Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “mRNA stability”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 199 records · Page 11Linked to original sources
PubMed2003

Fructose modulates GLUT5 mRNA stability in differentiated Caco-2 cells: role of cAMP-signalling pathway and PABP (polyadenylated-binding protein)-interacting protein (Paip) 2.

In intestinal cells, levels of the fructose transporter GLUT5 are increased by glucose and to a greater extent by fructose. We investigated the mechanism by which fructose increases GLUT5 expression. In Caco-2 cells, fructose and glucose increased activity of the -2500/+41 GLUT5 promoter to the same extent. cAMP also activated the GLUT5 promoter. However, if a protein kinase A inhibitor was used to block cAMP signalling, extensive GLUT5 mRNA degradation was observed, with no change in basal transcription levels demonstrating the involvement of cAMP in GLUT5 mRNA stability. Indeed, the half-life of GLUT5 mRNA was correlated ( R2=0.9913) with cellular cAMP levels. Fructose increased cAMP concentration more than glucose, accounting for the stronger effect of fructose when compared with that of glucose on GLUT5 production. We identified several complexes between GLUT5 3'-UTR RNA (where UTR stands for untranslated region) and cytosolic proteins that might participate in mRNA processing. Strong binding of a 140 kDa complex I was observed in sugar-deprived cells, with levels of binding lower in the presence of fructose and glucose by factors of 12 and 6 respectively. This may account for differences in the effects of fructose and glucose. In contrast, the amounts of two complexes of 96 and 48 kDa increased equally after stimulation with either glucose or fructose. Finally, PABP (polyadenylated-binding protein)-interacting protein 2, a destabilizing partner of PABP, was identified as a component of GLUT5 3'-UTR RNA-protein complexes. We conclude that the post-transcriptional regulation of GLUT5 by fructose involves increases in mRNA stability mediated by the cAMP pathway and Paip2 (PABP-interacting protein 2) binding.

3' Untranslated Regions↗
PubMed1997

mRNA stability is regulated by a coding-region element and the unique 5' untranslated leader sequences of the three Synechococcus psbA transcripts.

The psbAI and psbAIII transcripts in Synechococcus sp. strain PCC 7942 are subject to accelerated turnover when cells are exposed to high light intensities, but psbAII message stability is unaffected. We used a psbAI 'minigene' which has a part of the coding sequence removed as a reporter gene in order to identify the cis-acting elements of the transcript that determine stability. While engineering the minigene to optimally mimic the native gene, we identified a stabilizer element within the open reading frame, corresponding to the coding region for the first membrane span of the D1 protein, the presence of and translation through which was essential for normal psbA mRNA stability. We propose that this stabilizer is a site for ribosome pausing, and that accumulation of ribosomes on the transcript upstream of the pause site increases stability. To identify the elements that regulate the differential responses of the psbA transcripts to high-light growth, sequences from psbAII and psbAIII were substituted in the psbAI minigene reporter. The chimeric reporter transcripts established that the psbAI and psbAIII untranslated leaders determine the faster turnover of these messages. The untranslated leader regions of the psbA transcripts may regulate mRNA stability by modulating translation and thereby stability, or by recruiting RNA-binding proteins that affect mRNA turnover more directly.

Cyanobacteria↗
PubMed1987

Differential mRNA stability controls relative gene expression within a polycistronic operon.

In this paper we demonstrate a role for mRNA stability in controlling relative gene expression within a polycistronic operon. The polycistronic malEFG operon of E. coli contains two REP sequences (highly conserved inverted repeats) within the malE-malF intercistronic region. Deletion of these REP sequences from the chromosomal operon not only destabilizes upstream malE mRNA, but also results in a 9-fold reduction in the synthesis of MalE protein. A single REP sequence seems to be as efficient as the two normally found in this intergenic region at stabilizing translationally active upstream mRNA. The widespread occurrence of REP sequences and other sequences that could potentially stabilize upstream mRNA suggests that this mechanism of control of gene expression may be rather common.

ATP-Binding Cassette Transporters↗
PubMed2004

Oxidised-HDL3 induces the expression of PAI-1 in human endothelial cells. Role of p38MAPK activation and mRNA stabilization.

Modified lipoproteins have been suggested to modulate endothelial expression of plasminogen activator inhibitor-1 (PAI-1). As oxidized high-density lipoprotein (Ox-HDL) has been found in atheromatous plaques and receptors for modified HDL are present on endothelial cells, we investigated the role of Ox-HDL3 on the expression of PAI-1. Ox-HDL3 but not native HDL3, increased PAI-1 mRNA expression in endothelial cells. Furthermore, PAI-1 antigen expression and activity increased in the supernatant of cells incubated with Ox-HDL3. The intracellular pathways involved in this effect were investigated. Ox-HDL3 activated both extracellular signal-regulated kinases (ERK) 1/2 and p38 mitogen-activated protein kinase (MAPK). Moreover, incubation with specific inhibitors of these kinases showed that p38MAPK was mainly involved in the Ox-HDL3-dependent PAI-1 induction. Transient transfection experiments suggested that none of the response elements in the proximal promoter (-804 to 17) were involved in Ox-HDL3-mediated PAI-1 expression. mRNA stability experiments showed that Ox-HDL3 increased the PAI-1 mRNA half-life. In summary, Ox-HDL3 induced PAI-1 mRNA expression and antigen release through a molecular mechanism involving MAPK activation and mRNA stabilization. Thus, oxidative modification converts HDL to a prothrombotic lipoprotein species.

Cells, Cultured↗
PubMed2000

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability.

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.

3' Untranslated Regions↗
PubMed2003

The KH-domain protein alpha CP has a direct role in mRNA stabilization independent of its cognate binding site.

Previous studies suggest that high-level stability of a subset of mammalian mRNAs is linked to a C-rich motif in the 3' untranslated region (3'UTR). High-level expression of human alpha-globin mRNA (h alpha-globin mRNA) in erythroid cells has been specifically attributed to formation of an RNA-protein complex comprised of a 3'UTR C-rich motif and an associated 39-kDa poly(C) binding protein, alpha CP. Documentation of this RNA-protein alpha-complex has been limited to in vitro binding studies, and its impact has been monitored by alterations in steady-state mRNA. Here we demonstrate that alpha CP is stably bound to h alpha-globin mRNA in vivo, that alpha-complex assembly on the h alpha-globin mRNA is restricted to the 3'UTR C-rich motif, and that alpha-complex assembly extends the physical half-life of h alpha-globin mRNA selectively in erythroid cells. Significantly, these studies also reveal that an artificially tethered alpha CP has the same mRNA-stabilizing activity as the native alpha-complex. These data demonstrate a unique contribution of the alpha-complex to h alpha-globin mRNA stability and support a model in which the sole function of the C-rich motif is to selectively tether alpha CP to a subset of mRNAs. Once bound, alpha CP appears to be fully sufficient to trigger downstream events in the stabilization pathway.

3' Untranslated Regions↗
PubMed2002

Stress granules: sites of mRNA triage that regulate mRNA stability and translatability.

Mammalian stress granules (SGs) are cytoplasmic domains into which mRNAs are sorted dynamically in response to phosphorylation of eukaryotic initiation factor (eIF) 2alpha, a key regulatory step in translational initiation. The activation of one or more of the eIF2alpha kinases leads to SG assembly by decreasing the levels of eIF2-GTP-tRNA(Met), the ternary complex that is normally required for loading the initiator methionine onto the 48 S preinitiation complex to begin translation. This stress-induced scarcity of eIF2-GTP-tRNA(Met) allows the RNA-binding proteins TIA-1 (T-cell internal antigen-1) and TIAR (TIA-1-related protein) to bind the 48 S complex in lieu of the ternary complex, thereby promoting polysome disassembly and the concurrent routing of the mRNA into a SG. The actual formation of SGs occurs upon auto-aggregation of the prion-like C-termini of TIA-1 proteins; this aggregation is reversed in vivo by overexpression of the heat-shock protein (HSP) chaperone HSP70. Remarkably, HSP70 mRNA is excluded from SGs and is preferentially translated during stress, indicating that the RNA composition of the SG is selective. Moreover, the effects of HSP70 on TIA aggregation suggest a feedback loop whereby HSP70 synthesis is auto-regulated. Proteins that promote mRNA stability [e.g. HuR (Hu protein R)] and destabilize mRNA [i.e. tristetraprolin (TTP)] are also recruited to SGs, suggesting that SGs effect a process of mRNA triage, by promoting polysome disassembly and routing mRNAs to cytoplasmic domains enriched for HuR and TTP. This model reveals connections between the eIF2alpha kinase system, mRNA stability and cellular chaperone levels.

Animals↗
PubMed1989

Cyclic AMP (cAMP) effects on chorionic gonadotropin gene transcription and mRNA stability: labile proteins mediate basal expression whereas stable proteins mediate cAMP stimulation.

Cyclic AMP stimulates a marked accumulation of CG alpha and CG beta mRNAs that reflects, in part, increased rates of gene transcription. We find that a major component of cAMP stimulation of alpha and CG beta mRNAs is independent of new protein synthesis. After treatment of JEG-3 choriocarcinoma cells with cycloheximide, basal levels of alpha and CG beta mRNAs decreased over 12 h to 27% and 13% of control values, respectively. However, cycloheximide treatment did not affect the degree of cAMP-stimulation of alpha and CG beta mRNA levels which increased 20- and 26-fold, respectively. Similarly, cycloheximide did not block cAMP-stimulated transcription of the alpha and CG beta genes. The effect of cAMP treatment on alpha and CG beta mRNA stability was assessed by decay after removal of cAMP, pulse-chase analyses, and decay after inhibition of RNA synthesis by actinomycin D. The half-lives of alpha and CG beta mRNAs determined by decay rates after removal of cAMP were 6.0 h and 7.2 h, respectively. Consistent with these measurements of mRNA stability, alpha and CG beta mRNA half-lives determined by pulse-chase analyses were 8.8 h and 8.6 h, respectively. Cyclic AMP treatment increased the half-lives of alpha and CG beta mRNAs 1.8- and 3.4-fold, respectively. Thus, the effects of cAMP on alpha and CG beta gene expression are predominantly transcriptional, but cAMP also increases mRNA levels via a posttranscriptional mechanism.(ABSTRACT TRUNCATED AT 250 WORDS)

8-Bromo Cyclic Adenosine Monophosphate↗
PubMed2005

The role of cytokine mRNA stability in the pathogenesis of autoimmune disease.

Inflammatory cytokines such as interferon (IFN)-gamma, interleukin (IL)-2, tumor-necrosis factor (TNF)-alpha and IL-17 play an important role in the pathogenesis of cell-mediated autoimmune diseases. Cytokine gene expression is tightly regulated at the post-transcriptional level. Cytokine mRNA decay is dependent not only upon cis-elements in the RNA but also upon trans-acting factors such as the RNA binding proteins TTP, HuR, AUF-1, Nucleolin and YB-1. Physiologic signals, for instance signaling through the CD28 receptor on T cells, can modulate the half-life of a select subset of cytokine mRNAs, such as IL-2. Distinct cis- and trans-acting elements in human and mouse IL-2 mRNA may account for the different pattern of CD28-mediated mRNA stabilization in these two species. TTP-deficient mice or mice with a deletion of the TNF-alpha mRNA ARE element develop a complex inflammatory syndrome that is associated with a prolonged TNF-alpha mRNA half-life and elevated levels of circulating TNF-alpha. This syndrome can be prevented by treatment with TNF-alpha blocking antibodies. Evidence from mice with altered cytokine mRNA stability, along with human data, suggests that imbalance between the stability and decay of inflammatory cytokine mRNAs could represent a basic mechanism leading to autoimmunity.

Animals↗
PubMed2000

Identification of AUF1 as a parathyroid hormone mRNA 3'-untranslated region-binding protein that determines parathyroid hormone mRNA stability.

Parathyroid hormone (PTH) mRNA levels are post-transcriptionally increased by hypocalcemia and decreased by hypophosphatemia, and this is mediated by cytosolic proteins binding to the PTH mRNA 3'-untranslated region (UTR). The same proteins are also present in other tissues, such as brain, but only in the parathyroid is their binding regulated by calcium and phosphate. The function of the PTH mRNA 3'-UTR-binding proteins was studied using an in vitro degradation assay. Competition for the parathyroid-binding proteins by excess unlabeled 3'-UTR destabilized the full-length PTH transcript in this assay, indicating that these proteins protect the RNA from RNase activity. The PTH RNA 3'-UTR-binding proteins were purified by RNA affinity chromatography of rat brain S-100 extracts. The eluate from the column was enriched in PTH RNA 3'-UTR binding activity. Addition of eluate to the in vitro degradation assay with parathyroid protein extracts stabilized the PTH transcript. A major band from the eluate at 50 kDa was sequenced and was identical to AU-rich binding protein (AUF1). Recombinant AUF1 bound the full-length PTH mRNA and the 3'-UTR. Added recombinant AUF1 also stabilized the PTH transcript in the in vitro degradation assay. Our results show that AUF1 is a protein that binds to the PTH mRNA 3'-UTR and stabilizes the PTH transcript.

3' Untranslated Regions↗
PubMed2000

Glucose starvation reduces IGF-I mRNA in tumor cells: evidence for an effect on mRNA stability.

The purpose of this study was to characterize the mechanisms by which glucose regulates IGF-I gene expression in rat C6 glioma cells and in rat GH3 pituitary adenoma cells. Glucose starvation for periods of 12 to 48 h decreased IGF-I mRNA levels. In contrast, there was no stimulation of IGF-I mRNA by medium glucose between 1 and 25 mM over a 24-h period. Studies with hexoses and glycolytic metabolites suggested that glucose metabolism was required to maintain IGF-I mRNA. Glucose starvation lowered IGF-I mRNA half-life in both C6 and GH3 cells. Protein synthesis inhibition lowered IGF-I mRNA by about 20% in glucose-fed C6 and GH3 cells, while potently increasing IGF-I mRNA in glucose-starved C6 cells and not altering IGF-I mRNA in glucose-starved GH3 cells. Our results suggest that in these tumor cells, IGF-I mRNA stability is reduced by glucose starvation, secondary to a deficiency in intracellular glucose metabolism. Ongoing protein synthesis is not required for this mRNA de-stabilizing effect in GH3 cells. Rather, in glucose-starved C6 cells, decreased IGF-I mRNA stability may result from the action of a labile protein.

Animals↗
PubMed2004

p38 MAPK regulates IL-1beta induced IL-6 expression through mRNA stability in osteoblasts.

Osteoblast-derived IL-6 functions in coupled bone turnover by supporting osteoclastogenesis favoring bone resorption instead of bone deposition. Gene regulation of IL-6 is complex occurring both at transcription and post-transcription levels. The focus of this paper is at the level of mRNA stability, which is important in IL-6 gene regulation. Using the MC3T3-E1 as an osteoblastic model, IL-6 secretion was dose dependently decreased by SB203580, a p38 MAPK inhibitor. Steady state IL-6 mRNA was decreased with SB203580 (2 microM) ca. 85% when stimulated by IL-1beta (1-5 ng/ml). These effects require de novo protein synthesis as they were inhibited by cycloheximide. p38 MAPK had minor effects on proximal IL-6 promoter activity in reporter gene assays. A more significant effect on IL-6 mRNA stability was observed in the presence of SB203580. Western blot analysis confirmed that SB203580 inhibited p38 MAP kinase, in response to IL-1beta in a dose dependent manner in MC3T3-E1 cells. Stably transfected MC3T3-E1 reporter cell lines (MC6) containing green fluorescent protein (GFP) with the 3'untranslated region of IL-6 were constructed. Results indicated that IL-1beta, TNFalpha, LPS but not parathyroid hormone (PTH) could increase GFP expression of these reporter cell lines. Endogenous IL-6 and reporter gene eGFP-IL-6 3'UTR mRNA was regulated by p38 in MC6 cells. In addition, transient transfection of IL-6 3'UTR reporter cells with immediate upstream MAP kinase kinase-3 and -6 increased GFP expression compared to mock transfected controls. These results indicate that p38 MAPK regulates IL-1beta-stimulated IL-6 at a post transcriptional mechanism and one of the primary targets of IL-6 gene regulation is the 3'UTR of IL-6.

3' Untranslated Regions↗
PubMed2003

A role for increased mRNA stability in the induction of endothelin-1 synthesis by lipopolysaccharide.

An association exists between infection and cardiovascular diseases, including atherosclerosis, stroke and myocardial infarction. This may involve endothelin-1 (ET-1) which has been implicated in these and other vascular pathologies. ET-1 synthesis is controlled primarily by the level of its mRNA and numerous stimuli, including infection, lead to elevated ET-1 levels. Here, we have investigated the regulation of ET-1 release and preproET-1 (ppET-1) mRNA in bovine aortic endothelial cells by lipopolysaccharide (LPS). ET-1 release from bovine aortic endothelial cells was stimulated by LPS and reporter gene assays implicated LPS-induced ppET-1 transcription. However, changes in transcription were modest compared to increases in ET-1 synthesis. Therefore, ppET-1 mRNA levels were measured by real-time reverse transcription-polymerase chain reaction. The effect of LPS on ppET-1 mRNA levels was more marked than on transcription (1.2-fold increase in transcription vs. 5.5-fold increase in ppET-1 mRNA). Analysis of ppET-1 mRNA stability by real-time reverse transcription-polymerase chain reaction showed that LPS increased its half-life by approximately 2-fold. Thus, upregulated ppET-1 mRNA and hence increased ET-1 synthesis may be due to both increased transcription and reduced mRNA degradation. These effects of LPS on mRNA stability may be a key mechanism in vascular pathologies through which many proteins are induced in response to infection.

Animals↗
PubMed1989

Mechanism of erythromycin-induced ermC mRNA stability in Bacillus subtilis.

In Bacillus subtilis, the ermC gene encodes an mRNA that is unusually stable (40-min half-life) in the presence of erythromycin, an inducer of ermC gene expression. A requirement for this induced mRNA stability is a ribosome stalled in the ermC leader region. This property of ermC mRNA was used to study the decay of mRNA in B. subtilis. Using constructs in which the ribosome stall site was internal rather than at the 5' end of the message, we show that ribosome stalling provides stability to sequences downstream but not upstream of the ribosome stall site. Our results indicate that ermC mRNA is degraded by a ribonucleolytic activity that begins at the 5' end and degrades the message in a 5'-to-3' direction.

Bacillus subtilis↗
PubMed2005

Differences in the translation efficiency and mRNA stability mediated by 5'-UTR splice variants of human SP-A1 and SP-A2 genes.

Surfactant protein A (SP-A) plays an important role in host defense, modulation of inflammatory processes, and surfactant-related functions of the lung. The human SP-A (hSP-A) locus consists of two functional genes, SP-A1 and SP-A2. Several hSP-A 5'-untranslated region (UTR) splice variants for each gene have been characterized and shown to be translated in vitro and in vivo. In this report, we investigated the role of hSP-A 5'-UTR splice variants on SP-A production and molecular mechanisms involved. We used in vitro transient expression of hSP-A 5'-UTR constructs containing luciferase as the reporter gene and quantitative real-time PCR to study hSP-A 5'-UTR-mediated gene expression. We found that 1) the four (A'D', ABD, AB'D', and A'CD') 5'-UTR splice variants under study enhanced gene expression, by increasing luciferase activity from 2.5- to 19.5-fold and luciferase mRNA from 4.3- to 8.8-fold compared with the control vector that lacked hSP-A 5'-UTR; 2) all four 5'-UTR splice variants studied regulated mRNA stability. The ABD variant exhibited the lowest rate of mRNA decay compared with the other three constructs (A'D', AB'D', and A'CD'). These three constructs also exhibited significantly lower rate of mRNA decay compared with the control vector; 3) based on the indexes of translational efficiency (luciferase activity/mRNA), ABD and AB'D' exhibited higher translational efficiency compared with the control vector, whereas the translational efficiency of each A'D' and A'CD' was lower than that of the control vector. These findings indicate that the hSP-A 5'-UTR splice variants play an important role in both SP-A translation and mRNA stability.

5' Untranslated Regions↗
PubMed2001

Altered expression of the mRNA stability factor HuR promotes cyclooxygenase-2 expression in colon cancer cells.

Cyclooxygenase-2 (COX-2) expression is normally tightly regulated. However, constitutive overexpression plays a key role in colon carcinogenesis. To understand the molecular nature of enhanced COX-2 expression detected in colon cancer, we examined the ability of the AU-rich element-containing (ARE-containing) 3' untranslated region (3'UTR) of COX-2 mRNA to regulate rapid mRNA decay in human colon cancer cells. In tumor cells displaying enhanced growth and tumorigenicity that is correlated with elevated COX-2, vascular endothelial growth factor (VEGF), and IL-8 protein levels, the corresponding mRNAs were transcribed constitutively and turned over slowly. The observed mRNA stabilization is owing to defective recognition of class II-type AREs present within the COX-2, VEGF, and IL-8 3'UTRs; c-myc mRNA, containing a class I ARE decayed rapidly in the same cells. Correlating with cellular defects in mRNA stability, the RNA-binding of trans-acting cellular factors was altered. In particular, we found that the RNA-stability factor HuR binds to the COX-2 ARE, and overexpression of HuR, as detected in tumors, results in elevated expression of COX-2, VEGF, and IL-8. These findings demonstrate the functional significance rapid mRNA decay plays in controlling gene expression and show that dysregulation of these trans-acting factors can lead to overexpression of COX-2 and other angiogenic proteins, as detected in neoplasia.

3' Untranslated Regions↗
PubMed1994

Regulation of acetylcholinesterase mRNA stability by calcium during differentiation from myoblasts to myotubes.

The expression of acetylcholinesterase (AChE), nicotinic acetylcholine receptors (nAChR), and their corresponding mRNAs increases dramatically during the conversion of myoblasts to myotubes in C2-C12 cells. The increase in expression of nAChR arises from transcriptional activation of the genes encoding the receptor subunits, whereas stabilization of labile transcripts is primarily responsible for enhanced AChE expression. In a search for the signaling pathways responsible for stabilization of the AChE mRNA, we found that ryanodine, synthetic ryanodine receptor antagonists and L-type, but not N-type, Ca2+ channel blockers inhibit the differentiation-induced expression of AChE mRNA, but not the nAChR mRNA. Selective inhibition of increased expression of AChE is also evident. Inhibition by ryanodine and nifedipine is additive suggesting different target sites for the two Ca2+ channel ligands. Ryanodine binding sites can be detected in both myoblasts and myotubes, but they increase substantially during differentiation. Rates of AChE gene transcription are not altered by ryanodine and nifedipine, indicating that decreased Ca2+ availability prevents stabilization of the mRNA normally seen with differentiation. Muscle cells still undergo elongation and fusion in the presence of ryanodine or L-type Ca2+ channel antagonists. Ryanodine block is fully reversible, indicating functional integrity of the cellular expression system after the drug treatment. These findings indicate that intracellular ryanodine-sensitive calcium channels and extracellular L-type Ca2+ channels link to play an important role in stabilizing AChE mRNA and suggest that transient increases in intracellular Ca2+ may be critical for the commitment of AChE expression during myogenesis.

Acetylcholinesterase↗
PubMed2000

Alpha(1) adrenergic agonist induction of p21(waf1/cip1) mRNA stability in transfected HepG2 cells correlates with the increased binding of an AU-rich element binding factor.

Stimulation of transfected HepG2 cells (TFG2) with the alpha(1)-adrenergic agonist phenylephrine (PE) significantly activated p21(waf1/cip1) gene expression without affecting p53 gene expression. Northern blotting and reporter assay demonstrated that this induction was due to PE stimulation of p21(waf1/cip1) mRNA stability. To further define the underlying mechanism, we prepared a chloramphenicol acetyltransferase (CAT)-p21(waf1/cip1) 3'-untranslated region (3'-UTR) hybrid construct by inserting the 3'-UTR of p21(waf1/cip1) mRNA just downstream from the CAT coding sequence and transfected it into TFG2 cells. PE treatment enhanced the activity of this construct by 6-fold. Deletion analyses indicated that an AU-rich element (AURE) located between 553 to 625 within the p21(waf1/cip1) 3'-UTR was required for this induction. RNA gel shift assays demonstrated that this AURE bound an RNA-binding protein. This protein has been purified 5000-fold from PE-treated TFG2 cells by heparin-Sepharose and RNA affinity chromatography. SDS-polyacrylamide gel electrophoresis, UV cross-linking, and Northwestern analyses indicated the molecular mass of this protein as 24 and 52 kDa. Finally, PE treatment markedly enhanced this RNA-protein binding by a p42/44 mitogen-activated protein kinase-dependent mechanism. These data suggest that the AURE located between 553 and 625 within the p21(waf1/cip1) mRNA 3'-UTR, which binds an RNA-binding protein, is responsible for PE-induced p21(waf1/cip1) mRNA stability.

3' Untranslated Regions↗