Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “TMV”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 235 records · Page 13Linked to original sources
PubMed1980

DNA synthesis in wounded or TMV-infected leaves from sensitive and hypersensitive tobacco plants.

After wounding or viral infection, tobacco leaves synthesized DNA, as evidenced by [3H]thymidine incorporation. This synthesis was maximal 22 h after infection or 46 h after wounding. It took place before necrotic lesions appeared in hypersensitive leaves. Effects of wounding or infection was transmitted to non-damaged halves of leaves in which they also induced DNA synthesis of similar kinetics but of less magnitude. This synthesis was mostly nuclear but non-mitotic. The extent of synthesis varied with the viral inoculum concentration and with the age of the leaves and correlated with the subsequent necrotic reaction.

DNA↗
PubMed1977

Sequence from the assembly nucleation region of TMV RNA.

In an effort to isolate RNA sequences containing the assembly nucleation region, uniformly 32P-labeled tobacco mosaic virus RNA was partially digested with pancreatic ribonuclease, and the mixture of fragments was incubated with limited amounts of tobacco mosaic virus protein disks in conditions favorable for reconstitution. The RNA fragments which became encapsidated were purified and sequenced by conventional techniques. The sequence of the first 139 nucleotides of P1, the principal encapsidated fragment, is AGGUUUGAGAGAGAAGAUUACAAGCGUGAGAGACGGAGGGCCCAUGGAACUUACAGAAGAAGUUGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCAAUCAGACUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGU. Residues 1--110 of P1 overlap the assembly origin isolated and characterized in the accompanying papers by Zimmern (1977) and Zimmern and Butler (1977). Our results, taken in conjunction with the two accompanying papers, define the sequence of much of the nucleation region as well as sequences flanking it on both sides. The features of the P1 sequence which may have role in the nucleation reaction are discussed in detail in the text.

Base Sequence↗
PubMed2000

Role of P30 in replication and spread of TMV.

The P30 movement protein (MP) of tobacco mosaic virus is essential for distribution of sites of replication within infected cells and for cell-cell spread of infection. MP is an integral membrane protein and in early and mid-stages of infection causes severe disruption of the cortical endoplasmic reticulum (ER). MP also associates with microtubules, and in late stages is targeted for degradation by the 26S proteosome. During these stages, the ER regains its normal pre-infection configuration. Viral RNA is associated with ER and microtubules in the presence of MP. The MP is phosphorylated and mutation of the phosphorylated amino acid reduced association of MP with the ER, plasmodesmata, and microtubules, and altered the stability of the MP. The nature of the association of MP with vRNA and ER and microtubules, and the role of phosphorylation of MP in each of these functions, if any, remains to be determined.

Biological Transport↗