Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Alum Compounds”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 289 records · Page 16Linked to original sources
PubMed2002

Remarkably high antibody levels and protection against P. falciparum malaria in Aotus monkeys after a single immunisation of SPf66 encapsulated in PLGA microspheres.

Single dose immunisation is a major goal in vaccine design. The purpose of this study was the development of a single dose delivery system for the SPf66 malaria vaccine, based on this antigen's microencapsulation in PLGA microspheres by double emulsion method. Results indicate that a single immunisation in mice and monkeys with the SPf66 malaria vaccine, encapsulated in a mixture of two formulations of PLGA microspheres, induced a remarkably high and long-lasting immune response as assessed by ELISA and Western Blott. This immune response was associated with a good protective capacity in Aotus monkeys, after experimental challenge, indicating that antigen integrity lasted following the microencapsulation process. PLGA biodegradable microspheres thus serve as an effective delivery system for the design of a single dose immunisation vaccine, such as the SPf66 synthetic malaria vaccine.

Alum Compounds↗
PubMed2002

CpG-containing oligodeoxynucleotides augment and switch the immune responses of cattle to bovine herpesvirus-1 glycoprotein D.

The adjuvanticity of a synthetic oligodeoxynucleotide containing unmethylated CpG motifs (CpG ODN) was determined in cattle. Calves were immunized with a truncated secreted version of glycoprotein D (tgD) of bovine herpes virus-1 (BHV-1) formulated with alum, CpG ODN, or a combination of both. BHV-1 tgD formulated with CpG ODN or with alum and CpG ODN induced a stronger and more balanced immune response than tgD in alum. This level of immunity was of sufficient magnitude to minimize weight loss and significantly reduce the duration of virus shedding after intranasal viral challenge. Local tissue reactions generated by CpG ODN were very mild and transient, whereas reactions induced by alum or a combination of CpG ODN and alum were moderate in severity and duration. These data demonstrate that CpG ODN causes minimal injection site reactions and yet acts as an effective adjuvant in cattle.

Adjuvants, Immunologic↗
PubMed2003

Development of short non-CpG phosphodiester oligonucleotides as immune stimulatory agents.

We have previously reported that DNA isolated from Mycobacterium phlei (M. phlei) stimulates the synthesis of cytokines by monocytes and macrophages independently of the presence of unmethylated CpG motifs. Oligonucleotides as small as five to six bases isolated from M. phlei DNA have been found to induce cytokine synthesis. In the present study, we have investigated the potential for such CpG-lacking DNA to act as an immune stimulant. A series of six base length phosphodiester oligonucleotides derived from the genome of M. phlei were synthesised and tested for their ability to induce the synthesis of cytokines by murine, non-human primate (rhesus macaques and chimpanzee) and human peripheral blood mononuclear cells. The results show that phosphodiester oligonucleotides with a 5'GGGxGG3' sequence where x is A, C, G or T have the ability to induce the synthesis of IL-1beta, IL-6, IL10 or IL-12 by non-human primate and human PBMC, murine cells being unresponsive. The phosphodiester 5'GGGxGG3' oligonucleotides were shown to be stable in human serum, with a half-life of approximately 72 h. The addition of aluminium hydroxide to these 5'GGGxGG3' oligonucleotides potentiated, in a concentration-dependent manner, the synthesis of IL-12 by human peripheral blood mononuclear cells. These phosphodiester six base length non-CpG motif oligonucleotides may have potential as immunopotentiators for vaccines.

Adjuvants, Immunologic↗
PubMed2003

CpG ODN 2006 and IL-12 are comparable for priming Th1 lymphocyte and IgG responses in cattle immunized with a rickettsial outer membrane protein in alum.

Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-gamma production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-gamma-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-gamma transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-gamma mediated cellular immune responses in cattle.

Adjuvants, Immunologic↗
PubMed2003

Mycobacterium tuberculosis arabinomannan-protein conjugates protect against tuberculosis.

Lipoarabinomannan (LAM) is a major structural surface component of mycobacteria. Arabinomannan (AM) oligosaccharides derived from LAM of Mycobacterium tuberculosis H37Rv were isolated and covalently conjugated to tetanus toxoid (TT) or to short-term culture filtrate proteins (antigen 85B (Ag85B) or a 75kDa protein) from M. tuberculosis strain Harlingen. The different AM oligosaccharide (AMOs)-protein conjugate vaccine candidates proved to be highly immunogenic, inducing boosterable IgG responses against the AMOs portion of the conjugates in rabbits and guinea-pigs. Proliferation of T-cells from C57BL/6 mice immunized with the conjugates was seen upon in vitro stimulation with PPD. In C57BL/6 mice subcutaneous immunization with the AMOs-antigen 85B conjugate in alum provided significant protection compared to sham (alum only) immunized mice (P < 0.021) as estimated by long term survival against intravenous challenge with 10(5) M. tuberculosis H37Rv. Subcutaneous immunization followed by nasal boost with an AMOs-TT conjugate in Eurocine L3 adjuvant provided high (P < 0.025) protection as determined by long term survival after intranasal challenge with 10(5) virulent M. tuberculosis strain Harlingen. This level of protection was comparable to that obtained with the conventional live attenuated BCG vaccine. In guinea-pigs, immunization with AMOs-Ag85B in Eurocine L3 adjuvant followed by aerogenic challenge with M. tuberculosis H37Rv resulted in increased survival and reduced pathology in lungs and spleens relative to non-immunized animals.

Adjuvants, Immunologic↗
PubMed2003

Fractionation, structural studies, and immunological characterization of the semi-synthetic Quillaja saponins derivative GPI-0100.

Unfractionated GPI-0100 (UFGPI-0100) containing semi-synthetic derivatives of deacylated Quillaja saponins (DS saponins) modified at the glucuronic acid residue was resolved by reverse phase low-pressure liquid chromatography (RP-LPLC) into two fractions, RP18-1 and RP18-2, with different compositions and adjuvanticity. The fraction RP18-1 contained DS saponin adducts of N-dicyclohexylurea, and stimulated Th2 immunity with production of IgG1, while the RP18-2 fraction contained the dodecylamide derivatives of DS saponins and stimulated Th1 immunity with production of IgG2a, IFN-gamma, IL-2, and CTL. The strong immune stimulatory properties of RP18-2, relative to RP18-1, and the formation of RP18-1/RP18-2 mixed micelles may account for the effective stimulation of Th1 immunity by UFGPI-0100. UFGPI-0100 was free of acylated quillaja saponin components, including the more stable QS-7.

Adjuvants, Immunologic↗
PubMed2003

Safety and efficacy of CpG-containing oligodeoxynucleotides as immunological adjuvants in rabbits.

The efficacy of oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) as an adjuvant for rabbits was assessed alone and in combination with aluminum hydroxide (CpG/alum). The CpG/alum combination elicited a greater immune response to several antigens compared to Freund's adjuvant. A non-CpG/alum combination did not have the same effects as CpG/alum suggesting that the adjuvanticity was related to the CpG motifs. In addition, we formulated one of the antigens with combinations of CpG ODN and 30 or 10% Emulsigen (Em) [CpG/Em (30%) and CpG/Em (10%)]. Both CpG/Em (30%) and CpG/Em (10%) were more effective than Em, and equivalent to CpG/alum. The CpG/Em (10%) combination caused minimal tissue damage. Our results demonstrate that the addition of CpG ODN to aluminum hydroxide or to 10% Em significantly improves the efficiency of these adjuvants, without enhancing tissue reaction.

Adjuvants, Immunologic↗
PubMed1996

Single dose, polymeric, microparticle-based vaccines: the influence of formulation conditions on the magnitude and duration of the immune response to a protein antigen.

Ovalbumin-loaded poly (D,L-lactide co-glycolide) [OVA-loaded PLG] microparticles, produced by emulsion/solvent evaporation stimulated the production of high serum IgG antibody levels after a single subcutaneous (s.c.) administration in mice and the duration of the immune response paralleled the degradation rate of the carrier. Formulations based on slow resorbing PLG maintained relatively constant peak antibody levels for 26 weeks and high titres for over 1 year at a level approximating the peak response to the faster resorbing, OVA-loaded particles which was of lower duration. Vaccine formulations prepared by simple mixing of blank PLG microparticles and OVA exhibited low primary immune responses which were only elevated by boosting. OVA-loaded PLG microparticles exhibited a substantial surface protein component amounting to ca 40% and 60% of the total protein loading for slow resorbing and fast resorbing PLG, respectively. These findings suggest that sustained presentation of surface protein to the immune system was a major factor in the induction and long-term maintenance of high antibody titres following a single s.c. administration of OVA-loaded microparticles.

Alum Compounds↗
PubMed1997

The effect of age and weight on the response to formalin inactivated, alum-adjuvanted hepatitis A vaccine in healthy adults.

Formalin-inactivated, alum-adsorbed, hepatitis A vaccine was evaluated in 100 healthy adults who were stratified at enrollment into two age groups: 18-39 years: n = 50; 40-65 years: n = 50. All individuals received vaccine at 25 U of viral antigen. After stratification, both groups were randomized to receive either vaccination at 0 and 24 weeks or vaccination at 0.2 and 24 weeks. Subjects were bled for serology at 0, 2, 4, 24, 28 weeks and 1 year. The seroconversion rate and geometric mean titer (GMT = mIU ml-1) after one dose of vaccine was lower for older subjects [second week: < 40 years: 15/25 (60%) (GMT: 12.9). > 40 years: 5/22 (23%) (GMT: 6.1): fourth week: < 40 years: 20/22 (91%) (GMT: 29.0), > 40 years: 16/23 (70%) (GMT: 14.3)]. After a second dose at 2 weeks the seroresponse improved so that there were no longer differences between age groups [24 weeks: < 40: 21/22 (95%) (GMT: 123.9), > 40: 22/23 (96%) (GMT: 106.1)]. A third dose at 24 weeks resulted in a 20-40-fold increase in GMT in both age groups. As a separate evaluation height, weight, skin fold thickness, and body mass index (BMI) were assessed by logistic regression for their ability to predict serologic response. Serologic response was significantly associated with lower weight (P = 0.032) and BMI (P = 0.024) but not with height or skin fold thickness. Hepatitis A vaccine was well tolerated, with no serious adverse experiences. Adults older than 40 years appear to respond less well than younger adults to a single dose of 25 U of hepatitis A vaccine but equally well after two doses of vaccine. The slower antibody response to hepatitis A vaccine in overweight individuals was not attributable to skin adipose tissue.

Adolescent↗
PubMed1997

Adjuvants influence the quantitative and qualitative immune response in BALB/c mice immunized with respiratory syncytial virus FG subunit vaccine.

The ability of monophosphoryl lipid A (MPL), QS-21 and alum to alter the immunologic response to immunization with respiratory syncytial virus a chimeric FG construct (FG) subunit vaccine was examined in BALB/c mice. FG/MPL, FG/alum, and FG/MPL/QS-21 combinations increased non-neutralizing antibody response, while FG/QS-21 did not. FG subunit vaccine with MPL, QS-21, or both had cytokine responses more closely resembling primary infection than FG/alum, with decreased interleukin-4 mRNA levels and increased IgG2a isotype antibody. The lungs of the mice immunized with FG subunit vaccines showed a heightened inflammatory response to respiratory syncytial virus challenge as compared to live virus immunization. Adjuvants can be used to alter the humoral and cellular responses to RSV subunit immunization.

Adjuvants, Immunologic↗
PubMed1998

Plasmodium falciparum polyoximes: highly immunogenic synthetic vaccines constructed by chemoselective ligation of repeat B-cell epitopes and a universal T-cell epitope of CS protein.

Effective immunoprophylaxis directed against the pre-erythrocytic stages of the malaria parasite requires a vaccine that can elicit humoral and cell mediated immunity in individuals of diverse genetic background. In order for a synthetic peptide malaria vaccine to meet these requirements, problems associated with genetic restriction, peptide chemistry, adjuvant formulation and physiochemical characterization of the final synthetic vaccine product must first be overcome. To address these issues, five polyoxime vaccine candidates have been constructed by ligating purified peptide epitopes of the P. falciparum CS protein to a branched template via oxime bonds. All five constructs, including two based on templates containing the synthetic adjuvant tripalmitoyl-S-glyceryl cysteine (Pam3Cys), were of sufficient purity for characterization by mass spectrometry. The immunogenicity of the malaria polyoximes in different murine strains was compared to that of multiple antigen peptide (MAP) constructs synthesized by standard step-wise synthesis. A tri-epitope polyoxime-Pam3Cys construct, based on the repeats and a universal T-cell epitope that contains both helper and CTL epitopes of the CS protein, was shown to be a precisely-defined synthetic malaria vaccine candidate that was highly immunogenic in murine strains of diverse H-2 haplotypes.

Adjuvants, Immunologic↗
PubMed1998

Immunization with E. coli produced recombinant T. gondii SAG1 with alum as adjuvant protect mice against lethal infection with Toxoplasma gondii.

Polyclonal rabbit antibodies against recombinant Toxoplasma gondii SAG1 antigen expressed in E.coli recognize T. gondii and the antibodies significantly reduced T.gondii adherence and/or invasion into the host cell as did a monoclonal antibody against a conformational epitope of the SAG1 antigen. Groups of outbread NMRI mice were immunized with recombinant T. gondii SAG1 antigen in alum. The antibody response to immunizations was dominated by a Th2 response with production of T.gondii specific IgG1 antibodies. Challenge with tachyzoites from the virulent RH-strain produced a Th1 response dominated by the production of specific IgG2a antibodies and moderately boosted the IgG1 response, and challenge with bradyzoites from the avirulent SSI119-strain showed the same pattern. Immunization with rSAG1 resulted in a significant increased survival after challenge with tachyzoites of the RH-strain. Immunization with E.coli expressed recombinant SAG1 in alum induce partial protective immunity against lethal infection with T. gondii in mice.

Adjuvants, Immunologic↗
PubMed1999

Multivalent group A streptococcal vaccine designed to optimize the immunogenicity of six tandem M protein fragments.

One of the major challenges in the development of group A streptococcal M protein-based vaccines is the multiplicity of M types expressed by these organisms. Previous studies have shown that multivalent vaccines containing as many as eight M protein fragments in tandem were immunogenic and evoked opsonic antibodies. It was also noted that the C-terminal fragments of these hybrid proteins were often not immunogenic or evoked only low levels of opsonic antibodies, suggesting that the C-terminus of the molecule may have been preferentially degraded or altered in vivo. In the present studies, we designed a hexavalent vaccine containing protective M protein peptides from types 24, 5, 6, 19, 1, and 3 group A streptococci. In order to "protect" the carboxy-terminal components, the amino-terminal M24 fragment was reiterated on the carboxy-terminal end of the construct. The hexavalent vaccine was immunogenic in laboratory animals and evoked high titers of antibodies against each of the native M proteins represented in the vaccine and bactericidal antibodies against all six sterotypes of group A streptococci. The vaccine was equally immunogenic when delivered in alum or in complete Freund's adjuvant. None of the immune sera contained antibodies that crossreacted with human heart tissue. Our results show that complex multivalent group A streptococcal vaccines can be designed in such a way that each M protein fragment is immunogenic and evokes protective antibodies.

Alum Compounds↗
PubMed1999

Induction of a protective immunity against Schistosoma mansoni with ovalbumin-coupled Sm37-5 coadsorbed with granulocyte-macrophage colony stimulating factor (GM-CSF) or IL-12 on alum.

A previous study has shown that Sm37-5 is a major B cell epitope of Sm37-GAPDH. This epitope is highly antigenic in human infections and IgG antibody reactivity toward this determinant is associated with adolescent resistance to reinfection. This led us to test a synthetic peptide corresponding to Sm37-5, coupled to ovalbumin, as an anti-schistosome vaccine. Although mice injected with Sm37-5-OVA in Freund's adjuvant showed significant protection, immunization in aluminium hydroxide failed to induce protection. The adjuvant effect of cytokines (GM-CSF or IL-12) associated with the antigen on alum was investigated. With each of these two cytokines, significant reductions in the worm burden were obtained (32-38% with GM-CSF and 27% with IL-12, respectively). In addition, a reduction of the egg number trapped in the liver of immunized mice was also observed. Thus, protections were obtained with formulations that could potentially be used in humans.

Adjuvants, Immunologic↗
PubMed1999

Immunogenicity of IRIV- versus alum-adjuvanted diphtheria and tetanus toxoid vaccines in influenza primed mice.

The immunogenicity and protectivity of two different toxoid vaccines were compared in mice. In one formulation, toxoids (diphtheria or tetanus) were adsorbed to alumoxid, whereas in the other formulation the toxoids were crosslinked to immunopotentiating reconstituted influenza virosomes (IRIVs). A preimmunization with influenza antigens is necessary for a good anti-toxoid antibody response when the IRIV formulation was administered. After two immunizations with the IRIV- or alum-based vaccines, the IRIV-based formulation induced a higher humoral immune response than toxoids adsorbed to alum. Using an in vitro test, diphtheria toxin neutralizing antibodies were tested. Di-IRIV induced a significantly (p = 0.002) higher titer of diphtheria toxin neutralizing antibodies than Di-alum. Tetanus challenge experiments showed, that the IRIV-based tetanus vaccine induced a threefold higher titer of protective antibodies than the tetanus toxoid adsorbed to alum. Therefore, the IRIV-based formulations appeared to be superior to the alum-based vaccines in terms of immunogenicity and protectivity.

Adjuvants, Immunologic↗
PubMed1999

Analysis of the ability of five adjuvants to enhance immune responses to a chimeric plant virus displaying an HIV-1 peptide.

The ability of five different adjuvants (alum, complete Freund's adjuvant, Quil A, AdjuPrime and Ribi) to stimulate humoral and T-cell mediated immune responses against a purified chimeric virus particle was investigated. Each adjuvant was administered subcutaneously to adult mice together with 10 microg of wildtype (wt) cowpea mosaic virus (CPMV) or a chimeric CPMV displaying the HIV-1 gp41 peptide, residues 731-752. All preparations elicited strong antibody responses to CPMV, but Quil A elicited the highest and most consistent responses to the HIV-1 peptide. This finding was reflected in both ELISA titres with immobilized peptide and in HIV-1-neutralizing antibody. In addition Quil A was also, the only adjuvant to stimulate an in vitro proliferative T-cell response. Surprisingly with all adjuvant formulations a predominately IgG2a anti-gp41 peptide response was observed, indicating a type 1 T-helper cell-like response. Furthermore, the efficiency of the CPMV display system was demonstrated by its ability to induce good levels of peptide specific antibody in the absence of any adjuvant.

Adjuvants, Immunologic↗
PubMed1999

Influence of antigenic forms and adjuvants on the IgG subclass antibody response to Aujeszky's disease virus in mice.

The influence of antigenic forms of Aujeszky's disease virus (ADV) and adjuvant types on the production of IgG subclass antibodies in mice was investigated. Particulate antigen, inactivated ADV, alone induced IgG1 and lower IgG2a antibody production, while the antigen adsorbed onto aluminum phosphate gel (alum) enhanced IgG1 antibody production but suppressed IgG2a antibody production as well as solubilized ADV antigen adsorbed onto alum. QS21 saponin purified from Quillaja saponaria promoted the production of IgG1 and IgG2a antibodies in a large extent against the both particulate and soluble antigens, while this saponin has strong hemolytic activity. Lablaboside F saponin isolated from Dolichos lablab without hemolytic activity, also induced the production of large IgG1 and little IgG2a antibody against both antigens. Oil-based adjuvant, ISA70 of water-in-oil type and ISA25 of oil-in-water type, increased IgG1 and IgG2a antibodies against the both soluble and particulate antigens, whereas a combination of ISA25 and soluble antigen reduced IgG2a antibody response. These results indicate that IgG1 antibody production was not suppressed by a combination of antigenic form and adjuvant type, however, IgG2a antibody production was influenced.

Adjuvants, Immunologic↗
PubMed1999

Immunization of rhesus monkeys with a mucosal prime, parenteral boost strategy protects against infection with Helicobacter pylori.

Rhesus monkeys were immunized with recombinant Helicobacter pylori urease vaccine given solely by the parenteral route or preceded by a priming dose given by the oral route. Two groups of monkeys received parenteral urease with either a synthetic glycolipid adjuvant (Bay) or aluminum hydroxide (alum) as adjuvants. A third group of monkeys received a priming dose of oral urease given with the mucosal adjuvant LT (Escherichia coli heat labile enterotoxin), followed by parenterally administered booster doses of urease adsorbed to alum. Monkeys receiving placebo served as controls. The monkeys received a total of 4 doses of vaccine with the first 3 doses given every 3 weeks and the last booster dose administered 14 weeks later. The monkeys were challenged orally with H. pylori one week after the last vaccine dose and euthanized 10 weeks after challenge, at which time, their stomachs were collected for determination of bacterial colonization and histopathology. Monkeys primed with the oral vaccine and boosted with the parenteral vaccine showed a statistically significant reduction in bacterial colonization when compared to sham-immunized control animals (P = 0.05; Wilcoxon rank sums test). Monkeys receiving parenteral only regimes of urease plus Bay or alum showed no difference in bacterial colonization compared with sham-immunized controls (P = 1.00 and P = 0.33, respectively). The mucosal prime-parenteral boost regime did not cause gastropathy. There was no difference in any of the 3 treatment groups with respect to gastric epithelial changes compared to control animals. There was also no difference in the type and extent of gastric inflammatory cell infiltrates between animals vaccinated by the mucosal prime-parenteral boost strategy and sham immunized controls. However, monkeys receiving the two parenteral-only regimens had slightly elevated gastritis scores.

Adjuvants, Immunologic↗