Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Genes, Developmental”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 289 records · Page 16Linked to original sources

Distinct HP1 and Su(var)3-9 complexes bind to sets of developmentally coexpressed genes depending on chromosomal location.

Heterochromatin proteins are thought to play key roles in chromatin structure and gene regulation, yet very few genes have been identified that are regulated by these proteins. We performed large-scale mapping and analysis of in vivo target loci of the proteins HP1, HP1c, and Su(var)3-9 in Drosophila Kc cells, which are of embryonic origin. For each protein, we identified approximately 100-200 target genes among >6000 probed loci. We found that HP1 and Su(var)3-9 bind together to transposable elements and genes that are predominantly pericentric. In addition, Su(var)3-9 binds without HP1 to a distinct set of nonpericentric genes. On chromosome 4, HP1 binds to many genes, mostly independent of Su(var)3-9. The binding pattern of HP1c is largely different from those of HP1 and Su(var)3-9. Target genes of HP1 and Su(var)3-9 show lower expression levels in Kc cells than do nontarget genes, but not if they are located in pericentric regions. Strikingly, in pericentric regions, target genes of Su(var)3-9 and HP1 are predominantly embryo-specific genes, whereas on the chromosome arms Su(var)3-9 is preferentially associated with a set of male-specific genes. These results demonstrate that, depending on chromosomal location, the HP1 and Su(var)3-9 proteins form different complexes that associate with specific sets of developmentally coexpressed genes.

Animals↗

An additional copy of the adenylate cyclase-encoding gene relieves developmental defects produced by a mutation in a vegetative incompatibility-controlling gene in Podospora anserina.

To identify cellular functions involved in vegetative incompatibility in filamentous fungi, we have initiated the cloning of Podospora anserina (Pa) mod genes. These genes interfere with the lethal reaction triggered by interaction between incompatible het genes. A gene (Pa AC) has been cloned by complementation of developmental defects caused by a mutation in the mod-D gene. This gene encodes a protein of 2145 amino acids (aa)that exhibits strong similarities with many adenylate cyclases (AC). About 65% aa identity has been found between the sequence of the polypeptide encoded by this Pa AC gene and the AC of Neurospora crassa. The organization of peptidic domains in the polypeptide encoded by Pa AC is closely related to that of Saccharomyces cerevisiae CYR1. Restriction-fragment-length polymorphism (RFLP) and genetic analysis have shown that Pa AC and mod-D are distinct genes.

Adenylyl Cyclases↗

Association of developmental regulatory genes with the development of different molar tooth shapes in two species of rodents.

While the evolutionary history of mammalian tooth shapes is well documented in the fossil record, the developmental basis of their tooth shape evolution is unknown. We investigated the expression patterns of eight developmental regulatory genes in two species of rodents with different molar morphologies (mouse, Mus musculus and sibling vole, Microtus rossiaemeridionalis). The genes Bmp-2, Bmp-4, Fgf-4 and Shh encode signal molecules, Lef-1, Msx-1 and Msx-2, are transcription factors and p21CIP1/WAF1 participates in the regulation of cell cycle. These genes are all known to be associated with developmental regulation in mouse molars. In this paper we show that the antisense mRNA probes made from mouse cDNA cross-hybridized with vole tissue. The comparisons of gene expression patterns and morphologies suggest that similar molecular cascades are used in the early budding of tooth germs, in the initiation of tooth crown base formation, and in the initiation of each cusp's development. Furthermore, the co-localization of several genes indicate that epithelial signalling centres function at the three stages of morphogenesis. The earliest signalling centre in the early budding epithelium has not been reported before, but the latter signalling centres, the primary and the secondary enamel knots, have been studied in mouse. The appearance of species-specific tooth shapes was manifested by the regulatory molecules expressed in the secondary enamel knots at the areas of future cusp tips, whilst the mesenchymal gene expression patterns had a buccal bias without similar species-specific associations.

Animals↗

E2a-Pbx1 induces aberrant expression of tissue-specific and developmentally regulated genes when expressed in NIH 3T3 fibroblasts.

The E2a-Pbx1 oncoprotein contains the transactivation domain of E2a joined to the DNA-binding homeodomain (HD) of Pbx1. In mice, E2a-Pbx1 transforms T lymphoblasts and fibroblasts and blocks myeloblast differentiation. Pbx1 and E2a-Pbx1 bind DNA as heterodimers with other HD proteins whose expression is tissue specific. While the transactivation domain of E2a is required for all forms of transformation, DNA binding by the Pbx1 HD is essential for blocking myeloblast differentiation but dispensable for fibroblast or T-lymphoblast transformation. These properties suggest (i) that E2a-Pbx1 causes cellular transformation by activating gene transcription, (ii) that transcription of E2a-Pbx1 target genes is normally regulated by ubiquitous Pbx proteins and tissue-specific partners, and (iii) that DNA-binding mutants of E2a-Pbx1 activate a subset of all gene targets. To test these predictions, genes induced in NIH 3T3 fibroblasts by E2a-Pbx1 were identified and examined for tissue- and stage-specific expression and their differential abilities to be upregulated by E2a-Pbx1 in NIH 3T3 fibroblasts and myeloblasts and by a DNA-binding mutant of E2a-Pbx1 in NIH 3T3 cells. Of 12 RNAs induced by E2a-Pbx1, 4 encoded known proteins (a J-C region of the immunoglobulin kappa light chain, natriuretic peptide receptor C, mitochondrial fumarase, and the 3',5'-cyclic nucleotide phosphodiesterase, PDE1A) and 5 encoded new proteins related to angiogenin, ion channels, villin, epidermal growth factor repeat proteins, and the human 2.19 gene product. Expression of many of these genes was tissue specific or developmentally regulated, and most were not expressed in fibroblasts, indicating that E2a-Pbx1 can induce ectopic expression of genes associated with lineage-specific differentiation.

3T3 Cells↗

Gene expression in single cells of Bacillus subtilis: evidence that a threshold mechanism controls the initiation of sporulation.

Early during endospore formation in the bacterium Bacillus subtilis, two distinct cell types are formed. The initiation of this developmental pathway requires several physiological conditions (e.g., nutrient deprivation) and is controlled by the Spo0A transcription factor. We have found that in a culture of sporulating cells, there are two subpopulations, one that has initiated the developmental program and activated the expression of early developmental genes and one in which early developmental gene expression remains uninduced. We measured the expression of developmental (spo) genes in single cells of B. subtilis by using spo-lacZ fusions. Cells containing a spo-lacZ fusion were stained with a dye that fluoresces upon hydrolysis by beta-galactosidase, and the fluorescence in individual cells was measured with a flow cytometer. For Spo+ cells, we found that the proportion of the population expressing early developmental genes correlates well with the fraction of the population that eventually produces spores. In addition, mutations that cause a decrease in the amount of activated (phosphorylated) Spo0A transcription factor cause a decrease in the size of the subpopulation expressing early developmental genes that are directly activated by Spo0A approximately P. Again, the size of the subpopulation correlates well with the fraction of cells that produce spores. These results indicate that a threshold level of activated Spo0A (Spo0A approximately P) or of a component of the phosphorylation pathway must accumulate to induce sporulation gene expression and that most of the cells that are able to induce the expression of early genes that are directly activated by Spo0A approximately P go on to produce mature spores.(ABSTRACT TRUNCATED AT 250 WORDS)

Bacillus subtilis↗

The stress- and abscisic acid-induced barley gene HVA22: developmental regulation and homologues in diverse organisms.

Abscisic acid (ABA) induces the expression of a battery of genes in mediating plant responses to environmental stresses. Here we report one of the early ABA-inducible genes in barley (Hordeum vulgare L.), HVA22, which shares little homology with other ABA-responsive genes such as LEA (late embryogenesis-abundant) and RAB (responsive to ABA) genes. In grains, the expression of HVA22 gene appears to be correlated with the dormancy status. The level of HVA22 mRNA increases during grain development, and declines to an undetectable level within 12 h after imbibition of non-dormant grains. In contrast, the HVA22 mRNA level remains high in dormant grains even after five days of imbibition. Treatment of dormant grains with gibberellin (GA) effectively breaks dormancy with a concomitant decline of the level of HVA22 mRNA. The expression of HVA22 appears to be tissue-specific with the level of its mRNA readily detectable in aleurone layers and embryos, yet undetectable in the starchy endosperm. The expression of HVA22 in vegetative tissues can be induced by ABA and environmental stresses, such as cold and drought. Apparent homologues of this barley gene are found in phylogenetically divergent eukaryotic organisms, including cereals, Arabidopsis, Caenorhabditis elegans, man, mouse and yeast, but not in any prokaryotes. Interestingly, similar to barley HVA22, the yeast homologue is also stress-inducible. These observations suggest that the HVA22 and its homologues encode a highly conserved stress-inducible protein which may play an important role in protecting cells from damage under stress conditions in many eukaryotic organisms.

Abscisic Acid↗

Identification of a cis-acting positive regulatory element of the glial fibrillary acidic protein gene.

Developmental regulation of astrocyte-specific expression of the glial fibrillary acidic protein (GFAP) gene reflects transition of immature glioblasts to mature astrocytes. Described here is the cloning and sequencing of the 5'-flanking region of the mouse GFAP gene. It contains a glial-specific positive cis-acting regulatory element that directs preferential expression of a linked reporter gene when transfected into GFAP-positive glioblastoma cells. Sequence analysis of this region revealed the presence of a putative AP-1 binding site, implying a possible role for AP-1 factors in the astroglial-specific expression of the GFAP gene.

Astrocytes↗

Cat-2 gene expression. Developmental control of translatable CAT-2 mRNA levels in maize scutellum.

Poly(A)+ RNA was isolated from maize scutella of different stages of post-germinative development and translated in vitro in a rabbit reticulocyte translation system. Immunoprecipitation of the translation products with CAT-2-specific antibody was used to quantitate the relative levels of translatable CAT-2 mRNA at each stage. The results show a close correlation between the developmental profile of Cat2 gene expression and the profile of CAT-2 mRNA levels. Evidence that the levels of CAT-2 mRNA are regulated by a temporal regulatory gene (Car1) is presented and the possible mechanism(s) of this regulation discussed.

Animals↗

Schistosoma mansoni p48 eggshell protein gene: characterization, developmentally regulated expression and comparison to the p14 eggshell protein gene.

Egg production by worm pairs is a major cause of pathogenesis in schistosomiasis. To further the understanding of female reproductive development, we have isolated and characterized a complete copy of an eggshell protein precursor gene, p48. Sequence analysis reveals that the gene has 3 open reading frames and does not contain an intron. One of the open reading frames, ORF1, encodes a polypeptide of 50 kDa which shows strong homology to insect chorion proteins. Determination of the position of the mRNA cap-site facilitated identification of putative regulatory elements in the 5' upstream region of the gene. Some of these elements (e.g., TCACGT) have been shown to play a role in the regulation of chorion gene expression in insects. p48 mRNA is detectable only in mature female worms and the ability to detect the mRNA coincides temporally with worm pairing. Quantitative comparisons, during female reproductive development, of p48 transcripts to those from another eggshell protein precursor gene, p14, show that the p48 mRNA is significantly less abundant than p14 mRNA. In mature female worms, p48 mRNA can only be detected in vitelline cells. Antibodies made against the polypeptide sequence deduced from ORF1 of the p48 gene recognize a 50-kDa molecule in extracts from mature female worms, but not in extracts from immature females or males.

Amino Acid Sequence↗

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗

Novel insights into the aetiology and pathogenesis of hypopituitarism.

Recent advances in our knowledge of pituitary development, acquired mainly from animal models, have enhanced our understanding of the aetiology of isolated growth hormone deficiency (IGHD) and combined pituitary hormone deficiency (CPHD), as well as several syndromic forms of growth hormone deficiency (GHD). A number of developmental genes known to be important for organ commitment and cell differentiation and proliferation (HESX1, LHX3, LHX4, PROP1 and PIT1) have been implicated in CPHD with or without other syndromic features. Phenotypes associated with these genetic mutations and their inheritance may be highly variable. Functional analyses of these mutations reveal valuable insights into the function of the proteins and hence into the effect of these mutations on phenotype. Novel insights have been gained into the mechanisms whereby these genes are associated with particular phenotypes as a result of murine transgenesis, e.g. type II autosomal dominant GHD. Mutations within known genes account for a small proportion of cases of IGHD and CPHD, suggesting the role of other as yet unidentified genetic and environmental factors. Hence, genetic testing will in the future have a greater role to play in understanding the mechanisms leading to particular hypopituitary phenotypes and also in predicting the evolution of these disorders. There is, however, no substitute for careful delineation of the phenotype prior to undertaking genetic studies.

Animals↗

RNAi-induced targeted silencing of developmental control genes during chicken embryogenesis.

The RNA interference technique is a powerful tool to understand gene function. Intriguingly, RNA interference cannot only be used for cells in vitro, but also in living organisms. Here, we have adapted the method for use in the chick embryo. However, this technique is limited by the uncertainty in predicting the RNAi transfection efficiency and site in the embryo. Hence, we elaborated a modified vector system, pEGFP-shRNA, which can coexpress enhanced green fluorescent protein (EGFP) and short hairpin RNA (shRNA) simultaneously to facilitate analysis of gene silencing in chicken embryos. We tested the silencing of two highly conserved genes (cAxin2, cParaxis), which play crucial roles in chicken embryonic developmental processes. For each target gene, four to five small DNA inserts, each of them encoding one shRNA, were selected and cloned individually to the vector downstream of the Pol III promoter (either human H1 or U6 promoter), which shared with highly conserved motifs in human and chicken. The pEGFP-shRNA constructs were electroporated into the neural tube or somites. After subsequent re-incubation of 24 h, the EGFP expression, with green fluorescent signal, indicated the transfected regions in the neural tube or somites. The EGFP expressing embryos were further submitted into the process of in situ hybridization for examination of the silencing effects. The results show that the EGFP signal in transfected areas correlated with the silencing of the target genes (cAxin2, cParaxis). The cAxin2 expression was inhibited by shRNAs of either targeting the RGS domain or the DAX domain coding region. The cParaxis mRNA level in transgenic somites and the related migratory myogenic population was also reduced. The results suggest that our novel dual expression EGFP-shRNA system opens a new possibility to study gene function in a convenient and efficient way.

Animals↗

Developmental mucin gene expression in the human respiratory tract.

The epithelial surface of the respiratory tract is coated with a protective film of mucus secreted by epithelial goblet and submucosal gland cells. Histology of the airway mucosa and composition of secretions during the second trimester of fetal life are known to differ from the normal adult in that these secretions show similarities with those of hypersecretory disorders. To provide information regarding cell-specific expression of mucin genes and their relation to developmental patterns of epithelial cytodifferentiation, we studied the expression of eight different mucin genes (MUC1-MUC4, MUC5AC, MUC5B, MUC6, MUC7) in human embryonic and fetal respiratory tract using in situ hybridization. These investigations demonstrated that MUC4 is the earliest gene expressed in the foregut at 6.5 wk, followed by MUC1 and MUC2 from 9. 5 wk of gestation in trachea, bronchi, epithelial tubules, and terminal sacs before epithelial cytodifferentiation. In contrast, MUC5AC, MUC5B, and MUC7 are expressed at later gestational ages concomitant with epithelial cytodifferentiation. During this developmental stage, MUC1 and MUC4 mRNAs are located in goblet and ciliated cells, whereas MUC2 mRNAs are located in basal and goblet cells. MUC5AC expression is confined to goblet cells. In the submucosal glands, MUC2 mRNAs are located in both mucous and serous cells, whereas MUC5B and MUC7 mRNAs are expressed in mucous and in serous cells, respectively. These data suggest distinct developmental roles for MUC1, MUC2, MUC4, MUC5AC, MUC5B, and MUC7 in the elongation, branching, and epithelial cytodifferentiation of the respiratory tract during ontogenesis. Distinct patterns of mucin gene expression are also likely to play an important role in regulating appropriate epithelial cell proliferation and cytodifferentiation in adult airway mucosa as it is indicated by aberrant expression in hypersecretory disorders.

Adult↗

A rational nomenclature for vertebrate homeobox (HOX) genes.

Developmental fates along the anterior-posterior axes of animals are controlled by clustered homeotic genes which in vertebrates are called Hox genes. The gene clusters are similar and probably functionally homologous in animals as different as nematodes, flies, and mammals. A new set of names for Hox genes was recently agreed upon by many workers in the field. Remarkably, the order of the Hox genes along the chromosome reflects where they are expressed along the body axis. This simple principle is reflected in the new nomenclature system.

Animals↗

Assignment of the developmentally regulated gene NEDD1 to human chromosome 12q22 by fluorescence in situ hybridization.

The developmentally regulated mouse gene Nedd 1 encodes a protein showing similarities with the beta-subunit of heterotrimeric GTP-binding proteins and has growth suppressing activity when overexpressed in various cultured cell types. We have mapped the human homolog (NEDD1) of the mouse gene to chromosome 12q22 by fluorescence in situ hybridization using R-banded human (pro)metaphase chromosomes.

Animals↗

Cell type-specific negative regulatory element in low-affinity nerve growth factor receptor gene.

Developmental changes in the expression pattern of the low-affinity nerve growth factor receptor (LNGFR) gene suggest a complex mechanism of gene regulation. We demonstrate the presence of a negative regulatory element (NRE) localized to a 40 base pair (bp) segment, -1731 to -1690 bp upstream from the translation start site in the LNGFR gene. The NRE possesses two tandemly arranged sequences with similarity to immunoglobulin gene enhancer E-boxes. The NRE is active in neurons and neuronal cell lines but not in astrocytes. Electrophoretic mobility shift analysis (EMSA) demonstrates changing expression pattern of proteins binding to the NRE in developing nervous system. Since the specific binding of the proteins to the NRE is competed with oligonucleotides containing E-box sequences we suggest that factor(s) responsible for down regulation of LNGFR gene include members of the helix-loop-helix class of transcription factors.

Animals↗

Developmental mucin gene expression in the gastroduodenal tract and accessory digestive glands. I. Stomach. A relationship to gastric carcinoma.

Studies were undertaken to provide information regarding cell-specific expression of mucin genes in stomach and their relation to developmental and neoplastic patterns of epithelial cytodifferentiation. In situ hybridization was used to study mRNA expression of eight mucin genes (MUC1-4, MUC5AC, MUC5B, MUC6, MUC7) in stomach of 13 human embryos and fetuses (8-27 weeks' gestation), comparing these with normal, metaplastic, and neoplastic adult tissues. These investigations have demonstrated that MUC1, MUC4, MUC5AC, MUC5B, and MUC6 are already expressed in the embryonic stomach at 8 weeks of gestation. MUC3 mRNA expression can be observed from 10.5 weeks of gestation. MUC2 is expressed at later stages, concomitant with mucous gland cytodifferentiation. Normal adult stomach is characterized by strong expression of MUC1, MUC5AC, and MUC6, less prominent MUC2, and sporadic MUC3 and MUC4, without MUC5B and MUC7. Intestinal metaplasia is characterized by an intestinal-type pattern with MUC2 and MUC3 mRNA expression. Gastric carcinomas exhibit altered mucin gene expression patterns with disappearance of MUC5AC and MUC6 mRNAs in some tumor glands, abnormal expression of MUC2, and reappearance of MUC5B mRNAs. In conclusion, we have observed that patterns of mucin gene expression in embryonic and fetal stomach could show similarities with some gastric carcinomas in adults. Differences in mucin gene expression in developmental, metaplastic, and neoplastic stomach compared to normal adult stomach suggest a possible regulatory role for their products in gastric epithelial cell proliferation and differentiation.

Adenocarcinoma↗

Membrane mu poly(A) signal and 3' flanking sequences function as a transcription terminator for immunoglobulin-encoding genes.

Developmentally regulated mechanisms involving alternative RNA splicing and/or polyadenylation, as well as transcription termination, are implicated in controlling the levels of secreted mu (mu s), membrane mu (mu m) and delta immunoglobulin (Ig) heavy chain mRNAs during B cell differentiation (mu gene encodes the mu heavy chain). Using expression vectors constructed with genomic DNA segments composed of the mu m polyadenylation signal region, we analyzed poly(A) site utilization and termination of transcription in stably transfected myeloma cells and in murine fibroblast L cells. We found that the gene segment containing the mu m poly(A) signals, along with 536 bp of downstream flanking sequence, acted as a transcription terminator in both myeloma cells and L cell fibroblasts. Neither a 141-bp DNA fragment (which directed efficient polyadenylation at the mu m site), nor the 536-bp flanking nucleotide sequence alone, were sufficient to obtain a similar regulation. This shows that the mu m poly(A) region plays a central role in controlling developmentally regulated transcription termination by blocking downstream delta gene expression. Because this gene segment exhibited the same RNA processing and termination activities in fibroblasts, it appears that these processes are not tissue-specific.

Alternative Splicing↗