Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “viral noncoding RNA”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 217 records · Page 12Linked to original sources
PubMed1997

Genotypic distribution of hepatitis C virus in different regions of Thailand.

The genotypic distribution of hepatitis C virus (HCV) isolated from blood donors from four major regions of Thailand was studied by reverse hybridization assays. PCR-amplified products from the 5' noncoding and core regions of the viral genome were hybridized to genotype- and subtype-specific probes which were immobilized on the nitrocellulose membrane. Of 332 anti-HCV-positive plasma samples studied, 71% contained HCV RNA. HCV genotype 3a was the most prevalent genotype (39%), followed by genotype 1b (20%) and genotype 6 group variants (18%). HCV genotype 1a was identified among 9% of all isolates. Other genotypes (genotype 1 which was neither 1a nor 1b, genotype 3b, and an unclassified genotype) were uncommon. There was no difference in the mean age of the donors infected with different HCV genotypes. The genotypic distribution pattern of HCV was similar among HCV isolates from different regions of Thailand.

Genes, Viral↗
PubMed2005

The p92 polymerase coding region contains an internal RNA element required at an early step in Tombusvirus genome replication.

The replication of positive-strand RNA viral genomes involves various cis-acting RNA sequences. Generally, regulatory RNA sequences are present at or near genomic termini; however, internal replication elements (IREs) also exist. Here we report the structural and functional characterization of an IRE present in the readthrough portion of the p92 polymerase gene of Tomato bushy stunt virus. Analysis of this element in the context of a noncoding defective interfering RNA revealed a functional core structure composed of two noncontiguous segments of sequence that interact with each other to form an extended helical conformation. IRE activity required maintenance of several base-paired sections as well as two distinct structural features: (i) a short, highly conserved segment that can potentially form two different and mutually exclusive structures and (ii) an internal loop that contains a critical CC mismatch. The IRE was also shown to play an essential role within the context of the viral genome. In vivo analysis with novel RNA-based temperature-sensitive genomic mutants and translationally active subgenomic viral replicons revealed the following about the IRE: (i) it is active in the positive strand, (ii) it is dispensable late in the viral RNA replication process, and (iii) it is functionally inhibited by active translation over its sequence. Together, these results suggest that IRE activity is required in the cytosol at an early step in the viral replication process, such as template recruitment and/or replicase complex assembly.

Amaranthaceae↗
PubMed1989

Poliovirus translation: a paradigm for a novel initiation mechanism.

All eukaryotic cellular mRNAs, and most viral mRNAs, are blocked at their 5' ends with a cap structure (m7GpppX, where X is any nucleotide). Poliovirus, along with a small number of other animal and plant viral mRNAs, does not contain a 5' cap structure. Since the cap structure functions to facilitate ribosome binding to mRNA, translation of polio-virus must proceed by a cap-independent mechanism. Consistent with this, recent studies have shown that ribosomes can bind to an internal region within the long 5' noncoding sequence of poliovirus RNA. Possible mechanisms for cap-independent translation are discussed. Cap-independent translation of poliovirus RNA is of major importance to the mechanism of shut-off of host protein synthesis after infection. Moreover, it is likely to play a role in determining poliovirus neurovirulence and attenuation.

Humans↗
PubMed1990

Molecular cloning and complete nucleotide sequence of the attenuated rabies virus SAD B19.

Complementary DNA spanning the entire genome of the attenuated rabies virus strain SAD B19 which is used for oral immunization of foxes in Europe was cloned and sequenced. The viral genome comprises 11,928 nucleotides and encodes the five viral proteins N, NS, M, G, and L. Deduced protein sequences are highly similar to those of the pathogenic PV strain, homologies ranging from 90.6% for the M to 98.6% for the L protein. The five cistrons are separated by intergenic regions of 2, 5, 5, and 24 nucleotides, respectively. The G transcription stop/polyadenylation consensus signal in SAD B19 is destroyed by a deletion of three A residues. The strong conservation of both noncoding and coding nucleotide sequences indicates a high selective pressure on the primary structure of rabies virus genomic RNA.

Amino Acid Sequence↗
PubMed2005

Sensitivity of brome mosaic virus RNA1 replication to mutations in the 3' tRNA-like structure implies a requirement for sustained synthesis of replicase protein 1a.

The replication competence of a series of brome mosaic virus (BMV) RNA1 variants with defined mutations in the 3' tRNA-like structure, previously characterized in vitro to be defective in minus-strand synthesis and several tRNA-associated functions, was analyzed in barley protoplasts. Inocula containing wild type RNAs2 and 3 and RNA1 bearing either Deltaknob or 5'Psk mutation failed to replicate. Two additional RNA1 variants, each bearing either M4 or 5'AGA mutation, resulted in detectable accumulation of progeny but are inhibitory to overall viral replication when supplied in high concentrations. Another aminoacylation-defective mutation Delta5' supported viral replication but did not interfere with viral replication even at higher concentrations. Coinoculation of replication-incompetent variants of RNAl with wt RNAs2 and 3 to Chenopodium hybridum plants resulted in the delayed development of local necrotic lesions characteristic of a wt infection. Sequence analysis of progeny RNA recovered from these lesions indicated that, in each case, a functional 3' noncoding sequence was restored due to homologous recombination with a corresponding sequence from wt RNA3. Taken together the results suggest that, unlike protein 2a which is required in catalytic amounts, the intrinsic involvement of protein 1a at various stages of virus infection cycle demands its sustained synthesis.

3' Untranslated Regions↗
PubMed2003

Improved detection of rhinoviruses by nucleic acid sequence-based amplification after nucleotide sequence determination of the 5' noncoding regions of additional rhinovirus strains.

The isothermal nucleic acid sequence-based amplification (NASBA) system was applied for the detection of rhinoviruses using primers targeted at the 5' noncoding region (5' NCR) of the viral genome. The nucleotide sequence of the 5' NCRs of 34 rhinovirus isolates was determined to map the most conserved regions and design more appropriate primers and probes. The assay amplified RNA extracted from 30 rhinovirus reference strains and 88 rhinovirus isolates, it did not amplify RNA from 49 enterovirus isolates and other respiratory viruses. The assay allows one to discriminate between group A and B rhinoviruses. Sensitivities for the detection of group B and group A rhinoviruses was 20 and 200 50% tissue culture infective doses, respectively.

5' Untranslated Regions↗
PubMed1992

Conservation of RNA-protein interactions among picornaviruses.

Picornavirus genomes encode unique 5' noncoding regions (5' NCRs) which are approximately 600 to 1,300 nucleotides in length, contain multiple upstream AUG codons, and display the ability to form extensive secondary structures. A number of recent reports have shown that picornavirus 5' NCRs are able to facilitate cap-independent internal initiation of translation. This mechanism of translation occurs in the absence of viral gene products, suggesting that the host cell contains the necessary components for the cap-independent internal initiation of translation of picornavirus RNAs as well as cellular mRNAs. In an attempt to identify some of the perhaps novel cellular proteins involved in this newly discovered mechanism of translation, we utilized RNA mobility shifts assays to identify and characterize interactions that occur between the 5'NCR of poliovirus type 1 (PV1) and cellular proteins. In this report, we describe two separate interactions between RNA structures from the 5' NCR of PV1 and proteins present in extracts from HeLa cells as well as other cell types. We describe the interaction between nucleotides 186 to 220 (stem-loop D) and a cellular protein(s) present in HeLa cell extracts. Mutational analysis of this stem-loop structure suggests that maintenance of a base-paired structure in the lower stem is necessary to present the sequences which directly interact with the protein(s). We also describe the interaction between nucleotides 220 to 460 (stem-loop E) and a cellular protein present in HeLa cell extracts. This RNA binding activity fractionates to a specific ammonium sulfate fraction (A cut) of a ribosomal salt wash. Mutational analysis of the stem-loop E structure suggests that the preservation of an extensive RNA structure is necessary for a strong interaction with the cellular protein(s), although smaller RNAs derived from this region of the 5' NCR can interact to lesser extents. Finally, we show that both of these RNA-protein interactions are conserved among the closely related enteroviruses PV1 and coxsackievirus type B3, human rhinovirus type 14, and the more distantly related cardiovirus Theiler's murine encephalomyelitis virus, suggesting that such RNA-protein interactions serve basic functions which are conserved and utilized by each of these picornaviruses.

Base Sequence↗
PubMed1986

Engineering of the mRNA-interfering complementary RNA immune system against viral infection.

Creation of an artificial mRNA-interfering complementary RNA (micRNA) immune system, utilizing anti-sense RNAs to inhibit viral gene expression, has been shown to be an effective way to prevent viral infection. In the RNA coliphage SP, the gene for the maturation protein was found to be the best target for this type of immune system; mRNA-interfering complementary RNAs specific to the genes for coat protein and replicase were less effective in preventing infection. The greatest inhibitory effect was observed with a 240-base sequence encompassing the 24-base noncoding region of the maturation gene plus the 216-base coding sequence. Significantly, even a 19-base sequence covering only the Shine-Dalgarno sequence (ribosome-binding region) without the coding region exerted a strong inhibitory effect on phage proliferation. In contrast to the highly specific action against phage SP exhibited by the longer mRNA-interfering complementary RNA, the specificity with the shorter mRNA-interfering complementary RNA was broadened to phages Q beta and GA as well as SP, all of which are classified in the different groups of RNA coliphages. Therefore, this type of anti-viral reagent may be designed to have a particular breadth of specificity, thus increasing its value in various research and possibly clinical applications.

Base Sequence↗
PubMed2000

A mutant allele of essential, general translation initiation factor DED1 selectively inhibits translation of a viral mRNA.

Positive-strand RNA virus genomes are substrates for translation, RNA replication, and encapsidation. To identify host factors involved in these functions, we used the ability of brome mosaic virus (BMV) RNA to replicate in yeast. We report herein identification of a mutation in the essential yeast gene DED1 that inhibited BMV RNA replication but not yeast growth. DED1 encodes a DEAD (Asp-Glu-Ala-Asp)-box RNA helicase required for translation initiation of all yeast mRNAs. Inhibition of BMV RNA replication by the mutant DED1 allele (ded1-18) resulted from inhibited expression of viral polymerase-like protein 2a, encoded by BMV RNA2. Inhibition of RNA2 translation was selective, with no effect on general cellular translation or translation of BMV RNA1-encoded replication factor 1a, and was independent of p20, a cellular antagonist of DED1 function in translation. Inhibition of RNA2 translation in ded1-18 yeast required the RNA2 5' noncoding region (NCR), which also conferred a ded1-18-specific reduction in expression on a reporter gene mRNA. Comparison of the similar RNA1 and RNA2 5' NCRs identified a 31-nucleotide RNA2-specific region that was required for the ded1-18-specific RNA2 translation block and attenuated RNA2 translation in wild-type yeast. Further comparisons and RNA structure predictions suggest a modular arrangement of replication and translation signals in RNA1 and RNA2 5' NCRs that appears conserved among bromoviruses. The 5' attenuator and DED1 dependence of RNA2 suggest that, despite its divided genome, BMV regulates polymerase translation relative to other replication factors, just as many single-component RNA viruses use translational read-through and frameshift mechanisms to down-regulate polymerase. The results show that a DEAD-box helicase can selectively activate translation of a specific mRNA and may provide a paradigm for translational regulation by other members of the ubiquitous DEAD-box RNA helicase family.

Base Sequence↗
PubMed1977

Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.

Base Sequence↗
PubMed2001

Overcoming host- and pathogen-mediated resistance in tomato and tobacco maps to the M RNA of Tomato spotted wilt virus.

A viral genetic system was used to map the determinants of the ability of Tomato spotted wilt virus (TSWV) to overcome the R gene (Sw-5) in tomato and the resistance conferred by the nucleocapsid gene of TSWV (N gene) in tobacco. A complete set of reassortant genotypes was generated from TSWV isolates A and D. TSWV-A was able to overcome the Sw-5 gene in tomato and the TSWV N gene in tobacco, whereas TSWV-D was repressed by both forms of resistance. The ability to overcome both forms of resistance was associated with the M RNA segment of TSWV-A (M(A)). Overcoming the Sw-5 gene was linked solely to the presence of M(A), and the ability of M(A) to overcome the TSWV N gene was modified by the L RNA and the S RNA of TSWV-A, which is consistent with previous reports that suggest that the nucleocapsid gene is not the primary determinant for overcoming the nucleocapsid-mediated resistance. Sequence analysis of the M RNA segment of TSWV-A, -D, and the type isolate BR-01 revealed multiple differences in the coding and noncoding regions, which prevented identification of the resistance-breaking nucleotide sequences.

Bunyaviridae↗
PubMed1992

Comparative molecular biology of flaviviruses and hepatitis C virus.

Currently available sequence information suggests that the genome organization of hepatitis C virus is similar to that of flaviviruses. A positive-stranded genomic RNA contains a single long open reading frame (ORF) which is flanked by 5' and 3' noncoding sequences. This RNA codes for structural proteins at the 5' end (starting with the capsid protein) and a set of nonstructural proteins in the remainder of the genome. The latter provide essential virus-specific functions for the viral life cycle, such as protease, helicase, and RNA replicase activities. The sequence motifs characteristic of the corresponding functional protein domains are separated by similar spacings in the nonstructural regions of hepatitis C virus and flaviviruses. The structural region of the hepatitis C virus appears to consist of a capsid protein which is larger than that of flaviviruses and two putative envelope proteins which are presumably different in molecular weight and much more heavily glycosylated than their counterparts in flaviviruses. A study group of the International Committee on the Taxonomy of viruses proposes to include hepatitis C virus as a genus into the family 'flaviviridae'.

Amino Acid Sequence↗
PubMed1989

Determinants in the 5' noncoding region of poliovirus Sabin 1 RNA that influence the attenuation phenotype.

A number of recombinants between the virulent Mahoney and attenuated Sabin strains of type 1 poliovirus were constructed by using infectious cDNA clones of the two strains. To identify a strong neurovirulence determinant(s) residing in the genome region upstream of nucleotide position 1122, these recombinant viruses were subjected to biological tests, including monkey neurovirulence tests. The results of the monkey neurovirulence tests suggested the important contribution of an adenine residue (Mahoney type) at position 480 to the expression of the neurovirulence phenotype of type 1 poliovirus. This nucleotide, however, had only a minor effect, if any, on viral temperature sensitivity. Monkey neurovirulence tests on the recombinant virus whose genome had a guanine residue (Sabin type) at position 480 and variants generated from this recombinant virus in the central nervous system of monkeys strongly suggested that only one nucleotide change, from adenine to guanine, was not sufficient for full expression of the attenuation phenotype encoded by this genome region. These results suggest that the expression of the attenuation phenotype depends on the highly ordered structure formed in the 5' noncoding sequence and that the formation of such a structure is possibly influenced by the nucleotide at position 480. Furthermore, in vitro biological tests performed on viruses recovered from the central nervous system of monkeys injected with a temperature-sensitive recombinant virus showing the small-plaque and d phenotypes revealed that most of the recovered viruses had even higher temperature sensitivities and that all of the recovered viruses that had acquired the large-plaque phenotype had lost the d phenotype to some extent. These results indicate that there may be an unknown selection pressure(s) in the central nervous system and that common determinants might be involved in the expression of the small-plaque and d phenotypes.

Animals↗
PubMed1990

Attenuation of Mengo virus through genetic engineering of the 5' noncoding poly(C) tract.

The murine cardioviruses, such as the Mengo and encephalomyocarditis viruses, and the bovine aphthoviruses, such as foot-and-mouth disease virus, are distinguished among positive-strand RNA viruses by the presence of long homopolymeric poly(C) tracts within their 5' noncoding sequences. Although the specific lengths (60-350 bases) and sequence discontinuities (for example, uridine residues) that sometimes disrupt the homopolymer have served to characterize natural viral isolates, the biological function of the poly(C) region has never been clear. We now report that complementary DNA-mediated truncation of the Mengo virus poly(C) tract dramatically attenuates the pathogenicity of the virus in mice. Animals injected with viruses with short tracts not only survived inoculation of up to 50 micrograms live virus (10(11) plaque-forming units) but consistently produced high titres of neutralizing antibodies, which conferred long-term immunogenic protection from (normally) lethal virus challenge. We propose that analogous synthetic strains of foot and mouth disease virus could serve as the basis for new attenuated vaccines.

Animals↗
PubMed1987

Characterization of a transcriptional promoter of human papillomavirus 18 and modulation of its expression by simian virus 40 and adenovirus early antigens.

RNA present in cells derived from cervical carcinoma that contained human papillomavirus 18 genomes was initiated in the 1.053-kilobase BamHI fragment that covered the complete noncoding region of this virus. When cloned upstream of the chloramphenicol acetyltransferase gene, this viral fragment directed the expression of the bacterial enzyme only in the sense orientation. Initiation sites were mapped around the ATG of open reading frame E6. This promoter was active in some human and simian cell lines, and its expression was modulated positively by simian virus 40 large T antigen and negatively by adenovirus type 5 E1a antigen.

Acetyltransferases↗
PubMed1983

Molecular cloning and characterization of hepatitis A virus cDNA.

Double-stranded cDNA was synthesized from hepatitis A virus (HAV) RNA and inserted into the Pst I site of pBR322. Restriction endonuclease digestion and cross-hybridization of fragments yielded a map of overlapping cloned cDNAs that included at least 99% of the viral genome. Molecular clones containing HAV cDNA were identified by hybridizing cloned cDNA to electrophoretically resolved RNA from uninfected and HAV-infected tissue culture cells. Cloned cDNA probes specifically hybridized to RNA from infected cells, and the predominant species identified had the characteristic genomic length of picornaviral RNA (approximately equal to 7,500 nucleotides). A partial sequence from the 3' end of the genome revealed 414 bases in an open reading frame followed by two closely spaced stop codons, a 60-base noncoding region, and a tract of poly(A).

Amino Acid Sequence↗
PubMed1991

De novo generation of defective interfering RNAs of tomato bushy stunt virus by high multiplicity passage.

Defective interfering (DI) RNAs were generated de novo in each of 12 independent isolates of tomato bushy stunt virus (TBSV) upon serial passage at high multiplicities of infection (m.o.i.) in plants, but not in any of 4 additional isolates after 11 serial passages at low m.o.i. The DI RNAs were detected in RNA isolated from virus particles and in 2.3 M LiCl-soluble RNA fractions isolated from inoculated leaves. Symptom attenuation leading to persistent infections was closely correlated with the passage in which DIs first developed. Comparisons of nucleotide sequences of 10 cDNA clones from 2 DI RNA populations and with a previously characterized TBSV DI RNA revealed the same four regions of sequence from the TBSV genome were strictly conserved in each of the DI RNAs: the virus 5' leader sequence of 168 bases; a region of approximately 200-250 bases from the viral polymerase gene; approximately 70 bases from the 3' terminus of the viral p19 and p22 genes; and approximately 130 bases from the 3' terminal noncoding region. Conservation of the sequence motif present in all of the DIs suggests that there might be a common mechanism of DI formation as well as selection pressure to maintain sequences essential for replication and encapsidation.

Base Sequence↗