Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Netropsin”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 253 records · Page 14Linked to original sources
PubMed1997

Hairpin polyamides that use parallel and antiparallel side-by-side peptide motifs in binding to DNA.

Pt-bis-netropsin is a synthetic sequence-specific DNA-binding ligand comprizing two netropsin-like fragments which are linked in a tail-to-tail manner via a cis-diammineplatinum (II) residue. The CD studies and thermodynamic characterization of the DNA-binding properties exhibited by this compound reveal that it forms two types of complexes with poly[d(AT)].poly[d(AT)] and DNA oligomers containing nucleotide sequences 5'-CC(TA)n CC-3', with n = 4, 5 and 6. The first type corresponds to the binding of Pt-bis-netropsin in the extended conformation and is characterized by the saturating ratio of one bound Pt-bis-netropsin molecule per 9 AT-base pairs. The second type of the complex corresponds to the binding of Pt-bis-netropsin to DNA in the folded hairpin form. The binding approaches saturation level when one Pt-bis-netropsin molecule is bound per four or five AT-base pairs. The hairpin form of Pt-bis-netropsin complex is built on the basis of parallel side-by-side peptide motif which is inserted in the minor DNA groove. The CD spectral profiles reflecting the binding of Pt-bis-netropsin in the hairpin form are different from those observed for binding of another bis-netropsin with the sequence Lys-Gly-Py-Py-Gly-Gly-Gly-Py-Py-Dp, where Py is a N-propylpyrrole amino acid residue and Dp is a dimethylaminopropylamino residue. The hairpin form of this bis-netropsin is formed on the basis of antiparallel side-by-side peptide motif. The CD spectra obtained for complexes of this polyamide in the hairpin form with poly[d(AT)].poly[d(AT)] exhibit positive CD band with a peak at 325 nm, whereas the CD spectral profiles for the second complex of Pt-bis-Nt with poly[d(AT)].poly[d(AT)] and short DNA oligomers have two intense positive CD bands near 290 nm and 328 nm. This reflects the fact that two bis-netropsins use different structural motifs on binding to DNA in the hairpin form.

Amino Acid Sequence↗
PubMed1990

Thermodynamic data from drug-DNA footprinting experiments.

Sequence-dependent thermodynamic quantities for the antiviral agent netropsin and a related bis(N-methylimidazole) dipeptide, lexitropsin, have been determined by DNase I footprinting techniques. The primary data are autoradiographic spot intensities derived from 10 footprinting experiments carried out in the temperature range 0-45 degrees C. After exclusion effects due to overlapped drug sites on DNA and redistribution phenomena associated with the enzyme were accounted for, sequence-dependent binding constants for the two ligands were calculated. Our approach does not require an independent determination of the free drug concentration, which is calculated, with individual site binding constants, by using only footprinting data. The temperature dependence of the binding constants for netropsin implied that the binding enthalpies for all the sites but one on a 139 base pair restriction fragment of pBR 322 DNA are exothermic. Their values roughly correlate with the free energies of binding, which are smaller for sites including a 5'-TA-3' sequence. The binding enthalpies for the lexitropsin to all its sites were exothermic and more negative than those of netropsin. This may be due to the greater ability of the lexitropsin, when compared to netropsin, to form hydrogen bonds with sites on DNA. The binding constants of the lexitropsin toward its GC interaction sequences were much lower than those of netropsin, as can be explained by the reduced charge of the former ligand. Although it is difficult to determine the specific origin of the thermodynamic effects measured, comparison between netropsin and the lexitropsin suggests that the degree of solvation in the minor groove of DNA may be a factor influencing the entropy of the binding process.

Base Sequence↗
PubMed2002

Antitumor AHMA linked to DNA minor groove binding agents: synthesis and biological evaluation.

DNA minor groove binder hybrid molecules, netropsin derivatives such as N-[2-(dimethylamino)ethyl]-1-methyl-4-aminopyrrolo-2-carboxamide (MePy) or its derivatives containing two units of N-methylpyrrolecarboxamide (diMePy) and bisbenzimidazole (Ho33258), were linked to the NH(2) function of AHMA or to the CH(2)OH group of AHMA-ethylcarbamate to form AHMA-N-netropsins (13-16) and AHMA-ethylcarbamate-O-netropsins (19-22), and AHMA-bisbenzimidazole (AHMA-Ho33258, 25), respectively. These conjugates' in vitro antitumor activity, inhibition of a variety of human tumor cell growth, revealed that AHMA-ethylcarbamate-O-netropsin derivatives were more cytotoxic than AHMA-N-netropsin compounds. In the same studies, all compounds bearing MePy were more potent than those compounds linked with diMePy. Moreover, AHMA-netropsin derivatives bearing a succinyl chain as the linking spacer were more potent than those compounds having a glutaryl bridge. Among these hybrid molecules, AHMA-ethylcarbamate-O-succinyl-MePy (19) was 2- to 6-fold more cytotoxic than the parent compound AHMA (5) in various cell lines, whereas compound 25 had very poor solubility and was inactive. Studies on the inhibitory effect against topoisomerase II (Topo II) and DNA interaction of these conjugates showed no correlation between the potency of DNA binding and inhibitory activity against Topo II.

Acridines↗
PubMedDate not supplied

Sequence-specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study.

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis-diammine platinum(II)-bridged bis-netropsin, cis-diammine platinum(II)-bridged bis-distamycin and bis-glycine-linked bis-distamycin were investigated for sequence-specific interactions. The oligonucleotides used were the 154 base pair HindIII-RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI-PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134-1139 (5'AATCTT3'), 1152-1156 (5'ATATT3') and 1178-1194 (5'TTTCAATCTTTTTATTT3') for the former and 720-726 (5'TATTCTT3'), 751-771 (5'AATTGTATAATAAATTTAAAA3') and 781-785 (5'TATTT3') for the latter. The AT-preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (Ka) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 approximately SN 6570>platinum-bridged netropsin or distamycin approximately bis-glycine-bridged distamycin and was found independently of the binding sites examined. GC-base pairs interspersed in short AT-tracts reduced the Ka-values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT-stretches has been discussed.

Cisplatin↗
PubMed1989

Quantitative footprinting analysis using a DNA-cleaving metalloporphyrin complex.

The results of quantitative footprinting studies involving the antiviral agent netropsin and a DNA-cleaving cationic metalloporphyrin complex are presented. An analysis of the footprinting autoradiographic spot intensities using a model previously applied to footprinting studies involving the enzyme DNase I [Ward, B., Rehfuss, R., Goodisman, J., & Dabrowiak, J. C. (1988) Biochemistry 27, 1198-1205] led to very low values for netropsin binding constants on a restriction fragment from pBR-322 DNA. In this work, we show that, because the porphyrin binds with high specificity to DNA, it does not report site loading information in the same manner as does DNase I. We elucidate a model involving binding equilibria for individual sites and include competitive binding of drug and porphyrin for the same site. The free porphyrin and free drug concentrations are determined by binding equilibria with the carrier (calf thymus DNA) which is present in excess and acts as a buffer for both. Given free porphyrin and free netropsin concentrations for each total drug concentration in a series of footprinting experiments, one can calculate autoradiographic spot intensities in terms of the binding constants of netropsin to the various sites on the 139 base pair restriction fragment. The best values of these binding constants are determined by minimizing the sum of the squared differences between calculated and experimental footprinting autoradiographic spot intensities. Although the determined netropsin binding constants are insensitive to the value assumed for the porphyrin binding constant toward its highest affinity sites, the best mean-square deviation between observed and calculated values, D, depends on the choice of (average) drug binding constant to carrier DNA, Kd.(ABSTRACT TRUNCATED AT 250 WORDS)

Base Sequence↗
PubMed1989

Binding of mithramycin to DNA in the presence of second drugs.

Comparative DNA equilibrium binding studies with mithramycin (MTR) and ethidium bromide in the presence and in the absence of second drugs were investigated by spectral titrations. Unusual curvatures (in contrast to those due to neighbor exclusion or anticooperativity) are found in the Scatchard plots of MTR-DNA titrations in the presence of netropsin, a minor-groove binder. Parallel studies with ethidium bromide indicate that although the presence of netropsin significantly reduces the binding ability of ethidium, no unusually curved Scatchard plots are obtained. The unusual curvature exhibited by the Scatchard plots of MTR titrations in the presence of netropsin indicates that the binding of netropsin greatly affects the MTR binding to DNA and can be simulated by an explicit incorporation of the second drug-DNA interaction in the binding formalism. Since netropsin is a minor-groove binder, its interference with the binding of MTR is in accord with the notion that MTR also binds at this groove. The observation of negligible effects on the DNA binding ability of MTR in the presence of either a major-groove or a phosphate group binder lends further support to this conclusion. Consistent with its guanine specificity, studies with synthetic polynucleotides suggest that MTR exhibits negligible affinity for poly(dA-dT).poly(dA-dT) or poly(dA).poly(dT).(ABSTRACT TRUNCATED AT 250 WORDS)

Binding Sites↗
PubMed1989

Probing the hydration of the minor groove of A.T synthetic DNA polymers by volume and heat changes.

The minor-groove ligand netropsin provides a sensitive probe of the hydration difference between poly(dA).poly(dT) and poly[d(AT)].poly[d(AT)]. We have measured the volume change delta V accompanying binding of netropsin to these polymers, using an improved magnetic suspension densimeter. For poly(dA).poly(dT) we find delta V = +97 mL/mol of bound netropsin at pH 7.0 and 10 mM sodium phosphate buffer. For poly[d(AT)].poly[d(AT)] we find delta V = -16 mL/mol of bound netropsin. This striking differential effect suggests that the poly(dA).poly(dT) duplex compresses more water (or is more extensively hydrated). From our enthalpy and entropy results we estimate the approximately 10 water molecules, immobilized in the minor groove of this system, are displaced by each netropsin bound. The volume increase, however, is substantially larger than can be explained by a simple melting of these immobilized water molecules in the minor groove. A decompression of at least 40 water molecules must attend the complexation to the poly(dA).poly(dT) duplex. This suggests that the conformation change attending the binding of the drug to this polymer duplex causes a further dehydration, whereas no such change in dehydration and configuration for the heteropolymer system is indicated.

Binding Sites↗
PubMed1996

Design of sequence-specific DNA binding ligands that use a two-stranded peptide motif for DNA sequence recognition.

The design and DNA binding activity of beta-structure-forming peptides and netropsin-peptide conjugates are reported. It is found that a pair of peptides-S,S'-bis(Lys-Gly-Val-Cys-Val-NH-NH-Dns)-bridged by an S-S bond binds at least 10 times more strongly to poly(dG).poly(dC) than to poly(dA).poly(dT). This peptide can also discriminate between 5'-GpG-3' and 5'-GpC-3' steps in the DNA minor groove. Based on these observations, new synthetic ligands, bis-netropsins, were constructed in which two netropsin-like fragments were attached by means of short linkers to a pair of peptides-Gly-Cys-Gly- or Val-Cys-Val-bridged by S-S bonds. These compounds possess a composite binding specificity: the peptide chains recognize 5'-GpG-3' steps on DNA, whereas the netropsin-like fragments bind preferentially to runs of 4 AT base pairs. Our data indicate that combining the AT-base-pair specific properties of the netropsin-type structure with the 5'-GpG-3'-specific properties of certain oligopeptides offers a new approach to the synthesis of ligands capable of recognizing mixed sequences of AT- and GC-base pairs in the DNA minor groove. These compounds are potential models for DNA-binding domains in proteins which specifically recognize base pair sequences in the minor groove of DNA.

Aminoglycosides↗
PubMed1995

The effect of AT and GC sequence specific minor groove-binding agents on restriction endonuclease activity.

The ability of the naturally occurring A/T specific DNA minor groove binders netropsin and diastamycin A and two synthetic G/C selective oligopeptide analogues (1 and 2), to interfere with the catalytic activity of restriction endonucleases has been investigated. Enzymes were chosen to have A/T rich (EcoRI, EcoRV) or G/C rich (BalI, NruI) recognition sequences. An agarose gel assay was used to measure the cleavage of 32P-labelled DNA and ligand-DNA binding data was obtained using methidium-propyl EDTA footprinting. Netropsin and distamycin bind at the recognition sites, and dose-dependently inhibited cleavage by, EcoRI and EcoRV, (EcoRI > EcoRV). They were also more effective at inhibiting the catalytic activity of BalI than either 1 or 2. NruI was inhibited by distamycin and 2, but not by netropsin or 1. DNA footprinting revealed that neither 1 or 2 bound to the BalI or NruI recognition sequences under the conditions used whereas netropsin and distamycin footprint at adjacent sites. 1 binds to two of the three recognition sequences for the enzyme Fnu4HI (GCNGC) in the fragment studied and was shown to inhibit DNA cleavage only at these two sites. 2 binds strongly to two GGGCTC sequences which are recognition sites for the enzyme BanII. In this case a pronounced stimulation of cleavage was observed in the presence of 2 over a wide dose range. The results indicate that enzyme inhibition does not necessarily result from simultaneous occupancy of a common site, or at nearby flanking sequences, and in some circumstances, a pronounced stimulation of enzyme cleavage can occur.

Autoradiography↗
PubMed2001

Changes in 13C NMR chemical shifts of DNA as a tool for monitoring drug interactions.

The antibiotic drug, netropsin, was complexed with the DNA oligonucleotide duplex [d(GGTATACC)]2 to explore the effects of ligand binding on the 13C NMR chemical shifts of the DNA base and sugar carbons. The binding mode of netrospin to TA-rich tracts of DNA has been well documented and served as an attractive model system. For the base carbons, four large changes in resonance chemical shifts were observed upon complex formation: -0.64 ppm for carbon 4 of either Ado4 or Ado6, 1.36 ppm for carbon 2 of Thd5, 1.33 ppm for carbon 5 of Thd5 and 0.94 for carbon 6 of Thd5. AdoC4 is covalently bonded to a heteroatom that is hydrogen bonded to netropsin; this relatively large deshielding is consistent with the known hydrogen bond formed at AdoN3. The three large shielding increases are consistent with hydrogen bonds to water in the minor groove being disrupted upon netropsin binding. For the DNA sugar resonances, large changes in chemical shifts were observed upon netropsin complexation. The 2', 3' and 5' 13C resonances of Thd3 and Thd5 were shielded whereas those of Ado4 and Ado6 were deshielded; the 13C resonances of 1' and 4' could not be assigned. These changes are consistent with alteration of the dynamic pseudorotational states occupied by the DNA sugars. A significant alteration in the pseudorotational states of Ado4 or Ado6 must occur as suggested by the large change in chemical shift of -1.65 ppm of the C3' carbon. In conclusion, 13C NMR may serve as a practical tool for analyzing structural changes in DNA-ligand complexes.

Base Sequence↗
PubMed1992

Interaction of lambda cro repressor with synthetic operator OR3 studied by competition binding with minor groove binders.

In the present work, we employ a combination of CD spectroscopy and gel retardation technique to characterize thermodynamically the binding of lambda phage cro repressor to a 17 base pair operator OR3. We have found that three minor groove-binding antibiotics, distamycin A, netropsin and sibiromycin, compete effectively with the cro for binding to the operator OR3. Among these antibiotics, sibiromycin binds covalently to DNA in the minor groove at the NH2 of guanine, whereas distamycin A and netropsin interact preferentially with runs of AT base pairs and avoid DNA regions containing guanine bases in the two polynucleotide strands. Only subtle DNA conformation changes are known to take place upon binding of these antibiotics. Both the CD spectral profiles and the results of the gel retardation experiments indicate that distamycin A and netropsin can displace cro repressor from the operator OR3. The binding of cro repressor to the OR3 is accompanied by considerable changes in CD in the far-UV region which appear to be attributed to a DNA-dependent structural transition in the protein. Spectral changes are also induced in the wavelength region of 270-290 nm. The CD spectral profile of the cro-OR3 mixture in the presence of distamycin A can be represented as a sum of the CD spectrum of the repressor-operator complex and spectrum of distamycin-DNA complex at the appropriate molar ratio of the bound antibiotic to the operator DNA (r). When r tends to the saturation level of binding the CD spectrum in the region of 270-360 nm approaches a CD pattern typical of complexes of the antibiotic with the free DNA oligomer. This suggests that simultaneous binding of cro repressor and distamycin A to the same DNA oligomer is not possible and that distamycin A and netropsin can be used to determine the equilibrium affinity constant of cro repressor to the synthetic operator from competition-type experiments. The binding constant of cro repressor to the OR3 is found to be (6 +/- 1).10(6)M-1 at 20 degrees C in 10 mM sodium cacodylate buffer (pH 7.0) in the presence of 0.1 M NH4F.

Aminoglycosides↗
PubMed1994

Mutagenicity and pausing of HIV reverse transcriptase during HIV plus-strand DNA synthesis.

The unusually high frequency of misincorporation by HIV-1 reverse transcriptase (HIV RT) is likely to be the major factor in the rapid accumulation of viral mutations in AIDS, especially in the env gene. To investigate the ability of HIV RT to copy the env gene, we subcloned an HIV env gene fragment into a single-stranded DNA vector and measured the progression of synthesis by HIV RT. We observed that HIV RT, but not RT from avian myeloblastosis virus, DNA polymerase-alpha or T7 DNA polymerase, pauses specifically at poly-deoxyadenosine stretches within the env gene. The frequency of bypassing the polyadenosine stretches by HIV RT is enhanced by increasing the ratio of enzyme to template. We measured the fidelity of DNA synthesis within a segment of the hypervariable region 1 of the env gene (V-1) containing a poly-deoxyadenosine sequence by repetitively copying the DNA by HIV RT, and then cloning and sequencing the copied fragments. We found that 27% of the errors identified in V-1 sequence were frameshift mutations opposite the poly-adenosine tract, a site where strong pausing was observed. Pausing of HIV RT at the polyadenosine tract could be enhanced by either distamycin A or netropsin, (A-T)-rich minor groove binding peptides. Moreover, netropsin increases the frequency of frameshift mutations in experiments in which HIV RT catalyzes gap filling synthesis within the lacZ gene in double-stranded circular M13mp2 DNA. These combined results suggest that the enhanced mutation frequency may be due to increased pausing at netropsin-modified polyadenosine tracts. Therefore, netropsin and related A-T binding chemicals may selectively enhance frameshift mutagenesis induced by HIV RT and yield predominantly non-viable virus.

Base Composition↗
PubMed1997

Copper-dependent oxidative and topoisomerase II-mediated DNA cleavage by a netropsin/4'-(9-acridinylamino)methanesulfon-m-anisidide combilexin.

A conjugate molecule was synthesized by linking the DNA-intercalative antitumor drug 4'-(9-acridinylamino)methanesulfon-manisidide (mAMSA) via a 4-carboxamide side chain to a dipyrrolecarboxamide moiety structurally related to the minor groove-binding antibiotic netropsin. The molecule (netropsin/ mAMSA) behaves as a threading intercalator. Its netropsin-like tail becomes located in the minor groove of the double helix and serves to drive the hybrid molecule preferentially to AT-rich sites on various DNA fragments as revealed by DNase I footprinting. The hybrid retains the susceptibility to copper-dependent oxidation characteristic of the parent mAMSA moiety as well as its ability to generate oxygen radicals, which can mediate DNA damage, mainly at cytidine and guanosine nucleotides. It also retains the property of stimulating the formation of cleavable complexes with DNA in the presence of topoisomerase II, but its netropsin-like moiety confers little or no influence on the reaction with topoisomerase I. Although netropsin/mAMSA is less potent than mAMSA at producing cleavable complexes with topoisomerase II, it promotes the appearance of cleavage sites at much the same nucleotide sequences as does the parent compound. The dipyrrolecarboxamide tail is not silent, however, since it modifies the concentration-dependence of cleavable complex formation.

Amsacrine↗
PubMed1999

Interaction between antitumor drugs and a double-stranded oligonucleotide studied by electrospray ionization mass spectrometry.

Electrospray ionization mass spectrometry was used to investigate the complex formation between a double-stranded oligonucleotide and various antitumor drugs belonging to two categories: intercalators (ethidium bromide, amsacrine and ascididemin) and minor groove binders (Hoechst 33258, netropsin, distamycin A, berenil and DAPI). The goal of this study was to determine whether the relative intensities in the mass spectra reflect the relative abundances of the species in the solution phase. The full-scan mass spectra suggest non-specific binding for the intercalators and specific binding for the minor groove binders. The preferential stoichiometries adopted by each minor groove binder were determined by studying the influence of the drug concentration on the spectra. We obtained 2:1 > 1:1 for distamycin, 1:1 > 2:1 for Hoechst 33258 and DAPI and only the 1 : 1 complex for netropsin and berenil. These features reflect their known behavior in solution. The compared tandem mass spectra of the 1 : 1 complexes with Hoechst 33258 and netropsin, when correlated with published crystallographic data, suggest the possibility of inferring some structural information. The relative binding affinities of the drug for the considered duplex were deduced with two by two competition experiments, assuming that the relative intensities reflect the composition of the solution phase. The obtained affinity scale is netropsin > distamycin A > DAPI > Hoechst 33258 > berenil. These examples show some of the potential uses of mass spectrometry as a useful tool for the characterization of specific drug binding to DNA, and possibly a rapid drug screening method requiring small amounts of materials.

Antineoplastic Agents↗
PubMed1984

Interaction of nucleic acids with a non-intercalative anti-leukemic compound containing bisquarternary heterocycles.

The binding of an antitumour drug with bisquarternary ammonium heterocyclic structure, NSC-101327, to nucleic acids has been examined by using ultraviolet absorption and CD measurements. Like the minor groove-binding oligopeptides, netropsin and distamycin A, the optically inactive chromophoric system of NSC-101327 shows induced Cotton effects in the CD spectra of complexes with various DNAs, RNA and single-stranded polynucleotides. This property directly reflects interaction of NSC-101327 with different types of nucleic acids at moderate ionic strength, which contrasts with previous findings of a higher selective binding of netropsin to B-DNA. However, an efficient interactin of NSC-101327 with dA X dT basepair sequences is demonstrated by a large melting temperature increase of dA X dT-rich DNAs. NSC-101327 also reacts with dG X dC base pairs of B-DNA and forms a complex with Z-DNA of poly( br8dG -dC) X poly( br8DG -dC). The affinity of NSC-101327 to poly(dG-dC) X poly(dG-dC) is, however, lower, and the CD spectral binding effect depends on the ionic strength. The CD results of the complex with poly(dA-dT) X poly(dA-dT) suggests at least two binding modes, in accordance with previous conclusions. This is indicated by a clear-cut initial increase of the CD signal and a subsequent large decrease to negative CD signals. Competition experiments with netropsin suggest that binding of NSC-101327 occurs preferentially in the minor groove without intercalation. NSC-101327 also tends to interact with lower binding affinity to dG-dC pairs in B-DNA, with rA X rU pairs of RNA and with single-stranded polynucleotides. Thus our results suggest that NSC-101327 represents a DNA groove-binding ligand of lower basepair specificity and lower conformational selectivity compared to the B-specific netropsin probe.

Antineoplastic Agents↗
PubMed1990

Effect of ionic strength and cationic DNA affinity binders on the DNA sequence selective alkylation of guanine N7-positions by nitrogen mustards.

Large variations in alkylation intensities exist among guanines in a DNA sequence following treatment with chemotherapeutic alkylating agents such as nitrogen mustards, and the substituent attached to the reactive group can impose a distinct sequence preference for reaction. In order to understand further the structural and electrostatic factors which determine the sequence selectivity of alkylation reactions, the effect of increased ionic strength, the intercalator ethidium bromide, AT-specific minor groove binders distamycin A and netropsin, and the polyamine spermine on guanine N7-alkylation by L-phenylalanine mustard (L-Pam), uracil mustard (UM), and quinacrine mustard (QM) was investigated with a modification of the guanine-specific chemical cleavage technique for DNA sequencing. For L-Pam and UM, increased ionic strength and the cationic DNA affinity binders dose dependently inhibited the alkylation. QM alkylation was less inhibited by salt (100 mM NaCl), ethidium (10 microM), and spermine (10 microM). Distamycin A and netropsin (100 microM) gave an enhancement of overall QM alkylation. More interestingly, the pattern of guanine N7-alkylation was qualitatively altered by ethidium bromide, distamycin A, and netropsin. The result differed with both the nitrogen mustard (L-Pam less than UM less than QM) and the cationic agent used. The effect, which resulted in both enhancement and suppression of alkylation sites, was most striking in the case of netropsin and distamycin A, which differed from each other. DNA footprinting indicated that selective binding to AT sequences in the minor groove of DNA can have long-range effects on the alkylation pattern of DNA in the major groove.

Alkylation↗
PubMed2004

Changes in drug 13C NMR chemical shifts as a tool for monitoring interactions with DNA.

The antibiotic drug, netropsin, was complexed with the DNA oligonucleotide duplex [d(GGTATACC)]2 to monitor drug 13C NMR chemical shifts changes. The binding mode of netropsin to the minor groove of DNA is well-known, and served as a good model for evaluating the relative sensitivity of 13C chemical shifts to hydrogen bonding. Large downfield shifts were observed for four resonances of carbons that neighbor sites which are known to form hydrogen bond interactions with the DNA minor groove. Many of the remaining resonances of netropsin exhibit shielding or relatively smaller deshielding changes. Based on the model system presented here, large deshielding NMR shift changes of a ligand upon macromolecule binding can likely be attributed to hydrogen bond formation at nearby sites.

Anti-Bacterial Agents↗
PubMed1995

Interaction of minor groove ligands to an AAATT/AATTT site: correlation of thermodynamic characterization and solution structure.

A combination of circular dichroism spectroscopy, titration calorimetry, and optical melting has been used to investigate the association of the minor groove ligands netropsin and distamycin to the central A3T2 binding site of the DNA duplex d(CGCAAATTGGC).d(GCCAATTTGCG). For the complex with netropsin at 20 degrees C, a ligand/duplex stoichiometry of 1:1 was obtained with Kb approximately 4.3 x 10(7) M-1, delta Hb approximately -7.5 kcal mol-1, delta Sb approximately 9.3 cal K-1 mol-1, and delta Cp approximately 0. Previous NMR studies characterized the distamycin complex with A3T2 at saturation as a dimeric side-by-side complex. Consistent with this result, we found a ligand/duplex stoichiometry of 2:1. In the current study, the relative thermodynamic contributions of the two distamycin ligands in the formation of this side-by-side complex (2:1 Dst.A3T2) were evaluated and compared with the thermodynamic characteristics of netropsin binding. The association of the first distamycin molecule of the 2:1 Dst.A3T2 complex yielded the following thermodynamic profile: Kb approximately 3.1 x 10(7) M-1, delta Hb = -12.3 kcal mol-1, delta Sb = -8 cal K-1 mol-1, and delta Cp = -42 cal K-1 mol-1. The binding of the second distamycin molecule occurs with a lower Kb of approximately 3.3 x 10(6) M-1, a more favorable delta Hb of -18.8 kcal mol-1, a more unfavorable delta Sb of -34 cal K-1 mol-1, and a higher delta Cp of -196 cal K-1 mol-1. The latter term indicates an ordering of electrostricted and structural water molecules by the complexes. These results correlate well with the NMR titrations and are discussed in context of the solution structure of the 2:1 Dst.A3T2 complex.

Base Sequence↗