Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “subgrouping”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 271 records · Page 15Linked to original sources
PubMed1995

Irritable bowel syndrome in a community: symptom subgroups, risk factors, and health care utilization.

The clinical relevance of subdividing the irritable bowel syndrome (IBS) into subgroups based on bowel habit is largely unknown. We therefore obtained an age- and sex-stratified random sample of Olmsted County, Minnesota, residents aged 20-95 years. All subjects were mailed a valid self-report questionnaire during the years 1988-1993; the response rate was 74% (n = 3,022). Among subjects with IBS (n = 536), four symptom-based subgroups of similar size were identified: constipation predominant, diarrhea predominant, alternating constipation and diarrhea, and neither. The prevalence of IBS was significantly greater in females, primarily because of a higher prevalence of constipation-predominant IBS in women. Of persons > or = 60 years of age, 23% reported the initial onset of IBS in the previous year compared with 10% in younger subjects; the age at onset of IBS was similar among the subgroups. Marital status, education level, smoking, and alcohol use were not significantly different among the subgroups. Of those with IBS, 25% reported visiting a physician for abdominal pain or disturbed defecation in the prior year compared with only 8% of persons without IBS. Female sex, an increased number of Manning's symptom criteria, and the individual IBS subgroups were not associated with higher rates of physician visits. We conclude that the onset of IBS may not be limited to early adulthood and that subgroups of IBS based on bowel patterns may not identify clinically distinct entities.

Adult↗
PubMed2005

Manual therapy in osteoarthritis of the hip: outcome in subgroups of patients.

OBJECTIVE: To investigate whether manual therapy has particular benefit in subgroups of patients defined on the basis of hip function, range of joint motion, pain and radiological deterioration. METHODS: The study was performed in the out-patient clinic of physical therapy of a large hospital. Data on 109 patients with OA of the hip (clinical ACR criteria) participating in a randomized clinical trial on the effects of manual therapy were used. The outcomes for hip function (Harris hip score), range of joint motion (ROM) and pain (VAS) were compared for specific subgroups. Subgroups were assigned by the median split method. The interaction effect between subgroup and treatment was tested using multiple regression analysis. RESULTS: No differences were observed in the effect of manual therapy in specific subgroups of patients defined on the basis of baseline levels of hip function, pain and ROM. On the basis of radiological grading of osteoarthritis (OA), we found that patients with severe radiological grading of OA had significantly worse outcome on ROM as a result of manual therapy than patients with mild or moderate radiological grading of OA. CONCLUSION: A significant interaction effect was found for only 1 out of 12 hypotheses investigated. Therefore, we conclude that there is no evidence for the particular benefit of manual therapy in subgroups of patients.

Aged↗
PubMed1985

Neuropsychological and computerized axial tomography volume characteristics of empirically derived dementia subgroups.

Neuropsychological assessment data from 138 Alzheimer's disease patients were cluster-analyzed to yield five separate subgroups. These clusters are best described as follows. Cluster I is a low-functioning subgroup characterized by severe generalized deficits (N = 25), cluster II is a subgroup characterized by a higher level of visual-spatial skills relative to the other groups (N = 39), cluster III (N = 21) and cluster IV (N = 42) are virtually indistinguishable in terms of verbal ability and memory, but do differ with regard to visual-spatial skills, and cluster V is a subgroup which presented with relatively better preserved verbal abilities (N = 11). Despite their different neuropsychological profiles, the subgroups did not differ significantly with regard to those complaints that were noted early in the course of the disease process. However, they were found to differ significantly with regard to the patients' educational backgrounds, the distribution of males and females, and the age of the patients at the time of onset of the disease. Analysis of the degree and lateralization of cortical atrophy using volumetric techniques suggested little relationship with neuropsychological examination results. Ventricular volume differences among the five subgroups were not found to be statistically significant after the effect of age had been partialled out. Results are discussed in relation to the multiple factors relating to brain structure and cognition in Alzheimer's disease.

Adult↗
PubMed2004

Bone-anchored hearing aid: comparison of benefit by patient subgroups.

OBJECTIVES/HYPOTHESIS: The osseointegrated bone-anchored hearing aid, using the Branemark system, is well established and has proven benefit. The aim was to study quality of life benefits within patient subgroups using the validated Glasgow Benefit Inventory (GBI). STUDY DESIGN: Retrospective questionnaire study. METHODS: Ninety-four consecutive patients were enrolled into the study. Mean patient age was 49 years, with a female-to-male ratio of 1.1:1. Patient subgroups were discharging mastoid cavities, chronic active otitis media, congenital ear problems, otosclerosis, and acoustic neuroma and other unilateral hearing losses. RESULTS: The response rate was 73%. The score for total benefit of bone-anchored hearing aid fitting for the entire group was +33.3 (95% confidence interval [CI], 25-42). Glasgow Benefit Inventory scores for each subgroup were all greater than +20. The congenital atresia group scored highest with +45 (95% CI, 28-61). Variation in benefit across the subgroups has been demonstrated. Fitting of BAHA following acoustic neuroma surgery was shown to be of benefit with a score of +22.2. General benefits scored highest in all subgroups compared with physical and social benefits. CONCLUSION: The study demonstrated the differences in benefit within patient subgroups. Its results can be used to give patients a predictive value at the time of preoperative counseling. The study identified congenital ear disorders as the group likely to obtain maximal benefit. Notably, for the first time, the study demonstrated the documented benefit of restoring stereo hearing to patients who have acquired unilateral hearing loss following acoustic neuroma surgery using a BAHA.

Bone Conduction↗
PubMed2006

Misuse of baseline comparison tests and subgroup analyses in surgical trials.

It is unclear whether the misuse of statistical tests that compare patients' baseline characteristics and subgroup analyses in randomized controlled trials can be extrapolated to the surgical literature. We did an observational study evaluating the current use of baseline comparability tests and subgroup analyses in surgical randomized controlled trials. Published surgical randomized controlled trials in four medical journals were identified. We also identified randomized controlled trials in the Journal of Bone and Joint Surgery (American and British volumes). We identified 72 randomized controlled trials, with a mean of 10 +/- 8 baseline variables. Of 166 significance tests, 17 (10%) were significant. Twenty-seven (38%) trials included 54 subgroup analyses with a minimum of one and maximum of 23 subgroup analyses per study. Inappropriate emphasis on subgroup analyses occurred frequently. Forty-nine (91%) analyses were performed post hoc without prior hypotheses. Investigators reported differences between subgroups in 31 (57%) of the analyses, all of which were featured in the summary or conclusion. These inferences may be misleading, making their application to clinical practice unwarranted.

Data Interpretation, Statistical↗
PubMedDate not supplied

Psychosocial treatment within sex by ethnicity subgroups in the Enhancing Recovery in Coronary Heart Disease clinical trial.

OBJECTIVE: Intervening in depression and/or low perceived social support within 28 days after myocardial infarction (MI) in the Enhancing Recovery in Coronary Heart Disease (ENRICHD) clinical trial did not increase event-free survival. The purpose of the present investigation was to conduct post hoc analyses on sex and ethnic minority subgroups to assess whether any treatment subgroup is at reduced or increased risk of greater morbidity/mortality. METHODS: The 2481 patients with MI (973 white men, 424 minority men, 674 white women, 410 minority women) who had major or minor depression and/or low perceived social support were randomly allocated to usual medical care or cognitive behavior therapy. Total mortality or recurrent nonfatal MI (ENRICHD primary endpoint) and cardiac mortality or recurrent nonfatal MI (secondary endpoint) were analyzed as composite endpoints by group for time to first event using Cox proportional hazards regression. RESULTS: There was a trend in the direction of treatment efficacy for white men for the primary endpoint (hazard ratio [HR], 0.80; 95% confidence interval, 0.61-1.05; p =.10) and a significant (p <.006, Bonferroni corrected) effect for the secondary endpoint (HR, 0.63; 95% CI, 0.46-0.87; p =.004). In contrast, the HRs for each of the other three subgroups were nonsignificant. The magnitude of differences in treatment effects between white men and the other subgroups remained significant for the secondary endpoint (p =.04) after adjustment for age, education, living alone, antidepressant use, comorbidity score, cardiac catheterization, ejection fraction, history of hypertension, and major depression. CONCLUSIONS: White men, but not other subgroups, may have benefited from the ENRICHD intervention, suggesting that future studies need to attend to issues of treatment design and delivery that may have prevented benefit among sex and ethnic subgroups other than white men.

Cognitive Behavioral Therapy↗
PubMed2006

Learning the structure of correlated synaptic subgroups using stable and competitive spike-timing-dependent plasticity.

Synaptic plasticity must be both competitive and stable if ongoing learning of the structure of neural inputs is to occur. In this paper, a wide class of spike-timing-dependent plasticity (STDP) models is identified that have both of these desirable properties in the case in which the input consists of subgroups of synapses that are correlated within the subgroup through the occurrence of simultaneous input spikes. The process of synaptic structure formation is studied, illustrating one particular class of these models. When the learning rate is small, multiple alternative synaptic structures are possible given the same inputs, with the outcome depending on the initial weight configuration. For large learning rates, the synaptic structure does not stabilize, resulting in neurons without consistent response properties. For learning rates in between, a unique and stable synaptic structure typically forms. When this synaptic structure exhibits a bimodal distribution, the neuron will respond selectively to one or more of the subgroups. The robustness with which this selectivity develops during learning is largely determined by the ratio of the subgroup correlation strength to the number of subgroups. The fraction of potentiated subgroups is primarily determined by the balance between potentiation and depression.

Action Potentials↗
PubMed1976

Restriction of human immune antibodies to heavy-chain variable subgroups.

Human immune antibodies such as anti-Rh and anti-Kell antibodies were tested in hemagglutination and hemagglutination inhibition experiments for VH subgroup composition. A striking VH subgroup restriction was found in several of these groups of antibodies. In the majority of cases there was a restriction to one particular VH subgroup for a single antibody specificity in a given individual. In some cases there was also an overall restriction to one particular subgroup for antibodies with the same antibody specificity. This was particularly pronounced for anti-D antibodies, which was primarily restricted to VHII, and for the anti-Kell, which was particularly related to VHIII. Subgroup-specific antigens for all the main VH subgroups were blocked on combination of the antibody molecule with antigen. No relation was found between VH restriction and restriction to IgG subclass, or genetic markers or chi and lambda light-chain type.

Antibodies↗
PubMed1993

Preferential rearrangements of the V gamma I subgroup of the gamma-chain of the T-cell antigen receptor to J gamma 2C gamma 2 gene segments in peripheral blood lymphocyte transcripts from normal donors.

To investigate whether there are preferential VJC gene rearrangements of the gamma-chain of the human T-cell antigen receptor (TCR), we amplified and sequenced gamma-chain TCR transcripts from peripheral blood lymphocytes from adult normal donors. cDNA was synthesized from total RNA and amplified by the polymerase chain reaction (PCR) using 5' primers specific for either the V gamma I or the V gamma II subgroups of the gamma-chain of the TCR. The amplified cDNAs were then cloned and sequenced. The majority (approximately 83%) of the cDNAs employing V-I subgroup gene segments rearranged to J gamma 2 (J gamma 2.1 or J gamma 2.3) C gamma 2 gene segments. This was in contrast to the predominant rearrangement of the V gamma II subgroup (V gamma 9) to J gamma 1.2C gamma 1. The remaining 13% of the cDNAs employing V gamma I subgroup gene segments rearranged to J gamma 1.1C gamma 1 or J gamma 1.3C gamma 1. There was significant N diversity as well as imprecise joining at the VJ junction. gamma delta TCR utilizing the C gamma 1 gene segment are disulfide-linked, whereas those utilizing the C gamma 2 gene segment are non-disulfide-linked. These results demonstrate that peripheral blood gamma-chain transcripts exhibit preferential rearrangements of V gamma I subgroup gene segments to J gamma 2(2.1,2.3)C gamma 2 gene segments. By contrast, V gamma II subgroup (V gamma 9) transcripts exhibit rearrangements to J gamma 1.2C gamma 1.

Amino Acid Sequence↗
PubMed2005

Design and validation of 16S rRNA probes to enumerate members of the Clostridium leptum subgroup in human faecal microbiota.

Among human faecal bacteria, many members of the Clostridium leptum subgroup are fibrolytic and butyrate producing microorganisms thereby contributing to processes important to colonic health. Yet this phylogenetic subgroup remains poorly described to date. To improve detection and description of members of the C. leptum subgroup, the Clep 866 group probe was developed. Its association with probes targeting the Clostridium viride cluster (Cvir 1414) and Eubacterium desmolans species (Edes 635) allowed for the first time the detection of all members found in this phylogenetic group in human faecal microbiota. A species-specific probe was also designed to detect members of the Ruminococcus callidus species (Rcal 733). The design of signature regions was based on alignment of 16S rRNA sequences isolated from faeces of five healthy adults. Furthermore, an oligonucleotide competitor strategy was developed in order to improve the specificity of the probes formerly validated or designed in this study. The oligonucleotide probes were tested using a collection of target and non-target strains using FISH combined with flow cytometry. These new probes were added to a panel of 18 phylogenetic probes selected to describe faecal microbiota composition in 21 human faeces of healthy adults. Clostridium leptum subgroup represented 22% of the total faecal bacteria and codominated with members of Clostridium coccoides group. The cluster Faecalibacterium prausnitzii was the dominant component of the C. leptum subgroup and 20% of the latter subgroup remained unidentified at the species level.

Adult↗
PubMed2005

Development of the PEARLS model (Particulate Exposure from Ambient to Regional Lung by Subgroup) and use of Monte Carlo simulation to predict internal exposure to 2.5 in Toronto.

Air pollution is a current and growing concern for Canadians, and there is evidence that ambient levels that meet current exposure standards may be associated with mortality and morbidity in Toronto, Canada. Evaluating exposure is an important step in understanding the relationship between particulate matter (PM) exposure and health outcomes. This report describes the PEARLS model (Particulate Exposure from Ambient to Regional Lung by Subgroup), which predicts exposure distributions for 11 age-gender population subgroups in Toronto to PM2.5 (PM with a median aerodynamic diameter of 2.5 microm or less) using Monte Carlo simulation techniques. The model uses physiological and activity pattern characteristics of each subgroup to determine region-specific lung exposure to PM2.5, which is defined as the mass of PM2.5 deposited per unit time to each of five lung regions (two extrathoracic, bronchial, bronchiolar, and alveolar). The modeling results predict that children, toddlers, and infants have the broadest distributions of exposure, and the greatest chance of experiencing extreme exposures in the alveolar region of the lung. Importance analysis indicates that the most influential model variables are air exchange rate into indoor environments, time spent outdoors, and time spent at high activity levels. Additionally, a "critical point" was defined and introduced to the PEARLS to investigate the effects of possible threshold-pathogenic phenomena on subgroup exposure patterns. The analysis indicates that the subgroups initially predicted to be most highly exposed were likely to have the highest proportion of their population exposed above the critical point. Substantial exposures above the critical point were predicted in all subgroups for ambient concentrations of PM2.5 commonly observed in Toronto after continuous exposure of 24 hours or more.

Air Pollutants↗
PubMed1988

Relationships between clinical symptoms and monoamine metabolite concentrations in biochemically defined subgroups of depressed patients.

In 28 patients with primary depression, relationships were sought between rating scores on the Montgomery-Asberg Depression Rating Scale and the concentrations of the monoamine metabolites 5-hydroxyindoleacetic acid (5-HIAA), homovanillic acid (HVA) and 4-hydroxy-3-methoxyphenylglycol (HMPG) in cerebrospinal fluid (CSF). Among the single items in the rating scale, reported sadness correlated negatively with HMPG. No other significant relationships were found in the total group of patients. However, in subgroups with low or high concentrations of monoamine metabolites, several significant relationships were found, such as a negative correlation between inner tension and concentration difficulties, respectively, and 5-HIAA in the low-HMPG subgroup. Curvilinear relationships were found between pessimistic thoughts and 5-HIAA in the high-5-HIAA subgroup and between apparent sadness and 5-HIAA in the low-HMPG subgroup. Suicidal thoughts tended to correlate in a curvilinear way with the ratio of HMPG/5-HIAA in the low-HVA and the high-HMPG subgroups, but the curves were mirrored. The results indicate that relationships between clinical symptoms and monoamine metabolite homeostasis in CSF are qualitatively and quantitatively different in defined high-and low-monoamine subgroups of depressed patients.

Depressive Disorder↗
PubMed1984

Serotyping of cell culture-adapted subgroup 2 human rotavirus strains by neutralization.

Nine human rotavirus strains from stools of infants with gastroenteritis were serially propagated in MA-104 cell cultures. All strains were identified as subgroup 2 rotaviruses by RNA gel electrophoresis, complement fixation, and enzyme-linked immunosorbent assay. The human rotavirus strains were propagated for 15 to 20 passages and then used for immunization of guinea pigs and rabbits. Animal antisera were also raised against a subgroup 1 human strain purified from stools and against the cell culture-adapted Wa strain, a reference subgroup 2 rotavirus of human origin. Cross-neutralization studies revealed the existence of two distinct serotypes within the cell culture-adapted subgroup 2 human rotaviruses: strains related and unrelated to strain Wa were classified as serotypes 1 and 3, respectively. Results with convalescent-phase sera from infants with primary rotavirus infections confirmed the existence of two serotypes within subgroup 2, and the serotypes responsible for primary subgroup 2 infections could be determined on the basis of the neutralizing reactivity of convalescent sera.

Cells, Cultured↗
PubMed1984

Cultivation and subgroup determination of human rotaviruses from Egyptian infants and young children.

Primary African green monkey kidney cells were more sensitive than primary cynomolgus monkey kidney and MA104 cells for supporting the growth of human rotaviruses detected in diarrheal stools of Egyptian infants and young children. In attempts to characterize these Egyptian rotaviruses, only 31% of the strains tested in the form of fecal suspensions were identified as subgroup 1 or 2. After one passage in African green monkey kidney cells, 80% of the strains were identified as subgroup 1 or 2. Of these 43 rotaviruses for which the subgroup was determined, 28% were subgroup 1 and 72% were subgroup 2. Thus, cultivation in African green monkey kidney cell cultures facilitated the antigenic characterization of rotaviruses by subgrouping; cultivation also represents an initial step in determining serotype and in developing potential vaccine candidates.

Animals↗
PubMed1996

Discrimination of respiratory syncytial virus subgroups A and B by reverse transcription-PCR.

Reverse transcription (RT)-PCR with shared primers differentiating respiratory syncytial virus (RSV) subgroups A and B was developed for subtyping of RSV isolates. Results of RT-PCR were compared with those of an indirect immunofluorescence test using monoclonal antibodies. Viral RNA isolated from cell cultures infected with RSV served as a template for cDNA synthesis with random primers. For PCR, we used three synthetic oligonucleotides corresponding to the G protein mRNA sequence of subgroup A (bases 248 to 267; 3'ATGCAACAAGCCAGATCAAG), subgroup B (bases 314 to 333; 3'ACTCATCCAAACAACCCACA), or both (bases 511 to 530; 3'GGWACAAARTTGAACACTTC). PCR products of RSV subgroups A and B had molecular sizes of 283 and 217 bp, respectively. Specific cutting sites for RSV A and B in amplified cDNA were demonstrated by restriction fragment analysis with four restriction endonucleases. Our RT-PCR assay divided 68 RSV isolates into 47 strains of subgroup A and 21 strains of subgroup B in full agreement with subtyping by monoclonal antibodies. RT-PCR seems to be a good alternative to subtyping of RSV with monoclonal antibodies.

Antibodies, Monoclonal↗
PubMed1987

Antigenic relatedness between glycoproteins of human respiratory syncytial virus subgroups A and B: evaluation of the contributions of F and G glycoproteins to immunity.

The degree of antigenic relatedness between human respiratory syncytial virus (RSV) subgroups A and B was estimated from antibody responses induced in cotton rats by respiratory tract infection with RSV. Glycoprotein-specific enzyme-linked immunosorbent assays of antibody responses induced by RSV infection demonstrated that the F glycoproteins of subgroups A and B were antigenically closely related (relatedness, R approximately 50%), whereas the G glycoproteins were only distantly related (R approximately 5%). Intermediate levels of antigenic relatedness (R approximately 25%) were seen in neutralizing antibodies from cotton rats infected with RSV of the two subgroups. Immunity against the F glycoprotein of subgroup A, induced by vaccinia-A2-F, conferred a high level of protection which was of comparable magnitude against challenge by RSV of either subgroup. In comparison, immunity against the G glycoprotein of subgroup A, induced by vaccinia-A2-G, conferred less complete, but significant, protection. Importantly, in vaccinia-A2-G-immunized animals, suppression of homologous challenge virus replication was significantly greater (13-fold) than that observed for the heterologous virus.

Animals↗
PubMed1997

Functional phenotype of transformed human alphabeta and gammadelta T cells determined by different subgroup C strains of herpesvirus Saimiri.

Based on sequence divergence in the transformation-relevant region, herpesvirus saimiri strains are classified into three subgroups. Only members of subgroup C transform human T lymphocytes to continuous interleukin-2-dependent growth in culture. In this study, human cord blood T cells were immortalized by using different subgroup C strains (C488, C484, and C139). The resulting T-cell lines represented different types of T-cell clones. They were either CD4+ or CD8+ and expressed either the alphabeta or the gammadelta type of T-cell receptors. If transformed by the same virus strain, alphabeta and gammadelta clones were similar with respect to viral persistence, virus gene expression, proliferation, and Th1-type cytokine production. However, major differences were observed in T cells immortalized by different subgroup C strains. Strain C139 persisted at low copy number, compared to the high copy number of prototype C488. The transformation-associated genes stpC and tip of strain C488 were strongly induced after T-cell stimulation. The homologous genes of strain C139 were only weakly expressed and not induced after activation. After CD2 ligation, the C488-transformed T cells produced interleukin-2, whereas the C139-transformed cells did not. Correspondingly, the C139-transformed T cells were less sensitive to cyclosporin A. Sequence comparison from different subgroup C strains revealed a variability of the stpC/tip promoter region and of the Lck-binding viral protein Tip. Thus, closely related subgroup C strains of herpesvirus saimiri cause major differences in the functional phenotype of growth-transformed human T cells.

Amino Acid Sequence↗
PubMed2000

TVB receptors for cytopathic and noncytopathic subgroups of avian leukosis viruses are functional death receptors.

The identification of TVB(S3), a cellular receptor for the cytopathic subgroups B and D of avian leukosis virus (ALV-B and ALV-D), as a tumor necrosis factor receptor-related death receptor with a cytoplasmic death domain, provides a compelling argument that viral Env-receptor interactions are linked to cell death (4). However, other TVB proteins have been described that appear to have similar death domains but are cellular receptors for the noncytopathic subgroup E of ALV (ALV-E): TVB(T), a turkey subgroup E-specific ALV receptor, and TVB(S1), a chicken receptor for subgroups B, D, and E ALV. To begin to understand the role of TVB receptors in the cytopathic effects associated with infection by specific ALV subgroups, we asked whether binding of a soluble ALV-E surface envelope protein (SU) to its receptor can lead to cell death. Here we report that ALV-E SU-receptor interactions can induce apoptosis in quail or turkey cells. We also show directly that TVB(S1) and TVB(T) are functional death receptors that can trigger cell death by apoptosis via a mechanism involving their cytoplasmic death domains and activation of the caspase pathway. These data demonstrate that ALV-B and ALV-E use functional death receptors to enter cells, and it remains to be determined why only subgroups B and D viral infections lead specifically to cell death.

Animals↗