Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Double Stranded RNA Viruses”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 235 records · Page 13Linked to original sources
PubMed1993

Structural studies of the enveloped dsRNA bacteriophage phi 6 of Pseudomonas syringae by Raman spectroscopy. I. The virion and its membrane envelope.

We report and interpret the first Raman spectrum of a double-stranded RNA virus containing a membrane envelope. Spectra of the native bacteriophage phi 6 and of its isolated host-attachment (spike) protein and phospholipid-free core assembly were collected from aqueous solutions over a wide range of temperature. Comparison of the vibrational spectra by digital difference methods permits the following structural conclusions regarding molecular constituents of the fully assembled virion. (1) The double-stranded RNA, phospholipid and protein components of the phage exhibit Raman amplitudes in accordance with their biochemically determined compositions in the native virion (10, 20 and 70%, respectively). (2) alpha-Helix and irregular conformations are the dominant secondary structures in proteins of both the viral membrane and nucleocapsid. This represents a departure from previously examined icosahedral phage and plant viruses, which are dominated by beta-sheet structures. (3) The phospholipids of the viral membrane are liquid crystalline throughout the determined range of virus thermostability (0 to 40 degrees C). (4) The P3 spike protein of phi 6, which is anchored to, but not sequestered within the viral membrane, is largely alpha-helical (approximately 35%) and highly thermolabile. Denaturation of P3 at temperatures above 30 degrees C leads to appreciable loss (approximately 20%) of alpha-helix in favor of beta-strand structure, and alters significantly the environments of many aromatic side-chains. (5) The secondary structures of integral membrane proteins of phi 6 are overwhelmingly alpha-helical (approximately 70 to 80%) and also thermolabile. In contrast to P3, which exhibits aspartate and glutamate carboxyls in the ionized form (CO2-), the integral membrane proteins exhibit only protonated carboxyl groups (COOH). Treatment of phi 6 with butylated hydroxytoluene (BHT), which has been shown to remove the P3 spike protein, does not significantly perturb phospholipids and associated integral proteins of the viral membrane or structural proteins and packaged double-stranded RNA of the nucleocapsid. However, P3 subunits, which are recovered after BHT treatment, exhibit radically altered secondary and tertiary structures, including the loss of most subunit alpha-helices. Among the P3 side-chains affected by BHT treatment, we note a general trend toward greater hydrophilicity and greater solvent exposure of the aromatic residues Trp and Tyr. On the other hand, the cysteine sulfhydryl groups of the BHT-isolated P3 monomer are not solvent exposed and function as strong hydrogen-bond donors in the protein core.(ABSTRACT TRUNCATED AT 400 WORDS)

Bacteriophage phi 6↗
PubMed1996

Amplification, expression, and packaging of a foreign gene by giardiavirus in Giardia lamblia.

Giardia lamblia is an intestinal protozoan parasite and one of the earliest eukaryotic divergents. The trophozoite multiplies via asexual binary fission and lacks all natural means of lateral gene transfer. A system is developed here for long-term expression of a foreign gene in this organism by exploiting recombinant virions derived from the giardiavirus (GLV), a double-stranded RNA virus that infects many Giardia isolates. An in vitro transcript of the cloned GLV cDNA, comprising the firefly luciferase-encoding region flanked by 5' and 3' fragments of GLV positive-strand RNA, was electroporated into GLV-infected trophozoites. Luciferase activity in electroporated cells peaked on day 2 at levels 6 orders of magnitude above background. Expression of this foreign gene remained at 80% of its peak level after 30 days in the absence of selective pressure. The chimeric RNA was replicated as double-stranded RNA and packaged into virus-like particles. The recombinant virions were partially purified from the wild-type helper virus by CsCl equilibrium density-gradient centrifugation and used to superinfect Giardia trophozoites. At multiplicities of infection of 100 or higher, these chimeric virions were able to initiate new rounds of expression of luciferase activity in the superinfected cells. Thus, the engineered virion can be successfully used to introduce and efficiently express a heterologous gene in this eukaryotic microorganism.

Animals↗
PubMed2000

Structure of the reovirus core at 3.6 A resolution.

The reovirus core is an assembly with a relative molecular mass of 52 million that synthesizes, modifies and exports viral messenger RNA. Analysis of its structure by X-ray crystallography shows that there are alternative, specific and completely non-equivalent contacts made by several surfaces of two of its proteins; that the RNA capping and export apparatus is a hollow cylinder, which probably sequesters its substrate to ensure completion of the capping reactions; that the genomic double-stranded RNA is coiled into concentric layers within the particle; and that there is a protein shell that appears to be common to all groups of double-stranded RNA viruses.

Capsid↗
PubMed2003

Identification of the minimal phosphoacceptor site required for in vivo activation of interferon regulatory factor 3 in response to virus and double-stranded RNA.

The ubiquitously expressed latent interferon regulatory factor (IRF) 3 transcription factor is activated in response to virus infection by phosphorylation events that target a cluster of Ser/Thr residues, (382)GGASSLENTVDLHISNSHPLSLTSDQY(408) at the C-terminal end of the protein. To delineate the minimal phosphoacceptor sites required for IRF-3 activation, several point mutations were generated and tested for transactivation potential and cAMP-response element-binding protein-binding protein/p300 coactivator association. Expression of the IRF-3 S396D mutant alone was sufficient to induce type I IFN beta, IFNalpha1, RANTES, and the interferon-stimulated gene 561 promoters. Using SDS-PAGE and immunoblotting with a novel phosphospecific antibody, we show for the first time that, in vivo, IRF-3 is phosphorylated on Ser(396) following Sendai virus infection, expression of viral nucleocapsid, and double-stranded RNA treatment. These results demonstrate that Ser(396) within the C-terminal Ser/Thr cluster is targeted in vivo for phosphorylation following virus infection and plays an essential role in IRF-3 activation. The inability of the phosphospecific antibody to detect Ser(396) phosphorylation in lipopolysaccharide-treated cells suggests that other major pathways may be involved in IRF-3 activation following Toll-like receptor 4 stimulation.

Amino Acid Sequence↗
PubMed1997

An atomic model of the outer layer of the bluetongue virus core derived from X-ray crystallography and electron cryomicroscopy.

BACKGROUND: Bluetongue virus (BTV), which belongs to the Reoviridae family and orbivirus genus, is a non-enveloped, icosahedral, double-stranded RNA virus. Several protein layers enclose its genome; upon cell entry the outer layer is stripped away leaving a core, the surface of which is composed of VP7. The structure of the trimeric VP7 molecule has previously been determined using X-ray crystallography. The articulated VP7 subunit consists of two domains, one which is largely alpha-helical and the other, smaller domain, is a beta barrel with jelly-roll topology. The relative orientations of these two domains vary in different crystal forms. The structure of VP7 and the organizations of 780 subunits of this molecule in the core of virus is central to the assembly and function of BTV. RESULTS: A 23 A resolution map of the core, determined using electron cryomicroscopy (cryoEM) data, reveals that the 260 trimers of VP7 are organized on a rather precise T = 13 laevo icosahedral lattice, in accordance with the theory of quasi-equivalence. The VP7 layer occupies a shell that is between 260 A and 345 A from the centre of the core. Below this radius (230-260 A) lies the T = 1 layer of 120 molecules of VP3. By fitting the X-ray structure of an individual VP7 trimer onto the cryoEM BTV core structure, we have generated an atomic model of the VP7 layer of BTV. This demonstrates that one of the molecular structures seen in crystals of the isolated VP7 corresponds to the in vivo conformation of the molecule in the core. CONCLUSIONS: The beta-barrel domains of VP7 are external to the core and interact with protein in the outer layer of the mature virion. The lower, alpha-helical domains of VP7 interact with VP3 molecules which form the inner layer of the BTV core. Adjacent VP7 trimer-trimer interactions in the T = 13 layer are mediated principally through well-defined regions in the broader lower domains, to form a structure that conforms well with that expected from the theory of quasi-equivalence with no significant conformational changes within the individual trimers. The VP3 layer determines the particle size and forms a rather smooth surface upon which the two-dimensional lattice of VP7 trimers is laid down.

Bluetongue virus↗
PubMed1981

Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

DNA-Directed RNA Polymerases↗
PubMed2006

Role of RNA helicases in HIV-1 replication.

Viruses are replication competent genomes which are relatively gene-poor. Even the largest viruses (i.e. Herpesviruses) encode only slightly >200 open reading frames (ORFs). However, because viruses replicate obligatorily inside cells, and considering that evolution may be driven by a principle of economy of scale, it is reasonable to surmise that many viruses have evolved the ability to co-opt cell-encoded proteins to provide needed surrogate functions. An in silico survey of viral sequence databases reveals that most positive-strand and double-stranded RNA viruses have ORFs for RNA helicases. On the other hand, the genomes of retroviruses are devoid of virally-encoded helicase. Here, we review in brief the notion that the human immunodeficiency virus (HIV-1) has adopted the ability to use one or more cellular RNA helicases for its replicative life cycle.

Antiviral Agents↗
PubMed1998

Mak21p of Saccharomyces cerevisiae, a homolog of human CAATT-binding protein, is essential for 60 S ribosomal subunit biogenesis.

Mak21-1 mutants are unable to propagate M1 double-stranded RNA, a satellite of the L-A double-stranded RNA virus, encoding a secreted protein toxin lethal to yeast strains that do not carry M1. We cloned MAK21 using its map location and found that Mak21p is homologous to a human and mouse CAATT-binding protein and open reading frames in Schizosaccharomyces pombe and Caenorhabditis elegans. Although the human protein regulates Hsp70 production, Mak21p is essential for growth and necessary for 60 S ribosomal subunit biogenesis. mak21-1 mutants have decreased levels of L-A coat protein and L-A double-stranded RNA. Electroporation with reporter mRNAs shows that mak21-1 cells cannot optimally express mRNAs which, like L-A viral mRNA, lack 3'-poly(A) or 5'-cap structures but can normally express mRNA with both cap and poly(A). The virus propagation phenotype of mak21-1 is suppressed by ski2 or ski6 mutations, each of which derepresses translation of non-poly(A) mRNA.

Amino Acid Sequence↗
PubMed1998

Generation of the short RNA transcript in Leishmaniavirus correlates with the growth of its parasite host, Leishmania.

Leishmaniavirus 1 is a double-stranded RNA virus that infects the New World kinetoplastid parasites, Leishmania braziliensis, and Leishmania guyanensis. The isolated virus particles contain an RNA-dependent RNA polymerase which exhibits both transcriptase activity for genome-length plus-strand synthesis and replicase activity for genome-length minus-strand synthesis. Recently, we identified a 320 nucleotide short RNA transcript of Leishmaniavirus 1-4, derived from the 5' end of the viral plus-strand, which is generated by the virus capsid via site-specific cleavage of the full-length positive single-stranded RNA. We have hypothesized that this short RNA transcript functions to regulate the virus life cycle during the growth of its parasite host, Leishmania guyanensis. To address this hypothesis, we measured the relative amount of short RNA transcripts and the absolute number of viral genomes per infected cell from log through stationary phase of the parasite growth cycle. In vitro assays of the viral polymerase showed an overall increase in viral polymerase activity from log growth into stationary phase which mirrored an in vivo increase in the quantity of double-stranded genome as measured by agarose gel electrophoresis. We have developed competitive reverse transcription-polymerase chain reaction (RT-PCR) assays to measure the relative amounts of viral transcripts in infected cells as well as the number of viral genomes per infected cell. The results of these assays show that the amount of full-length virus transcripts peaks in the parasite stationary phase (132 transcripts per cell), and that the short transcript is most abundant in the early stationary phase cells (24 transcripts per cell).

Animals↗
PubMed1996

Inhibitors of infectious pancreatic necrosis virus (IPNV) replication.

In attempts to detect inhibitors of infectious pancreatic necrosis virus (IPNV) replication, we have evaluated, by an IPNV plaque inhibition assay, a group of compounds that have broad spectrum antiviral activity for both single- and double-stranded RNA viruses. The inosine monophosphate dehydrogenase (IMP dehydrogenase) inhibitors 1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide (ribavirin) and 5-ethynyl-1-beta-D-ribofuranosylimidazole-4-carboxamide (EICAR), and the orotidine monophosphate decarboxylase (OMP decarboxylase) inhibitor 4-hydroxy-3-beta-D-ribofuranosylpyrazole-5-carboxamide (pyrazofurin), were found to inhibit IPNV replication. For EICAR and pyrazofurin the concentrations that inhibited the IPNV plaque formation by 50% (EC50) were 0.01 micrograms/ml and 0.5 micrograms/ml, respectively. The cytotoxic concentrations required to reduce cell viability by 50% (CC50) were 50 micrograms/ml and 100 micrograms/ml, respectively, and the concentrations that reduced [methyl-3H] thymidine incorporation by 50% (IC50) were 0.5-1 and 50 micrograms/ml. Thus, for both compounds the IPNV-inhibitory concentration was 50-100 times lower than the concentration that affected DNA synthesis in growing cells. EICAR and pyrazofurin seem to be good candidates for further evaluation in an in vivo model of IPNV infection.

Adenosine↗
PubMed1995

Virus-mediated expression of firefly luciferase in the parasitic protozoan Giardia lamblia.

Giardia lamblia, a prevalent human pathogen and one of the lineages that branched earliest from prokaryotes, can be infected with a double-stranded RNA virus, giardiavirus (GLV). The 6,277-bp viral genome has been previously cloned (A.L. Wang, H.-M. Yang, K.A. Shen, and C.C. Wang, Proc. Natl. Acad. Sci. USA 90:8595-8599, 1993; C.-H. Wu, C.C. Wang, H.M. Yang, and A.L. Wang, Gene, in press) and was converted to a transfection vector for G. lamblia in the present study. By flanking the firefly luciferase gene with the 5' and 3' untranslated regions (UTRs) of the GLV genome, transcript of the construct was synthesized in vitro with T7 polymerase and used to transfect G. lamblia WB trophozoites already infected with GLV (WBI). Optimal electroporation conditions used for the transfection were set at 1,000 V/cm and 500 microF, which resulted in expression of significant luciferase activity up to 120 h after electroporation. Furthermore, the mRNA and the antisense RNA of the luciferase gene were both detected by reverse transcription and PCR from 6 to 120 h postelectroporation, whereas no antisense RNA of luciferase was observed in the electroporated virus-free Giardia WB trophozoites. The mRNA of luciferase was detectable in the virus-free trophozoites by reverse transcription and PCR only up to 20 h after the electroporation, indicating that the introduced mRNA was replicated only by the viral RNA-dependent RNA polymerase inside the WBI cells. This expression of luciferase was dependent on the presence of UTRs on both ends of the viral genome transcript, including a putative packaging site that was apparently indispensable for luciferase expression. This is the first time that a viral vector in the form of mRNA URTs has been successfully used in transfecting a protozoan.

Animals↗
PubMed2000

Replicase activity of purified recombinant protein P2 of double-stranded RNA bacteriophage phi6.

In nature, synthesis of both minus- and plus-sense RNA strands of all the known double-stranded RNA viruses occurs in the interior of a large protein assembly referred to as the polymerase complex. In addition to other proteins, the complex contains a putative polymerase possessing characteristic sequence motifs. However, none of the previous studies has shown template-dependent RNA synthesis directly with an isolated putative polymerase protein. In this report, recombinant protein P2 of double-stranded RNA bacteriophage phi6 was purified and demonstrated in an in vitro enzymatic assay to act as the replicase. The enzyme efficiently utilizes phage-specific, positive-sense RNA substrates to produce double-stranded RNA molecules, which are formed by newly synthesized, full-length minus-strands base paired with the plus-strand templates. P2-catalyzed replication is also shown to be very effective with a broad range of heterologous single-stranded RNA templates. The importance and implications of these results are discussed.

Amino Acid Sequence↗
PubMed1977

Transcription of double-stranded RNA by Escherichia coli DNA-dependent RNA polymerase.

Double-stranded RNA of some virus genomes can be used as template for the DNA-dependent RNA polymerase purified from Escherichia coli. The RNA synthesis requires all four nucleoside triphosphates and manganese ions and is dependent on the presence of sigma subunit. The reaction is inhibited by rifampicin, streptolydigin and ethidium bromide, but not by DNase and actinomycin D which does not bind to double-stranded RNA. The template activity of double-stranded RNA from various viruses is different in each case. The order of template efficiency is Penicillum chrysogenum virus greater than cytoplasmic polyhedrosis virus greater than rice dwarf virus greater than reovirus. The product obtained using cytoplasmic polyhedrosis virus double-stranded RNA as template is single-stranded and hybridizes specifically to the denatured template RNA. One of the major 5'-starting nucleotide sequences of the product RNA is pppA-A-Y--. These results indicate that transcription in vitro of double-stranded RNA by E. Coli RNA polymerase is initiated at specific sites on the template.

Animals↗
PubMed1998

Apoptosis precedes necrosis of fish cell line with infectious pancreatic necrosis virus infection.

The current view of infectious pancreatic necrosis virus (IPNV) infection includes a necrotic process that relies primarily on the histological appearance of tissue after the degenerative process. We tested this view by examining the possibility that apoptosis is a component of double-stranded RNA virus (IPNV) that induces fish embryonic cell death. Four kinds of assays for apoptosis were used in analyzing IPNV-infected CHSE-214 cells: (1) assay with terminal deoxynucleotidyl transferase (TdT)-mediated end-labeling of DNA in nuclei of intact cells during virus infection, (2) assay for procoagulant activity, (3) assay for DNA ladders, and (4) electron microscopic assays for the ultrastructural changes in characteristic apoptotic cells. In all p.i. samples, both low and high m.o.i. groups contained apoptotic nuclei, according to TdT-mediated dUTP labeling of intact cells, but in control CHSE-214 cells, apoptotic nuclei were rare at all levels of incubation sampled by TdT-mediated dUTP labeling. Prenecrotic or postnecrotic cells were found to express phosphatidylserine on the surface by annexin V-FITC labeling, but normal cells did not. DNAs from both 4 h p.i. of high m.o.i. and 8 h p.i. of low m.o.i. were found to be cleaved into fragments indicative of preferential cleavage at internucleosomal sites. The IPNV-infected CHSE-214 cells were analyzed with an electron microscope and showed a pattern of ultrastructural change, indicating that apoptosis appears before pathological changes of necrosis, including condensed chromatin, fragmented nuclei, nuclei with chromatin marginations, and secondary necrosis from prenecrotic cells in IPNV-infected CHSE-214 cells. Together, these findings show that apoptosis precedes any detectable necrotic change in CHSE-214 cells that is currently viewed as necrosis. Thus, apoptosis characterizes the onset of pathology in host cells and is followed by necrotic processes.

Animals↗
PubMed1995

Synthetic lethality of sep1 (xrn1) ski2 and sep1 (xrn1) ski3 mutants of Saccharomyces cerevisiae is independent of killer virus and suggests a general role for these genes in translation control.

Strand exchange protein 1 (Sep1) (also referred to as exoribonuclease I [Xrn1]) from Saccharomyces cerevisiae has been implicated in DNA recombination, RNA turnover, karyogamy, and G4 DNA pairing among other disparate cellular processes. Using a genetic approach to study the role of SEP1/XRN1 in mitotic yeast cells, we identified mutations in the genes superkiller 2 (SKI2) and superkiller 3 (SKI3) as synthetically lethal with an sep1 null mutation. The SKI genes are thought to comprise an intracellular antiviral system controlling the expression of killer toxin from double-stranded RNA virus found in many yeast strains. However, the lethality of sep1 ski2 and sep1 ski3 mutants was independent of the L-A and M viruses, suggesting that the SKI genes act in a general cellular process in addition to virus control. We propose that Sep1/Xrn1 and Ski2 both act to block translation on transcripts targeted for degradation. Using a temperature-sensitive allele of SEP1/XRN1, we show that double mutants display a synthetic cell cycle arrest in late G1 at Start.

Base Sequence↗
PubMed1980

[Viruses and gastroenteritis (author's transl)].

In recent years it has been demonstrated that a group of viruses, Rotavirus for the children and Norwalk agent for adults, are a highly significant cause of acute gastroenteritis during the months of winter ("winter vomiting disease"). The Rotavirus was identified by Bishop et al. as a double-stranded RNA virus that can be isolate from faeces of children with acute gastroenteritis. Viral gastroenteritis is an autolimitate disease, although under certain conditions it may even lead to severe disease and death by profound dehydration and electrolyte imbalance; it is characterized by nausea, vomiting, diarrhea and others minor symptoms. This entity only affects children between 3 months and 6 years of age, with a little prevalence for the males. Breast-fed babies are commonly thought to be less likely than artificial-fed babies to suffer from infective diarrhea. Rotavirus infection is also known to occur in parents of infected children, but in this situation the symptoms are generally mild or absent and they needn't medical attention. The Rotavirus invade mainly the epithelium of the proximal intestine where they make a cytopatic and physiologic alteration (deficience in Na and K-ATPsa activity) that determines a disturbances of water and electrolyte transport across the epithelium thus contribute to the diarrhea. The best methods for detecting this type of viral gastroenteritis are electron microscopy and, specialy, the complement fixation test. In this moment we have not specific therapy for this new disease but because its epidemiological importance it must be in all clinical minds.

Adult↗
PubMed1991

Identification in porcine faeces of a novel virus with a bisegmented double stranded RNA genome.

Polyacrylamide gel electrophoresis of nucleic acids extracted from porcine faecal samples revealed in several samples the presence of two discrete bands. The bands were resistant to digestion with of DNase I and RNase T1, but not with RNase A in low salt conditions, indicating that they consisted of double stranded (ds) RNA. The two bands from different samples varied in sizes, in a range between 2.4-2.6 kbp and 1.7-1.9 kbp for the slow and fast moving band respectively. The bands cosedimented in CsCl gradients at an average density of 1.415 g/ml with icosahedral virus particles of a diameter of 34 nm and a triangulation number equal to 3. Aggregates of virus, which appeared to be immunocomplexes, were seen in one sample. From 244 faecal samples collected in one farm, 27 (11.1%) were found to contain the characteristic dsRNA pattern, with a higher prevalence in samples from animals 15 to 35 days old. The agent was equally distributed among samples from diarrhoeic or non-diarrhoeic animals. These results confirm the circulation among pigs of a novel virus, possibly of vertebrates, with a bisegmented double stranded RNA genome, similar to viruses previously described in humans, wild rats, guinea pigs, pigs, and chickens, for which the name "picobirnavirus" has been proposed.

Animals↗
PubMed1996

Polycistronic (tri- or bicistronic) phytoreoviral segments translatable in both plant and insect cells.

Genomic segment S12 of rice dwarf virus and segment S9 of wound tumor virus, both members of the genus Phytoreovirus, have small out-of-phase overlapping open reading frames (ORFs). Western blot (immunoblot) analysis revealed that rice dwarf virus S12 mRNA specified translation products from the large ORF and two overlapping small ORFs both in rice plant hosts and in Spodoptera frugiperda insect cells. These results provide the first example of a tricistronic mRNA for a segmented double-stranded RNA virus. Similarly, wound tumor virus S9 mRNA was found to direct the synthesis of protein products from both the large ORF and small out-of-frame ORF in S. frugiperda cells. Results of site-specific and deletion mutagenesis studies were consistent with a leaky scanning translation mechanism for the synthesis of the small ORFs.

Animals↗