1 cells in the presence of GDP-Man was inhibited by amphomycin. In addition, consistent with Man(2)-DAG serving as a lipid anchor precursor for LM assembly, endogenous, prelabeled [(3)H]Man(2)-DAG was converted to [(3)H]LM when membranes from mms2 cells were incubated with purified, exogenous Man-P-Und. These studies provide the first direct proof for the role of Man(2)-DAG as the lipid anchor precursor for LM, and suggest that Man(2)-DAG may be essential for the normal growth of M. luteus cells.

Cell Membrane↗
PubMed2003

Significance of highly conserved aromatic residues in Micrococcus luteus B-P 26 undecaprenyl diphosphate synthase.

Undecaprenyl diphosphate synthase catalyzes the sequential condensation of eight molecules of isopentenyl diphosphate (IPP) in the cis-configuration into farnesyl diphosphate (FPP) to produce undecaprenyl diphosphate (UPP), which is indispensable for the biosynthesis of the bacterial cell wall. This cis-type prenyltransferase exhibits a quite different mode of binding of homoallylic substrate IPP from that of trans-type prenyltransferase [Kharel Y. et al. (2001) J. Biol. Chem. 276, 28459-28464]. In order to know the IPP binding mode in more detail, we selected six highly conserved residues in Regions III, IV, and V among nine conserved aromatic residues in Micrococcus luteus B-P 26 UPP synthase for substitution by site-directed mutagenesis. The mutant enzymes were expressed and purified to homogeneity, and then their effects on substrate binding and the catalytic function were examined. All of the mutant enzymes showed moderately similar far-UV CD spectra to that of the wild-type, indicating that none of the replacement of conserved aromatic residues affected the secondary structure of the enzyme. Kinetic analysis showed that the replacement of Tyr-71 with Ser in Region III, Tyr-148 with Phe in Region IV, and Trp-210 with Ala in Region V brought about 10-1,600-fold decreases in the kcat/Km values compared to that of the wild-type but the Km values for both substrates IPP and FPP resulted in only moderate changes. Substitution of Phe-207 with Ser in Region V resulted in a 13-fold increase in the Km value for IPP and a 1,000-2,000-fold lower kcat/Km value than those of the wild-type, although the Km values for FPP showed about no significant changes. In addition, the W224A mutant as to Region V showed 6-fold and 14-fold increased Km values for IPP and FPP, respectively, and 100-250-fold decreased kcat/Km values as compared to those of the wild-type. These results suggested that these conserved aromatic residues play important roles in the binding with both substrates, IPP and FPP, as well as the catalytic function of undecaprenyl diphosphate synthase.

Alkyl and Aryl Transferases↗
PubMed2005

Purification and characterization of an esterase hydrolyzing monoalkyl phthalates from Micrococcus sp. YGJ1.

An esterase that specifically hydrolyzes medium-chain (C(3)-C(5)) monoalkyl phthalates was purified from phthalate-grown Micrococcus sp. YGJ1. The enzyme activity was split into two fractions by hydrophobic chromatography on Phenyl Sepharose, and the enzymes were purified to homogeneity from each fraction. The purified enzymes showed similar properties with respect to molecular mass (60 kDa), subunit molecular mass (27 kDa), N-terminal amino acid sequence, optimal pH (about 7.5), temperature-dependence, substrate specificity, and inhibitor susceptibility. The enzymes showed no activity toward various dialkyl phthalates or aliphatic carboxyl esters. 2-Mercaptoethanol effectively protected the enzymes from spontaneous inactivation. Diethylpyrocarbonate, p-chloromercuribenzoate, Hg(2+), and Cu(2+) strongly inhibited the enzymes, while phenylmethylsulfonyl fluoride produced weak inhibition, and various metal chelating reagents were ineffective. These findings show that the enzymes bear a close resemblance to the putative phthalate ester hydrolase (PehA) of Arthrobacter keyseri 12B.

Carboxylic Ester Hydrolases↗
PubMed1985

Excision of uracil residues in DNA: mechanism of action of Escherichia coli and Micrococcus luteus uracil-DNA glycosylases.

Various octadeoxynucleotides containing uracil at different positions were synthesized and submitted to the action of Escherichia coli and Micrococcus luteus uracil-DNA glycosylases. A uracil residue situated at the 5'-end was excised by the M.luteus enzyme but not by the E.coli one. Uracil residues located at the ultimate and penultimate positions at the 3'-end were not cleaved by either enzymes. At the other central positions, uracil was eliminated with different initial velocities. Single stranded phi X 174 DNA fragments were used to study the influence of the sequence. Cytosine bases were deaminated to give uracil by bisulfite treatment. It was shown that the initial excision velocity of two vicinal uracil residues was decreased. The same observation was made for two uracils separated by one base. A hypothetical scheme is suggested to explain the mechanism of action of uracil-DNA glycosylases.

Base Sequence↗
PubMed1990

Role of GC-biased mutation pressure on synonymous codon choice in Micrococcus luteus, a bacterium with a high genomic GC-content.

The GC (G + C, or G or C)-contents of codon silent positions in all two-codon sets and three codons AUY/A (IIe), and in most of the family boxes of Micrococcus luteus (genomic GC-content: 74%) are 95% to 100% in both the highly and weakly expressed genes. In some family boxes, there is a decrease in NNC codons and an increase in NNG codons from the highly expressed to weakly expressed genes without apparent involvement of NNU and NNA codons. From these observations, we conclude that the selective use of synonymous codons in M. luteus may be largely determined by GC-biased mutation pressure and that in the highly expressed genes tRNAs would act as a weak selection pressure in some family boxes. Available data suggest that the effect of selection pressure by tRNAs on the synonymous codon choice becomes more apparent in the highly expressed genes in eubacteria with intermediate GC-contents such as Escherichia coli and Bacillus subtilis, and that the U/C ratio of the codon third positions in NNU/C-type two-codon sets in the weakly expressed genes would represent the approximate magnitude of directional mutation pressure throughout eubacteria.

Base Sequence↗
PubMed1975

Further characterization of the polynucleotide phosphorylase of Micrococcus luteus.

The purification of polynucleotide phosphorylase from Micrococcus luteus by chromatography on phosphocellulose colums is described. This procedure offers several advantages over previous procedures. Previously determined molecular weights for Form-I enzyme and Form-T enzyme derived from Form-I by limited tryptic hydrolysis were confirmed as 2.7 and 2.3 times 10-5, respectively. Form-I appears homogeneous in the ultracentrifuge, but multiple active protein species are separable by polyacrylamide gel electrophoresis. The multiple species are probably the result of proteolysis. On polyacrylamide gel electrophoresis under denaturing conditions, Form-T yielded a single size of subunit of 71,000 daltons, and Form-I yielded several bands of different molecular sizes. These results differ from earlier determinations. The amino acid compositions of Form-I and Form-T are reported. Form-I contains only between 8 and 10 cysteine residues per molecule and Form-T half that many.

Amino Acids↗
PubMed1997

Exploiting unassigned codons in Micrococcus luteus for tRNA-based amino acid mutagenesis.

An alternative to suppression of stop codons for the biosynthetic insertion of non-natural amino acids has been developed. Micrococcus luteus , a Gram-positive bacterium, is incapable of translating at least two codons. One of these unused codons was inserted in a gene to act as a nonsense site. An aminoacylated tRNA was synthesized which was complementary to this codon. The gene containing the missing codon was expressed in vitro in a M.luteus transcription/translation system. Read-through of the missing codon occurred only when the complementary tRNA was included. The results demonstrate that M.luteus can be used for incorporation of amino acids via synthetically prepared aminoacylated tRNAs. The use of a M. luteus translation system provides a method for incorporation of non-natural amino acids which avoids the use of stop codons.

Amino Acid Sequence↗
PubMed1976

A deoxyadenylate kinase activity associated with polynucleotide phosphorylase from Micrococcus luteus.

We report here the presence of two enzymatic activities associated with highly purified preparations of polynucleotide phosphorylase from Micrococcus luteus. The first, a nuclease activity, which is not separated from the phosphorylase on hydroxylapatite, may be due to substitution of H2O for phosphate in the phosphorolysis reaction. The second activity, a deoxyadenylate kinase, the bulk of which is not resolved from the phosphorylase using gel filtration, sucrose density gradient centrifugation, DEAE-Sephadex, or hydroxylapatite chromatography, may represent a new activity of polynucleotide phosphorylase or be due to an enzyme which is tightly bound to the phosphorylase. Several properties of the kinase are described and its possible significance with respect to the overall enzyme mechanism is discussed.

Adenosine Monophosphate↗
PubMed1977

DNA-relaxing enzyme from Micrococcus luteus.

A DNA-relaxing enzyme which catalyzes the conversion of superhelical DNA to a non-superhelical covalently closed form has been purified from Micrococcus luteus to near homogeneity by two chromatographic steps. The enzyme is a single polypeptide chain. As determined by sodium dodecyl sulfate - polyacrylamide gel electrophoresis and gel filtration on Sephadex G 150, the molecular weight is 115,000. The DNA-relaxing activity determined as a function of enzyme concentration follows a sigmoidal curve. The enzyme requires Mg++ for activity. In the presence of 4.5 mM Mg++ addition of 50-250 mM KCl yields incompletely relaxed DNA molecules (intermediates); intermediates are also observed in the absence of KCl, when the reaction is carried out at 0 degree C or at Mg++ concentrations exceeding 10 mM.

DNA Topoisomerases, Type I↗
PubMed1978

Enzymes from Micrococcus luteus involved in the initial steps of excision repair of spontaneous DNA lesions: uracil-DNA-glycosidase and apurinic-endonucleases.

Uracil-DNA-glycosidase that releases free uracil from single-stranded or double-stranded deaminated DNA and poly d(A-U) has been partially purified from Micrococcus luteus. The enzyme has a molecular weight of about 16,000 and can be separated from uracil-endonuclease and endonucleases (AP-endonucleases) specific for apurinic and apyrimidinic sites. Uracil-DNA-glycosidase does not act on guanine residues opposite uracil in double-stranded DNA and on xanthine in deaminated DNA. The glycosidase generates apyrimidinic sites which can serve as substrate sites for different AP-endonucleases from M. luteus.

Apurinic Acid↗
PubMed1980

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

Bacillus subtilis↗
PubMed2000

Significance of Asn-77 and Trp-78 in the catalytic function of undecaprenyl diphosphate synthase of Micrococcus luteus B-P 26.

The primary structures of cis-prenyltransferases are completely different from those of trans-prenyltransferases. To obtain information about amino acid residues relating to catalytic function, random mutation of the undecaprenyl diphosphate synthase gene of Micrococcus luteus B-P 26 was carried out to construct a mutated gene library using an error-prone polymerase chain reaction. From the library, the mutants showing poor enzymatic activity were selected by the colony autoradiography method. Among 31 negative clones selected from 3,000 mutants, two clones were found to contain only one amino acid substitution at either Asn-77 or Trp-78. To determine the functional roles of these interesting residues, we prepared six mutated enzymes with substitutions at residues Asn-77 or Trp-78 by site-directed mutagenesis. Substitution of Asn-77 with Ala, Asp, or Gln resulted in a dramatic decrease in catalytic activity, but the K(m) values for both allylic and homoallylic substrates of these mutant enzymes were comparable to those of the wild-type. On the other hand, three Trp-78 mutants, W78I, W78R, and W78D, showed 5-20-fold increased K(m) values for farnesyl diphosphate but not for Z-geranylgeranyl diphosphate. However, these mutants showed moderate levels of enzymatic activity and comparable K(m) values for isopentenyl diphosphate to that of the wild-type. These results suggest that the Asn-Trp motif is involved in the binding of farnesyl diphosphate and enzymatic catalysis.

Alkyl and Aryl Transferases↗
PubMed1988

Undecaprenyl diphosphate synthase from Micrococcus luteus B-P 26: essential factors for the enzymatic activity.

An undecaprenyl diphosphate synthase fraction, which was free of other prenyltransferases and was active without the addition of detergent or phospholipid, was obtained by Sephadex G-100 chromatography of cell-free extracts of Micrococcus luteus B-P 26 cells. The addition of small amounts of Triton X-100 to this fraction caused a marked loss of the enzyme activity, but the activity was gradually restored as further detergent was added. When the enzyme fraction was chromatographed on DEAE-cellulose, the synthase was partially purified, but the activity was not detected unless assayed with addition of the detergent or a lipid fraction of this bacterium. Among the three phospholipids isolated from this bacterium, cardiolipin and phosphatidylglycerol had a marked effect in activating lipid-depleted undecaprenyl diphosphate synthase, but O-lysylphosphatidylglycerol, which occurs prominently in this bacterium, had little effect.

Alkyl and Aryl Transferases↗