Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Inverted Repeat Sequences”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 271 records · Page 15Linked to original sources
PubMed1987

Changes in the DNase I sensitivity of DNA sequences within the yeast 2 micron plasmid nucleoprotein complex effected by plasmid-encoded products.

We examined the effect of plasmid-encoded gene products on two DNase-I-sensitive regions of DNA in the yeast 2 micron plasmid nucleoprotein complex. For these studies, each sensitive region was cloned into an appropriate vector, and the chimeric plasmids were transformed into yeast. Nucleoprotein complexes of the chimeric plasmids were partially purified and tested for sensitivity to DNase I digestion. One sensitive region is between the 3' end of the 2 micron plasmid coding region D and the plasmid REP3 locus. This region was more sensitive and exhibited a different cleavage pattern when purified from a yeast strain containing endogenous 2 micron plasmid copies than when purified from a yeast strain lacking plasmid copies. Examination of the effect of individual gene products and combinations of the various gene products revealed that the plasmid's REP1, REP2 and D loci were all necessary to restore the pattern to that found in the preparation containing endogenous 2 micron plasmid copies. The other sensitive region studied brackets the binding site of the plasmid-encoded FLP protein, which catalyzes site-specific recombination between the 2 micron plasmid's inverted repeated sequences. In contrast to the first sensitive region examined, the sensitive region in the inverted repeat was less sensitive in chimeric plasmids isolated from a yeast strain containing endogenous 2 micron plasmid copies than from one lacking endogenous copies. Presumably, this protection results from the binding of the FLP protein.

Base Sequence↗
PubMed1997

Terminal inverted repeats of insertion sequence IS30 serve as targets for transposition.

In the present study, we demonstrate that the terminal inverted repeats of the Escherichia coli insertion sequence IS30 are functional target sites for the transposition of the (IS30)2 dimer, which represents an intermediate structure in the transposition of IS30. Comparative analysis of various target regions revealed that the left and right ends differ in their "attractivity." In our experiments, the joined left and right ends, i.e., the (IS30)2 intermediate structure, was found to be the most preferred target. It was also shown that flanking sequences can influence the target activity of the terminal repeats. The functional part of the target region was localized in the inverted repeats by means of mutational analysis, and it corresponds to the binding site of IS30 transposase. Insertion of 1 bp into the right inverted repeat resulted in unusual target duplication accompanied by gene conversion. The choice of the terminal inverted repeats as targets in transposition leads to the reconstruction of the (IS30)2 structure, which may induce a cascade of further rearrangements. Therefore, this process can play a role in the evolution of the genome.

Binding Sites↗
PubMed1990

Mutagenesis by hydrogen peroxide treatment of mammalian cells: a molecular analysis.

Hydrogen peroxide is an oxidizing agent which can be generated intracellularly either during normal metabolism or by treatment with external agents including solar UV radiation. Simian cells (CV-1) transfected with the SV40-based shuttle vector plasmid pZ189 have been treated with H2O2 and then incubated to allow repair and replication of the plasmid. The frequency of mutations at the supF locus of the recovered plasmid increases by a factor of up to four over the spontaneous value. The nucleotide changes associated with 100 spontaneous and 100 H2O2-induced mutants have been determined directly by sequencing a 150 bp fragment that includes the entire supF tRNA coding region. Deletions were observed in approximately 45% of both the spontaneous and induced mutants, whereas single or multiple base changes arose in 68 and 57% of the induced and spontaneous mutants respectively. The spectrum of induced mutations is characterized by (i) the occurrence of deletions associated with base changes (16% of all mutants analysed) and (ii) small deletions of 3 bp and less (51% of all deletion mutants sequenced). Sixty-five per cent (15 out of 23) of all small deletions (spontaneous and induced) are associated with runs of between two and five identical bases and eight of them arise at a mutational 'hotspot' region of five cytosines between bp 172 and 176. The majority (19 out of 30) of completely sequenced deletions observed in the spontaneous spectrum contain either (i) small (2-10 bp) direct repeat sequences that lie immediately outside one deletion terminus and immediately inside the second deletion terminus or (ii) small (2-3 bp) inverted repeat sequences lying immediately inside the two deletion termini. Most deletions that we have observed are therefore likely to arise as a consequence of specific aspects of DNA structure.

Animals↗
PubMed1990

Purification and properties of RhaR, the positive regulator of the L-rhamnose operons of Escherichia coli.

The product of the rhaR gene, which regulates the level of mRNA produced from the four L-rhamnose-inducible promoters of the rhamnose operon, has been hypersynthesized and purified by a two-column procedure. The purified protein is a 33 kDa DNA-binding protein that binds to an inverted repeat structure located within the psr promoter, the promoter for the rhaS and rhaR genes. The equilibrium binding constants and kinetic constants have been determined under a variety of solution conditions. The protein binds with high affinity and its binding is sensitive to salt concentration and the presence of L-rhamnose. The nucleotides and phosphate residues contacted by RhaR were identified by chemical interference assays. All of the contacts are made to one face of the DNA and the symmetrical pattern matches the inverted repeat sequence proposed for the binding site. An unusual property of the binding site is that the two half-sites of the inverted repeat are separated from one another by 17 base-pairs of uncontacted DNA. Significant binding is retained if the 17 base-pairs are extended by insertions of integral turns of DNA, but not by half-integral turns. The complex of RhaR-DNA appears to be sharply bent, approximately 160 degrees.

Base Sequence↗
PubMed1985

The maize cytochrome c oxidase subunit I gene: sequence, expression and rearrangement in cytoplasmic male sterile plants.

The single copy of the gene for cytochrome c oxidase subunit I (COX I) present in the mitochondrial genome of fertile maize (Zea mays L.) is encoded by a continuous open reading frame of 1584 nucleotides. The predicted polypeptide encoded by the gene has a mol. wt. of 58 219 daltons and shows >60% amino acid sequence homology with the corresponding fungal and animal polypeptides. Two major transcripts of 2400 and 2300 nucleotides can be detected and the 5' end of the larger transcript maps to a sequence from -161 to -153 (relative to the initiator codon) which shows high homology to the yeast mitochondrial promoter. In mitochondrial DNA from the S male-sterile cytoplasm of maize, which also characteristically contain two low mol. wt. linear DNAs (S1 and S2), rearrangements just 5' (at -175) to the COX I gene, generate additional DNA restriction fragments containing entire copies of the gene. These rearrangements involve a sequence identical to the terminal 186 bp of the 208-bp inverted repeat sequence found at either end of the S1 and S2 DNAs.

Journal Article↗
PubMed1986

The E35 stopper mutant of Neurospora crassa: precise localization of deletion endpoints in mitochondrial DNA and evidence that the deleted DNA codes for a subunit of NADH dehydrogenase.

Two types of defective mitochondrial DNA molecules with large deletions (5 kbp and 40 kbp) have previously been identified in the stopper mutant, E35, of Neurospora crassa. The junction fragments spanning the deletion endpoints have now been cloned and sequenced, and their sequences compared with those of the corresponding wild-type fragments. We show that both types of defective mitochondrial DNAs result from deletions of sequences flanked by short direct repeats, which are themselves parts of larger inverted repeat sequences. In every case, the short direct repeat sequences consist of a run of pyrimidines in one strand and purines in the other. We also report the sequence of a 2151-bp HindIII fragment, which is deleted in both of the defective mitochondrial DNAs. Besides the previously identified gene for a methionine tRNA, the 2151-bp DNA sequence contains an open reading frame with the potential to code for a hydrophobic protein 583 amino acids long. This hydrophobic protein has three blocks of significant homology with proteins coded by URF2 found in other mitochondrial genomes. Since the mammalian mitochondrial URF2 has recently been shown to code for a subunit of NADH dehydrogenase, part of the DNA sequence missing in the E35 stopper mutant of N. crassa may also code for a subunit of NADH dehydrogenase.

Amino Acid Sequence↗
PubMed1995

Cloning and sequencing of a beta-lactamase-encoding gene from the insect pathogen Bacillus thuringiensis.

A beta-lactamase (Bla)-encoding gene (bla) from Bacillus thuringiensis (Bt) was cloned and the nucleotide (nt) sequence was determined. Both the nt sequence and deduced amino acid sequences reveal that the Bt Bla is very similar to that of B. cereus and other group A Bla. The transcription start point was also determined. Comparison of the upstream region of Bt bla with that of other genes suggested the presence of three sequence elements that might be involved in promoter function: the -10 (TCGGTGAT) and -35 (TTAT) sequences, an A+T-rich region (5'TACTAGCTATAATTTTTTAGT) and an inverted repeat sequence (5'-GAGATAGAGGC[GCTACTATCTC).

Amino Acid Sequence↗
PubMed2006

Construction of equalized short hairpin RNA library from human brain cDNA.

Short hairpin RNA (shRNA) library is a powerful new tool for high-throughput loss-of-function genetic screens in mammalian cells. An shRNA library can be constructed from synthetic oligonucleotides or enzymatically cleaved natural cDNA. Here, we describe a new method for constructing equalized shRNA libraries from cDNA. First, enzymatically digested cDNA fragments are equalized by a suppression PCR-based method modified from suppression subtractive hybridization. The efficiency of equalization was confirmed by quantitative real-time PCR. The fragments are then converted into an shRNA library by a series of enzymatic treatments. With this new technology, we constructed a library from human brain cDNA. Sequence analysis showed that most of the randomly selected clones had inverted repeat sequences converted from different cDNA. After transfecting HEK 293T cells and detecting gene expression, three out of eight clones were demonstrated to significantly inhibit their target genes.

Base Sequence↗
PubMed1996

DNA and RNA oligomer sequences from the 3' noncoding region of the chicken glutamine synthetase gene from intramolecular hairpins.

The DNA sequence of the chicken glutamine synthetase gene contains an A.T-rich stretch of approximately 1500 base pairs in the 3' noncoding regions of exon 7 [Pu, H., & Young, A. P. (1989) Gene 18, 169-175]. Within this region several palindromic sequences occur that could conceivably form intramolecular structures. One such perfect inverted repeat sequence resides between positions 2605 and 2623. To investigate the hairpin-forming potential for this sequence, optical and calorimetric melting and gel electrophoresis studies have been performed on the following synthetically prepared DNA and RNA oligomer subsequences: DNA, 5'd-T-T-T-T-T-T-A-A-T-A-A-T-T-A-A-A-A-A-A-3'; and RNA, 5'r-U-U-U-U-U-U-A-A-U-A-A-U-U-A-A-A-A-A-A-3'. The DNA strand corresponds to the coding strand sequence while the RNA strand represents the transcribed mRNA. Results of melting analysis of these 19-base, partially self-complementary strands performed in 115 mM Na+ yielded evaluations of their thermodynamic transition parameters. These values are consistent with the melting of unimolecular structures, presumably hairpins. Thermodynamic parameters evaluated by analysis of the optical melting transitions assuming a two-state model and measured directly by differential scanning calorimetry agreed within experimental error. Therefore, melting behavior of the hairpins is all-or-none like. The DNA hairpin is slightly more stable than the RNA hairpin with melting enthalpy delta H0 = 41.2 +/- 3.8 kcal/mol and entropy delta S0 = 133 +/- 11 cal/K.mol (eu) compared to delta H0 = 32.0 +/- 6.0 kcal/mol and entropy delta S0 = 105 +/- 20 eu for the RNA. Gel electrophoretic analysis of these oligomers alone and in various mixtures with their DNA and RNA complementary strands was also performed. Consistent with interpretations of melting results, these experiments revealed both strands alone preferentially form intramolecular hairpin structures. In mixtures in which their complementary strands are in vast molar excess (stoichiometric ratios > 10:1), the intramolecular structures are converted to intermolecular duplexes. For the DNA and RNA strands examined, the conversion is not complete until over a 1000-fold excess of the complementary strand is added. Semiquantitative analysis of gel electrophoretograms enabled evaluations of the relative free energies of the hairpin and duplex states as a function of complementary strand concentration. With the finding that these sequences preferentially form hairpins, potential roles these structures could play in regulatory activities are considered.

Animals↗
PubMed2003

Isolation and analysis of a new hopper hAT transposon from the Bactrocera dorsalis white eye strain.

A new hopper element belonging to the hAT transposon family was isolated from the white eye mutant strain of the Oriental fruit fly, Bactrocera dorsalis. Using the original hopper element sequence from the wild type Kahuku strain as a template, the new hopper was isolated by inverse and direct PCR. Nucleotide sequence analysis reveals a 3131 bp element with terminal and subterminal inverted repeat sequences, an 8 bp duplicated insertion site, and a conceptual translation yielding a single uninterrupted 650 amino acid open reading frame. The white eye hopper has structure more consistent with function than the Kahuku element, indicating that hopper is not an ancient relic. The hopper element remains distantly related to other known hAT elements including those from insects, and presently it is most similar to Activator-related elements discovered in the human genome. DNA hybridization studies indicate, however, that elements closely related to hopper exist in another bactrocerid species, the melonfly, B. cucurbitae.

Amino Acid Sequence↗
PubMed2002

Coexistence of a novel beta-globin gene deletion (codons 81-87) with the codon 30 (G-->C) mutation in an Indian patient with beta0-thalassemia.

We identified and characterized a novel beta0-thalassemia mutation due to the deletion of 22 bases from codons 81 through 87, found in a compound heterozygous state with codon 30 (G-->C) in a patient originating from West Bengal State, India. The deletion causes a shift in the reading frame of the coding sequence and creates a stop codon at position 81. Direct and inverted repeat sequences present in the deleted region might be involved in the origin of this mutation. The patient had moderate anemia and did not require blood transfusions (thalassemia intermedia).

Base Sequence↗
PubMed1982

The internal organization of the varicella-zoster virus genome.

DNA was extracted from varicella-zoster (VZ) virions prepared in sucrose gradients. Thirty-eight molecules examined by electron microscopy were found to have a mean length of 46.7 micrometers. Examination of self-annealed VZV DNA molecules revealed that the virus genome was composed of a unique linear large sequence with a mol. wt. of 74.4 X 10(6) to 78.4 X 10(6), and a unique short sequence of mol. wt. approx. 9.8 X 10(6) flanked by inverted repeat sequences of 4.7 X 10(6) mol. wt.

Base Sequence↗
PubMed2001

Mutually exclusive distribution of IS1548 and GBSi1, an active group II intron identified in human isolates of group B streptococci.

The present study shows that active, self-splicing group II intron GBSi1 is located downstream of the C5a-peptidase gene, scpB, in some group B streptococcus (GBS) isolates that lack insertion sequence IS1548. IS1548 was previously reported to be often present at the scpB locus in GBS isolated in association with endocarditis. Since none of 67 GBS isolates examined, 40 of which were of serotype III, harbored both IS1548 and GBSi1, these two elements are suggested to be markers for different genetic lineages in GBS serotype III. The DNA region downstream of scpB in GBS isolates harboring either GBSi1, IS1548, or none of these mobile elements was found to encode the laminin binding protein, Lmb, which shows sequence similarities to a family of streptococcal adhesins. IS1548 is inserted 9 bp upstream of the putative promoter for lmb, while the insertion site for GBSi1 is located 88 bp further upstream. Sequences highly similar to GBSi1 exist also in Streptococcus pneumoniae. An inverted repeat sequence, with features typical of transcription terminators, was identified immediately upstream of the insertion site for the group II intron both in the GBS and S. pneumoniae sequences. This motif is suggested to constitute a target for the GBS intron as well as for rather closely related introns in Bacillus halodurans, Pseudomonas alcaligenes, and Pseudomonas putida. When transcripts containing the GBSi1 intron were incubated at high concentrations of ammonium and magnesium, a major product with the expected length and sequence for the ligated exons was generated. Unlike, however, all members of group II investigated so far, the excised intron was in linear, rather than in a branched (lariat), form.

Adhesins, Bacterial↗
PubMed2004

Structure and function of the shufflon in plasmid r64.

Conservative site-specific recombination plays key roles in creating biological diversity in prokaryotes. Most site-specific inversion systems consist of two recombination sites and a recombinase gene. In contrast, the shufflon multiple inversion system of plasmid R64 consists of seven sfx recombination sites, which separate four invertible DNA segments, and the rci gene encoding a site-specific recombinase of the integrase family. The rci product mediates recombination between any two inverted sfx sites, resulting in the inversion of four DNA segments independently or in groups. Random shufflon inversions construct seven pilV genes encoding constant N-terminal segment with different C-terminal segments. The pilV products are tip-located adhesins of the type IV pilus, called the thin pilus, of R64 and recognize lipopolysaccharides of recipient bacterial cells during R64 liquid matings. Thus, the shufflon determines the recipient specificity of liquid matings. Rci protein of R64 was overexpressed, purified, and used for in vitro recombination reactions. The cleavage and rejoining of DNA strands in shufflon recombinations were found to take place in the form of a 5' protruding 7-hp staggered cut within sfx sequences. Thus, the sfx sequence is asymmetric: only the 7-bp spacer sequence and the right arm sequence are conserved among various R64 sfxs, whereas the sfx left arm sequences are not conserved. Rci protein was shown to bind to entire sfx sequences, suggesting that it binds to the right arms of the sfx sequences in a sequence-specific manner and to their left arms in a non-sequence-specific manner. The sfx left arm sequences greatly affected the shufflon inversion frequency. The artificial symmetric sfx sequence, in which the sfx left arm was changed to the inverted repeat sequence of the right arm, exhibited the highest inversion frequency. Rci-dependent deletion of a DNA segment flanked by two symmetric sfx sequences in direct orientation was observed, suggesting that the asymmetry of sfx sequences may prevent recombination between sfx sequences in direct orientation in the R64 shufflon. The Rci C-terminal domain was not required for recombination using the symmetric sfx sequence. A model, where the C-terminal domain of Rci protein plays a key role in the sequence-specific and non-specific binding of Rci to asymmetric sfx sites, was proposed. Site-specific recombination in the temperate phage Mx8 of M. xanthus was also described. The Mx8 attP site is located within the coding sequence of the Mx8 intP gene. Therefore, the integration of Mx8 into the M. xanthus chromosome results in the conversion of the intP gene into a new gene, intP. As a result of this conversion, the 112-amino-acid C-terminal sequence of the intP product is replaced with a 13-amino acid sequence of the intR product. The C-terminal domain of Mx8 IntP recombinase is only required for integration and not for excision.

Journal Article↗
PubMed2004

Structure and function of the shufflon in plasmid R64.

Conservative site-specific recombination plays key roles in creating biological diversity in prokaryotes. Most site-specific inversion systems consist of two recombination sites and a recombinase gene. In contrast, the shufflon multiple inversion system of plasmid R64 consists of seven sfx recombination sites, which separate four invertible DNA segments, and the rci gene encoding a site-specific recombinase of the integrase family. The rci product mediates recombination between any two inverted sfx sites, resulting in the inversion of four DNA segments independently or in groups. Random shufflon inversions construct seven pilV genes encoding constant N-terminal segment with different C-terminal segments. The pilV products are tip-located adhesins of the type IV pilus, called the thin pilus, of R64 and recognize lipopolysaccharides of recipient bacterial cells during R64 liquid matings. Thus, the shufflon determines the recipient specificity of liquid matings. Rci protein of R64 was overexpressed, purified, and used for in vitro recombination reactions. The cleavage and rejoining of DNA strands in shufflon recombinations were found to take place in the form of a 5' protruding 7-bp staggered cut within sfx sequences. Thus, the sfx sequence is asymmetric: only the 7-bp spacer sequence and the right arm sequence are conserved among various R64 sfxs, whereas the sfx left arm sequences are not conserved. Rci protein was shown to bind to entire sfx sequences, suggesting that it binds to the right arms of the sfx sequences in a sequence-specific manner and to their left arms in a non-sequence-specific manner. The sfx left arm sequences greatly affected the shufflon inversion frequency. The artificial symmetric sfx sequence, in which the sfx left arm was changed to the inverted repeat sequence of the right arm, exhibited the highest inversion frequency. Rci-dependent deletion of a DNA segment flanked by two symmetric sfx sequences in direct orientation was observed, suggesting that the asymmetry of sfx sequences may prevent recombination between sfx sequences in direct orientation in the R64 shufflon. The Rci C-terminal domain was not required for recombination using the symmetric sfx sequence. A model, where the C-terminal domain of Rci protein plays a key role in the sequence-specific and non-specific binding of Rci to asymmetric sfx sites, was proposed. Site-specific recombination in the temperate phage Mx8 of M. xanthus was also described. The Mx8 attP site is located within the coding sequence of the Mx8 intP gene. Therefore, the integration of Mx8 into the M. xanthus chromosome results in the conversion of the intP gene into a new gene, intR. As a result of this conversion, the 112-amino-acid C-terminal sequence of the intP product is replaced with a 13-amino acid sequence of the intR product. The C-terminal domain of Mx8 IntP recombinase is only required for integration and not for excision.

Bacteria↗
PubMed2000

An engineered lox sequence containing part of a long terminal repeat of HIV-1 permits Cre recombinase-mediated DNA excision.

In our previous report, one 34-bp sequence from a long terminal repeat (LTR) of human immunodeficiency virus type 1 (HIV-1) clone, loxLTR-1, was proposed as a target site for site-specific excision by modified Cre recombinase. To support this suggestion, an engineered lox sequence, designated loxIL1, was made. This variant lox has the corresponding sequence of loxLTR-1 at the spacer region and the last two bases of inverted repeat sequence. Through in vitro recombination assay, loxIL1 also allowed the wild-type Cre to specifically recombine the sequence. An in vitro DNA binding experiment with mutants CreK244R and CreK244L revealed that lysine 244 of Cre plays an important role in interaction with the engineered lox. This result suggests that loxLTR-1 would be a candidate for antiviral strategy using site-specific recombinase.

DNA, Intergenic↗
PubMed1998

Conversion of temperature-sensitive to -resistant gene expression due to mutations in the promoter region of the melibiose operon in Escherichia coli.

The melibiose utilization system of Escherichia coli W3133, a derivative of K12, is nonfunctional between 37 and 42 degreesC. The reason for this temperature sensitivity was thought to be that the melibiose transporter (MelB) of W3133 cells was temperature-sensitive. A mutant W3133-2 has been isolated as a temperature-resistant strain that can utilize melibiose between 37 and 42 degreesC. However, we found that the melibiose transporter of the W3133-2 was still temperature-sensitive. Half-life activities of the melibiose transporter at 37 degreesC (or 40 degreesC) in both E. coli W3133 and W3133-2 were exactly the same. Furthermore, we found that the nucleotide sequence of coding region of the melB structural gene (the second gene of the melibiose operon) of W3133-2 was exactly the same as that of W3133. Activity of alpha-galactosidase (product of the first gene, melA, of the melibiose operon) of W3133 cells grown at 40 degreesC was very low, although that of W3133-2 cells grown at 40 degreesC was high. These observations suggested that expression of the melibiose operon in W3133 is also temperature-sensitive. In fact, we found that the expression in W3133 cells was temperature-sensitive, while that in W3133-2 cells was temperature-resistant, by analyzing mRNA levels using the Northern blot method. Furthermore, we identified mutations in the promoter region of the melibiose operon of W3133-2 that resulted in the elongation of an 18 nucleotide inverted repeat sequence to a 28-nucleotide repeat sequence present immediately upstream of the -35 region. This may stabilize a possible stem structure due to the inverted repeat at 37-42 degreesC.

Base Sequence↗
PubMed1985

A transcription termination signal immediately precedes the coding sequence for the chloramphenicol-inducible plasmid gene cat-86.

The plasmid gene cat-86 specifies chloramphenicol-inducible, chloramphenicol acetyltransferase in Bacillus subtilis. The inducible regulation is independent of the promoter that is used to activate cat-86 and is independent of the cat-86 coding sequence. We have proposed that the regulation of cat-86 results from the transcription of a pair of inverted-repeat sequences that immediately precede the coding sequence. These transcripts are predicted to sequester the cat-86 ribosome binding site in a stable RNA stem-loop which, in theory, should block the ribosome binding site from pairing with 16S rRNA. Inducible expression of cat-86 may therefore result in part from regulation of the translation of cat-86 mRNA. However, chloramphenicol-induction correlates with increased levels of cat-86 mRNA and the RNA stem-loop preceding the cat-86 coding sequence structurally resembles a rho-independent transcription terminator. We have therefore tested the inverted-repeats as a potential site of transcription termination. Transcription studies performed in vitro using SP6 RNA polymerase and in vivo by S1 mapping demonstrate that a substantial fraction of the potential cat-86 transcripts terminate at a site immediately 3' to the inverted-repeats. The results of the in vivo experiments suggest that the termination signal may be partially relieved by growth of cells in chloramphenicol.

Acetyltransferases↗