Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “Leukemia Inhibitory Factor Receptor alpha Subunit”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 217 records · Page 12Linked to original sources
PubMed1998

Neural precursor differentiation into astrocytes requires signaling through the leukemia inhibitory factor receptor.

The differentiation of precursor cells into neurons or astrocytes in the developing brain has been thought to be regulated in part by growth factors. We show here that neural precursors isolated from the developing forebrain of mice that are deficient in the gene for the low-affinity leukemia inhibitory factor receptor (LIFR-/-) fail to generate astrocytes expressing glial fibrillary acidic protein (GFAP) when cultured in vitro. Precursors from mice heterozygous for the null allele show normal levels of GFAP expression. These findings support the in vivo findings that show extremely low levels of GFAP mRNA in brains of embryonic day 19 LIFR-/- mice. In addition, monolayers of neural cells from LIFR-/- mice are far less able to support the neuronal differentiation of normal neural precursors than are monolayers from heterozygous or wild-type animals, indicating that endogenous signaling through the LIFR is required for the expression of both functional and phenotypic markers of astrocyte differentiation. LIFR-/- precursors are not irreversibly blocked from differentiating into astrocytes: they express GFAP after long-term passaging or stimulation with bone morphogenetic protein-2. These findings strongly implicate the LIF family of cytokines in the regulation of astrocyte differentiation and indeed the LIF-deficient animals show a significant reduction in the number of GFAP cells in the hippocampus. However, because this reduction is only partial it suggests that LIF may not be the predominant endogenous ligand signaling through the LIFR.

Animals↗
PubMed1996

Molecular basis of the soluble and membrane-bound forms of the murine leukemia inhibitory factor receptor alpha-chain. Expression in normal, gestating, and leukemia inhibitory factor nullizygous mice.

The murine leukemia inhibitory factor receptor alpha-chain (mLIFR) exists in a membrane-bound and a soluble form. The two major classes of mRNA transcript correspond to either the soluble or membrane-bound form of the mLIFR. In this study we have identified a complex and heterogeneous pattern of expression of mRNA transcripts for this receptor in normal mouse tissues and cell lines. In order to understand the molecular basis of these transcripts, genomic clones encompassing the region of divergence from the soluble to the membrane-bound form of the receptor were isolated. cDNAs encoding the membrane-bound form of the mLIFR were generated by an alternative splicing event where an exon that is specific to the soluble mLIFR was skipped. The membrane-bound form of the mLIFR was heterogeneously polyadenylated with at least five different sites of polyadenylation. The mRNA transcript encoding the soluble form of the mLIFR contained a region highly homologous to a murine B2 repetitive element, thus providing a possible explanation for the genesis of this transcript. The different forms of the mLIFR were analyzed in a wide range of mouse tissues in pseudopregnant mice and in mice at various stages of pregnancy. Only liver, placenta, and uterus showed an increase in the levels of mLIFR mRNA expression during pregnancy, indicating an important role for the LIFR in this process. However, somewhat surprisingly, there was no detectable difference in mLIFR mRNA levels or levels of soluble protein in leukemia inhibitory factor nullizygous mice when compared with normal mice.

Animals↗
PubMed1996

Characterization of the receptor binding sites of human leukemia inhibitory factor and creation of antagonists.

Residues in human leukemia inhibitory factor (hLIF) crucial for binding to both the human LIF receptor (R) and gp130 were identified by analysis of alanine scanning mutants of hLIF in assays for both receptor binding and bioactivity. The region of hLIF most important for binding to the hLIF-R is composed of residues from the amino terminus of the D-helix, carboxyl terminus of the B-helix, and C-D loop. This site forms a distinct surface at the end of the four-helix bundle in the tertiary structure of the closely related murine LIF. The two residues of hLIF that contribute the majority of free energy for hLIF-R binding, Phe-156 and Lys-159 are surrounded by other residues which have only a moderate impact. This arrangement of a few key residues surrounded by less important ones is analogous to the functional binding epitope of human growth hormone for its receptor. A second region of hLIF that includes residues from the carboxyl terminus of the D-helix and A-B loop also had a weak influence on hLIF-R binding. Residues in hLIF from both the A- and C-helices are involved in binding the gp130 co-receptor. Abolition of the gp130 binding site in hLIF created antagonists of LIF action.

Amino Acid Sequence↗
PubMed1997

Signaling of type II oncostatin M receptor.

Oncostatin M (OSM) mediates its bioactivities through two different heterodimer receptors. They both involve the gp130-transducing receptor, which dimerizes with either leukemia inhibitory receptor beta or with OSM receptor beta (OSMRbeta) to generate, respectively, type I and type II OSM receptors. Co-precipitation of gp130-associated proteins, flow cytometry, polymerase chain reaction, and tyrosine phosphorylation analyses allowed the characterization of both types of OSM receptors expressed on the surface of different cell lines. It also allowed the detection of a large size protein, p250, that specifically associates to the type II OSM receptor components and that is tyrosine-phosphorylated after the activation peak of the gp130.OSMRbeta heterocomplex. The restricted expression of type I OSM receptor by the JAR choriocarcinoma cell line, and type II receptor by the A375 melanoma cell line, permitted the characterization of their signaling machineries. Both type I and type II OSM receptors activated Jak1, Jak2, and Tyk2 receptor-associated tyrosine kinases. The information is next relayed to the nucleus by the STAT3 transcriptional activator, which is recruited by both types of OSM receptors. In addition, STAT5b was specifically activated through the gp130.OSMRbeta type II heterocomplex. The signaling pathway differences observed between the common type I LIF/OSM receptor and the specific type II OSM receptor might explain some of the bioactivities specifically displayed by OSM.

Animals↗
PubMed1997

The unusual species cross-reactivity of the leukemia inhibitory factor receptor alpha-chain is determined primarily by the immunoglobulin-like domain.

Human leukemia inhibitory factor (hLIF) binds to both human and mouse LIF receptors (LIFRs), while mouse LIF (mLIF) binds only to mouse LIFRs. Furthermore, hLIF binds with much higher affinity to the mouse LIFR (mLIFR) alpha-chain than does mLIF itself. To define the structural elements of the mLIFR alpha-chain conferring high affinity binding of hLIF and the species-specific interaction with mLIF, we first constructed C-terminally truncated extracellular domains of both the mLIFR and the human LIFR (hLIFR) alpha-chains, which contained only the two hemopoietin domains separated by an immunoglobulin-like domain. These recombinant truncated LIFR alpha-chains had identical binding and biological characteristics to either their naturally occurring or transfected counterparts. On the basis of this, we have generated eight interspecies receptor chimeras by combining different regions of the mouse and human LIFR sequence. Surprisingly, the immunoglobulin-like domain of the mLIFR alpha-chain played the predominant role in receptor-ligand interactions. Moreover, both high affinity binding for hLIF and the species-specific binding for mLIF mapped to the same domain of mLIFR molecule. These findings should enable the development of a "humanized" mouse LIFR that could act as a potent antagonist of hLIF biological activities in vivo.

Animals↗
PubMed1997

Identification of an upstream enhancer within a functional promoter of the human leukemia inhibitory factor receptor gene and its alternative promoter usage.

Knockout of the leukemia inhibitory factor receptor (LIFR) gene results in disrupted placental architecture, imbalanced bone development, and losses of functional neurons. We here report the identification of an enhancer in a functional human LIFR gene promoter and alternative promoter usage by this gene. A single transcription start site was identified in placental JEG-3 cells and a genomic clone containing 4876-nucleotide upstream sequences was found to have promoter activity in JEG-3 cells. However, in osteogenic sarcoma U-2 OS cell, Northern blot using a probe of the first exon detected in JEG-3 cells failed to detect LIFR transcripts. 5'-Rapid amplification of cDNA ends (RACE) revealed an alternative first exon and a 0.6-kilobase pair (kb) 5'-flanking region possessed promoter activity in U-2 OS cells. For the 4.8-kb promoter active in placental cells, a minimal promoter was localized within -162 nucleotides. Three regions increased and one inhibited promoter activity. Subcloning of an activation region (-4876 to -3453 nucleotides) into SV40 promoter either upstream or downstream in either orientation to the luciferase reporter resulted in 10-35-fold luciferase induction, demonstrating the characteristics of an enhancer. Transfections into nine cell lines of different tissue origin indicated that the cloned promoter and enhancer in the 4.8-kb fragment was placental tissue-specific. A 226-base pair fragment (-4625 to -4400 nucleotides) was further localized as the minimal enhancer region, in which deletion of either element A (-4625 to -4581 nucleotides) or element B (-4418 to -4400 nucleotides) resulted in the loss of enhancer activity. Electrophoretic mobility shift assay confirmed that these two elements bind to specific nuclear proteins individually. In the middle region between element A and B, disruption of enhancer integrity also led to a loss of enhancer activity, although two SP1 and three NF-kappaB/c-Rel binding sites did not contribute to enhancer function. These results demonstrate a complex regulation of the human LIFR gene, including alternative promoter usage and tissue-specific elements at the transcription level.

Base Sequence↗
PubMed1997

A sweat gland-derived differentiation activity acts through known cytokine signaling pathways.

The sympathetic innervation of sweat glands undergoes a target-induced noradrenergic to cholinergic/peptidergic switch during development. Similar changes are induced in cultured sympathetic neurons by sweat gland cells or by one of the following cytokines: leukemia inhibitory factor (LIF), ciliary neurotrophic factor (CNTF), or cardiotrophin-1 (CT-1). None of these is the sweat gland-derived differentiation activity. LIF, CNTF, and CT-1 act through the known receptors LIF receptor beta (LIFRbeta) and gp130 and well defined signaling pathways including receptor phosphorylation and STAT3 activation. Therefore, to determine whether the gland-derived differentiation activity was a member of the LIF/CNTF cytokine family, we tested whether it acted via these same receptors and signal cascades. Blockade of LIFRbeta inhibited the sweat gland differentiation activity in neuron/gland co-cultures, and extracts of gland-containing footpads stimulated tyrosine phosphorylation of LIFRbeta and gp130. An inhibitor (CGX) of molecules that bind the CNTFRalpha, which is required for CNTF signaling, did not affect the gland-derived differentiation activity. Soluble footpad extracts induced the same changes in NBFL neuroblastoma cells as LIF and CNTF, including increased vasoactive intestinal peptide mRNA, STAT3 dimerization, and DNA binding, and stimulation of transcription from the vasoactive intestinal peptide cytokine-responsive element. Thus, the sweat gland-derived differentiation activity uses the same signaling pathway as the neuropoietic cytokines, and is likely to be a family member.

Animals↗
PubMed1997

Signaling of the cardiotrophin-1 receptor. Evidence for a third receptor component.

Cardiotrophin-1 (CT-1) is a recently isolated cytokine belonging to the interleukin-6 cytokine family. In the present study we show that CT-1 activates its receptor expressed at the surface of a human neural cell line by recruiting gp130 and gp190/leukemia inhibitory factor receptor beta, as shown by analyzing their tyrosine phosphorylation level. Neutralizing antibody directed against gp130 and reconstitution experiments performed in the COS-7 cell line demonstrate that gp130-gp190 heterocomplex formation is essential for CT-1 signaling. Analysis of the subsequent activation events revealed that CT-1 induces and utilizes Jak1-, Jak2-, and Tyk2-associated tyrosine kinases, which are in turn relayed by STAT-3 transcription factor. Cross-linking of iodinated CT-1 to the cell surface led to the identification of a third alpha component in addition to gp130 and gp190, with an apparent molecular mass of 80 kDa. Removal of N-linked carbohydrates from the protein backbone of the alpha component resulted in a protein of 45 kDa. Our results provide evidence that the CT-1 receptor is composed of a tripartite complex, a situation similar to the high affinity receptor for ciliary neurotrophic factor.

Antigens, CD↗
PubMed1998

Identification and characterization of two distinct truncated forms of gp130 and a soluble form of leukemia inhibitory factor receptor alpha-chain in normal human urine and plasma.

Leukemia inhibitory factor (LIF) is a polyfunctional cytokine known to require at least two distinct receptor components (LIF receptor alpha-chain and gp130) in order to form a high affinity, functional receptor complex. In this report, we present evidence that there are two distinct truncated forms of gp130 in normal human urine and plasma: a large form with a molecular weight of approximately 100, 000, which is similar to a previously described form of soluble gp130 in human serum, and a previously undescribed small form with a molecular weight of approximately 50,000. Using a panel of monoclonal antibodies raised against the extracellular domain of human gp130, we were able to show that the small form of the urinary gp130 probably contained only the hemopoietin domain. Both forms of gp130 bound LIF specifically and were capable of forming heterotrimeric complexes with soluble human LIF receptor alpha-chain in the presence of human LIF. In addition to the soluble forms of gp130, a soluble form of LIF receptor alpha-chain was also detected in human urine and plasma.

Amino Acid Sequence↗
PubMed1998

Functional map of a placenta-specific enhancer of the human leukemia inhibitory factor receptor gene.

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (-4625/-4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (-4617/-4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (-4549/-4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (-4464/-4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of approximately 160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in human LIFR gene.

Binding Sites↗
PubMed1998

The box-1 region of the leukemia inhibitory factor receptor alpha-chain cytoplasmic domain is sufficient for hemopoietic cell proliferation and differentiation.

Leukemia inhibitory factor (LIF) is a pleiotropic cytokine that acts on a variety of cell types and regulates cell proliferation and differentiation. The functional receptor for LIF is composed of LIFR alpha-chain (LIFRalpha) and gp130 both of which are shared in the functional receptors for oncostatin M, ciliary neurotrophic factor, and cardiotrophin-1. By using stable transfection of wild-type or cytoplasmic deletion mutants of LIFRalpha together with full-length gp130 into Ba/F3 cells, we found that cells expressing gp130 and an extensively deleted mutant LIFRalpha containing only the box-1 region were capable of proliferating in response to LIF, although LIF-dependent long term growth of these cells was seriously impaired. Using a similar strategy to generate WEHI-3BD+ cells expressing gp130 and wild-type or truncation mutants of LIFRalpha, studies revealed that the box-1 region of the LIFRalpha was also sufficient for LIF-dependent induction of different aspects of differentiation, including up-regulation of macrophage surface marker expression, morphological change, and cell migration in agar culture. However, the C-terminal region of the LIFRalpha, although not essential for intracellular signaling, was important for efficient receptor-mediated ligand internalization. In summary, the membrane-proximal box-1 region plays a dominant role in LIF-induced signal transduction of both proliferation and differentiation.

Cell Differentiation↗
PubMed1999

The carboxyl-terminal domains of gp130-related cytokine receptors are necessary for suppressing embryonic stem cell differentiation. Involvement of STAT3.

Cell type-specific responses to the leukemia inhibitory factor (LIF)/interleukin 6 cytokine family are mediated by dimerization of the LIF receptor alpha-chain (LIFRalpha) with the signal transducer gp130 or of two gp130 molecules followed by activation of the JAK/STAT and Ras/mitogen-activated protein kinase cascades. In order to dissect the contribution of gp130 and LIFRalpha individually, chimeric molecules consisting of the extracellular domain of the granulocyte colony stimulating factor receptor (GCSF-R) and various mutant forms of the cytoplasmic domains of gp130 or LIFRalpha were expressed in embryonic stem (ES) cells to test for suppression of differentiation, or in a factor-dependent plasma cytoma cell line to assess for induction of proliferation. Carboxyl-terminal domains downstream of the phosphatase (SHP2)-binding sites were dispensable for mitogen-activated protein kinase activation and the transduction of proliferative signals. Moreover, carboxyl-terminal truncation mutants which lacked intact Box 3 homology domains showed decreased STAT3 activation, failed to induce Hck kinase activity and suppress ES cell differentiation. Moreover, STAT3 antisense oligonucleotides impaired LIF-dependent inhibition of differentiation. Substitution of the tyrosine residue within the Box 3 region of the GSCF-R abolished receptor-mediated suppression of differentiation without affecting the transduction of proliferative signals. Thus, distinct cytoplasmic domains within the LIFRalpha, gp130, and GCSF-R transduce proliferative and differentiation suppressing signals.

Antigens, CD↗
PubMed1999

Receptor recognition sites of cytokines are organized as exchangeable modules. Transfer of the leukemia inhibitory factor receptor-binding site from ciliary neurotrophic factor to interleukin-6.

Interleukin-6 (IL-6) and ciliary neurotrophic factor (CNTF) are "4-helical bundle" cytokines of the IL-6 type family of neuropoietic and hematopoietic cytokines. IL-6 signals by induction of a gp130 homodimer (e.g. IL-6), whereas CNTF and leukemia inhibitory factor (LIF) signal via a heterodimer of gp130 and LIF receptor (LIFR). Despite binding to the same receptor component (gp130) and a similar protein structure, IL-6 and CNTF share only 6% sequence identity. Using molecular modeling we defined a putative LIFR binding epitope on CNTF that consists of three distinct regions (C-terminal A-helix/N-terminal AB loop, BC loop, C-terminal CD-loop/N-terminal D-helix). A corresponding gp130-binding site on IL-6 was exchanged with this epitope. The resulting IL-6/CNTF chimera lost the capacity to signal via gp130 on cells without LIFR, but acquired the ability to signal via the gp130/LIFR heterodimer and STAT3 on responsive cells. Besides identifying a specific LIFR binding epitope on CNTF, our results suggest that receptor recognition sites of cytokines are organized as modules that are exchangeable even between cytokines with limited sequence homology.

Animals↗
PubMed1999

Binding of leukemia inhibitory factor (LIF) to mutants of its low affinity receptor, gp190, reveals a LIF binding site outside and interactions between the two cytokine binding domains.

The gp190 transmembrane protein, the low affinity receptor for the leukemia inhibitory factor (LIF), belongs to the hematopoietin family of receptors characterized by the cytokine binding domain (CBD). gp190 is one of the very few members of this family to contain two such domains. The membrane-proximal CBD (herein called D2) is separated from the membrane-distal one (called D1) by an immunoglobulin-like (Ig) domain and is followed by three fibronectin type III repeats. We used truncated gp190 mutants and a blocking anti-gp190 monoclonal antibody to study the role of these repeats in low affinity receptor function. Our results showed that the D1Ig region was involved in LIF binding, while D2 appeared to be crucial for the proper folding of D1, suggesting functionally important interactions between the two CBDs in the wild-type protein. In addition, a point mutation in the carboxyl terminus of the Ig region strongly impaired ligand binding. These findings suggest that at least two distinct sites, both located within the D1Ig region, are involved in LIF binding to gp190, and more generally, that ligand binding sites on these receptors may well be located outside the canonical CBDs.

Animals↗
PubMed1999

Leukemia inhibitory factor and its receptor promote adipocyte differentiation via the mitogen-activated protein kinase cascade.

Extracellular factors and intracellular signaling pathways involved in early events of adipocyte differentiation are poorly defined. It is shown herein that expression of leukemia inhibitory factor (LIF) and LIF receptor is developmentally regulated during adipocyte differentiation. Preadipocytes secrete bioactive LIF, and an antagonist of LIF receptor inhibits adipogenesis. Genetically modified embryonic stem (ES) cells combined with culture conditions to commit stem cells into the adipocyte lineage were used to examine the requirement of LIF receptor during in vitro development of adipose cells. The capacity of embryoid bodies derived from lifr(-/-) ES cells to undergo adipocyte differentiation is dramatically reduced. LIF addition stimulates adipocyte differentiation of Ob1771 and 3T3-F442A preadipocytes and that of peroxisome proliferator-activated receptor gamma2 ligand-treated mouse embryonic fibroblasts. Expression of the early adipogenic transcription factors C/EBPbeta and C/EBPdelta is rapidly stimulated following exposure of preadipose cells to LIF. The selective inhibitors of mitogen-activated protein kinase kinase, i.e. PD98059 and U0126, inhibit LIF-induced C/EBP gene expression and prevent adipocyte differentiation induced by LIF. These results are in favor of a model that implicates stimulation of LIF receptor in the commitment of preadipocytes to undergo terminal differentiation by controlling the early expression of C/EBPbeta and C/EBPdelta genes via the mitogen-activated protein kinase cascade.

Adipocytes↗
PubMed2000

Identification of a gp130 cytokine receptor critical site involved in oncostatin M response.

Gp130 cytokine receptor is involved in the formation of multimeric functional receptors for interleukin-6 (IL-6), IL-11, leukemia inhibitory factor (LIF), oncostatin M (OSM), ciliary neurotrophic factor, and cardiotrophin-1. Cloning of the epitope recognized by an OSM-neutralizing anti-gp130 monoclonal antibody identified a portion of gp130 receptor localized in the EF loop of the cytokine binding domain. Site-directed mutagenesis of the corresponding region was carried out by alanine substitution of residues 186-198. To generate type 1 or type 2 OSM receptors, gp130 mutants were expressed together with either LIF receptor beta or OSM receptor beta. When positions Val-189/Tyr-190 and Phe-191/Val-192 were alanine-substituted, Scatchard analyses indicated a complete abrogation of OSM binding to both type receptors. Interestingly, binding of LIF to type 1 receptor was not affected, corroborating the notion that in this case gp130 mostly behaves as a converter protein rather than a binding receptor. The present study demonstrates that positions 189-192 of gp130 cytokine binding domain are essential for OSM binding to both gp130/LIF receptor beta and gp130/OSM receptor beta heterocomplexes.

Alanine↗
PubMed2001

Identification of agonistic and antagonistic antibodies against gp190, the leukemia inhibitory factor receptor, reveals distinct roles for its two cytokine-binding domains.

The receptor for the cytokine leukemia inhibitory factor (LIF) associates the low affinity binding component gp190 and the high affinity converter gp130, both of which are members of the family of hematopoietic receptors characterized by the cytokine receptor homology (CRH) domain. The gp190 is among the very few members of this large family to contain two CRH domains. The membrane-distal one (herein called D1) is followed by an Ig-like domain, a membrane-proximal CRH domain called D2, and three type III fibronectin repeats. We raised a series of monoclonal antibodies specific for the human gp190. Among them was the blocking antibody 1C7, which was directed against the D1Ig region and which impaired the binding of LIF to gp190. Another blocking antibody, called 12D3, was directed against domain D2 and interfered with the reconstitution of the high affinity receptor complex, independently of the interaction between LIF and gp190. The blocking effect of these two antibodies concerned four cytokines known to use gp190, i.e. LIF, oncostatin M, ciliary neurotrophic factor, and cardiotrophin-1. Among 23 antibodies tested alone or in combination (two anti-D2 and 21 anti-D1Ig), only the mixture of the two anti-D2 antibodies displayed agonistic activity in the absence of the cytokine. Taken together, these results demonstrate that the two CRH domains of gp190 play different functions in ligand binding and receptor activation.

Animals↗
PubMed2002

Separate functions for the two modules of the membrane-proximal cytokine binding domain of glycoprotein 190, the leukemia inhibitory factor low affinity receptor, in ligand binding and receptor activation.

The receptor for the cytokine leukemia inhibitory factor (LIF) associates the low affinity binding component gp190 and the high affinity converter gp130. Both are members of the hematopoietic receptors family characterized by the cytokine receptor homology (CRH) domain, which consists of two barrel-like modules of around 100 amino acids each. The gp190 is among the very few members of this large family to contain two CRH domains. The membrane-distal one (herein called D1) is followed by an immunoglobulin-like domain, a membrane-proximal CRH domain called D2, and three type III fibronectin-like repeats. A minimal D1IgD2 fragment is required for binding LIF. By using transmembrane forms of deletion mutants in gp190 ectodomain, we demonstrated that removal of D1 led to spontaneous activation of the receptor and that this property was devoted to a peptidic sequence localized within the last 42 amino acids of the carboxyl-terminal module of D2. By using soluble forms of deletion mutants made by progressive truncations from the end of the D1IgD2 fragment, we demonstrated that the carboxyl-terminal module of D2 was dispensable for LIF binding and that the correct conformation of the D1Ig fragment required a full amino-terminal module of D2. Therefore, the two constitutive modules of the membrane-proximal CRH domain D2 of gp190 fulfill two distinct roles in gp190 function, i.e. in stabilizing the conformation of gp190 allowing LIF binding and in activating the receptor.

Amino Acid Sequence↗