SEARCH · Search PubMed

Results for “LACTOSE”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,801 records · Page 100Linked to original sources

PubMed1995

Mutational study at Ser300 position of the Escherichia coli lactose repressor.

We have previously reported that a Ser300Asn mutant of the Escherichia coli lactose repressor protein produced a temperature-sensitive phenotype. In order to analyze the structure-function relationship of the lactose repressor protein, we conducted 18 amino acid substitutions at this Ser 300 site by using in vitro mutagenesis. The substitutions at this position that exhibited repressors with the wild-type phenotype in vivo were Gly, Ala, Ile, Thr, Met and Cys; the other 10 substitutions examined (Leu, Val, Tyr, Trp, Asp, Glu, Gln, His, Lys and Arg) resulted in the lacI- phenotype. In addition, the Ser300Phe mutation resulted in the lacIts phenotype, while the Ser300Pro mutation resulted in lacIts,s. It seems likely that the Ser300 position plays an important role in oligomer formation and inducer binding.

Bacterial Proteins↗

PubMed1996

The mechanism of CAP-lac repressor binding cooperativity at the E. coli lactose promoter.

The cyclic AMP receptor protein (CAP) and lactose repressor bind their regulatory sites in the lactose promoter with moderate cooperativity (omega C101 = 11.8(+/- 3.7)). This cooperativity is significantly reduced by the removal of DNA located upstream of the CAP binding site or by substitution of the dimeric lacI-18 mutant repressor for the wild-type tetrameric protein. These results are consistent with a mechanism of interaction in which CAP bends the DNA and the lac repressor binds simultaneously to its operator site and to promoter-distal sequences. Similar values of omega C101 were obtained with a promoter truncation containing the O3 pseudooperator site and one in which the site is destroyed, suggesting that DNA contacts distal to the O3 site are necessary for cooperative binding.

Binding Sites↗

PubMed1993

What's new with lactose permease.

The lactose permease of Escherichia coli is a paradigm for polytopic membrane transport proteins that transduce free energy stored in an electrochemical ion gradient into work in the form of a concentration gradient. Although the permease consists of 12 hydrophobic transmembrane domains in probable alpha-helical conformation that traverse the membrane in zigzag fashion connected by hydrophilic "loops", little information is available regarding the folded tertiary structure of the molecule. In a recent approach site-directed fluorescence labeling is being used to study proximity relationships in lactose permease. The experiments are based upon site-directed pyrene labeling of combinations of paired Cys replacements in a mutant devoid of Cys residues. Since pyrene exhibits excimer fluorescence if two molecules are within about 3.5A, the proximity between paired labeled residues can be determined. The results demonstrate that putative helices VIII and IX are close to helix X. Taken together with other findings indicating that helix VII is close to helices X and XI, the data lead to a model that describes the packing of helices VII to XI.

Amino Acid Sequence↗

PubMed1995

Systemic infections in three infants due to a lactose-fermenting strain of Salmonella virchow.

Three previously healthy children developed gastroenteritis which led within a few days to systemic infections, two cases of bacteremia and one of meningitis. A lactose-fermenting Salmonella virchow strain was isolated from cerebrospinal fluid and blood cultures. In one case, this strain was also isolated from stool cultures. All the children had been fed the same milk formula. There was no other relationship between them. The batch of dried-milk formula was confirmed as the source of the infection by isolation of an identical lactose-fermenting Salmonella virchow strain by the Centro Nacional de Alimentación.

Anti-Bacterial Agents↗

PubMed2000

Roles of charged residues in the conserved motif, G-X-X-X-D/E-R/K-X-G-[X]-R/K-R/K, of the lactose permease of Escherichia coli.

The lactose permease is a polytopic membrane protein that has a duplicated conserved motif, GXXX(D/E)(R/K)XG[X](R/K)(R/K), located in cytoplasmic loops 2/3 and 8/9. In the current study, the roles of the basic residues and the acidic residue were investigated in greater detail. Neutral substitutions of two positive charges in loop 2/3 were tolerated, while a triple mutant resulted in a complete loss of expression. Neutral substitutions of a basic residue in loop 8/9 (i.e., K289I) also diminished protein stability. By comparison, neutral substitutions affecting the negative charge in loop 2/3 had normal levels of expression, but were defective in transport. A double mutant (D68T/N284D), in which the aspartate of loop 2/3 was moved to loop 8/9, did not have appreciable activity, indicating that the negative charge in the conserved motif could not be placed in loop 8/9 to recover lactose transport activity. An analysis of site-directed mutants in loop 7/8 and loop 8/9 indicated that an alteration in the charge distribution across transmembrane segment 8 was not sufficient to alleviate a defect caused by the loss of a negative charge in loop 2/3. To further explore this phenomenon, the double mutant, D68T/N284D, was used as a parental strain to isolate suppressor mutations which restored function. One mutant was obtained in which an acidic residue in loop 11/12 was changed to a basic residue (i.e., Glu374 --> Lys). Overall, the results of this study suggest that the basic residues in the conserved motif play a role in protein insertion and/or stability, and that the negative charge plays a role in conformational changes.

Amino Acid Sequence↗

PubMed1983

Monoclonal antibody to an integral membrane protein, the lactose permease.

A monoclonal IgG antibody directed against the lactose permease was produced from animals inoculated with membranes of a lac Y plasmid strain. The appropriate antibody was selected by a series of ELISA assays in which membranes, purified permease, or a lac Y-Z chimeric protein was the immobilized antigen. The antibody recognizes a portion of the permease exposed on the surface of membrane vesicles but does not inhibit lactose transport.

Antibodies, Monoclonal↗

PubMed1985

The lactose permease of Escherichia coli: evidence in favor of a dimer.

Lactose permease from Escherichia coli T 206 was purified in octyl-beta-D-glucopyranoside (octyl-glucoside) according to Newman et al. [J. Biol. Chem. (1981) 256, 11804-11808]. In this detergent the protein has a very high tendency to aggregate nonspecifically. Therefore, exchange of octyl-glucoside was performed for another nonionic detergent, dodecyl octaethylene glycol monoether (C12E8), in which the protein is more stable. The amounts of bound C12E8 and phospholipids were measured using radioactive detergent and gas chromatography, respectively, and were found to be respectively 0.2 and 0.15 g/g protein. Analytical ultracentrifugation (sedimentation velocity and sedimentation equilibrium) and gel filtration (conventional and high performance liquid chromatography) experiments indicated that in this detergent the lactose permease existed mainly as a dimer. This result is at variance with the monomeric state of the protein reported by Wright et al. [FEBS Lett. (1983) 162, 11-15] in another nonionic detergent (dodecyl-o-beta-maltoside). We discuss the possible reason for this discrepancy and suggest that the dimeric state of association may well reflect the situation that prevails in the membrane.

Chromatography, Gel↗

PubMed1977

Irreversibel inactivation of the membrane-bound enzyme IIlac of the lactose phosphotransferase system of Staphylococcus aureus by triton X-100 and protection by substrates.

Enzyme IIlac, the membrane-bound component of the lactose phosphotransferase system of Staphylococcus aureus, catalyzes the phosphorylation-transport reaction below: (see article). (The sugar can be lactose or one of its analogs.) The effects of the non-ionic detergents Triton X-100, Brij 35, and Tween 40 on the activity of Enzyme IIlac were studied. Especially striking effects were observed using Triton X-100, a detergent previously used to solubilize and isolate this enzyme. A systematic study of Triton effects over a range of concentrations and temperatures demonstrated three aspects of Triton-membrane interaction. At 0.1% Triton and 25 degrees C Enzyme IIlac is activated, but remains particulate. At 0.5% Triton and 0.5% Triton and 37 degrees C, it is rapidly and irreversibly inactivated. Sugar substrates and inhibitory sugar analogs protect Enzyme IIlac against inactivation; the effect is specific for beta-galactosides. The other substrate of Enzyme IIlac, phospho-Factor IIIlac, does not affect Triton inactivation, and the product analog galactose 6-phosphate slightly enhances the inactivation rate.

Detergents↗

PubMed1988

An improved purification of lactose permease.

The integral membrane protein lactose permease of Escherichia coli was purified to homogeneity in detergent micelles. No other proteins could be detected in the final product. The molar ratio of lactose permease to lipid was less than 0.2 in detergent solution, thus the preparation was essentially lipid-free. All molecules were functionally active as shown by substrate binding.

Cell Membrane↗

PubMed1989

Topological analysis of the amino-terminal region of lactose permease using the Escherichia coli outer membrane protein, OmpA, as a marker.

LacY-ompA fusions, encoding the N-terminal 50, 71 or 143 residues of lactose permease, were constructed. The observed orientation of the OmpA part of each hybrid protein with respect to the plasma membrane supports current models of the N-terminus of Lac permease. Hybrids possessing the entire mature OmpA were very stable; those with only a part thereof were much less stable. Due to their in vivo stability and accessibility to antibody it is proposed that such hybrids may represent potential models to investigate the assembly pathway of lactose permease.

Bacterial Outer Membrane Proteins↗

PubMed1988

Lectin activity and distribution of chicken lactose lectin I in the extracellular matrix of the chick developing kidney.

A lectin activity inhibitable by thiodigalactose, N-acetyllactosamine, lactulose, lactose and by an antibody raised against CLL I (chicken-lactose lectin I) has been investigated in the chick embryo developing kidney. At post-induction stages this activity was found in both mesonephros and metanephros. In immunofluorescence and immunoelectron microscopy, the extracellular distribution of CLL I was similar in the mesonephros and the metanephros. The lectin was never found intracellularly; cultured kidney cells did not express any endogenous lectin but were rich in lectin-receptor sites, which led to the hyphothesis that CLL I is not produced in situ but could be adsorbed on renal cells. Potential physiological roles for embryonic lectins are discussed.

Animals↗

PubMed1993

The effect of a low fat, low lactose diet on nutritional status during pelvic radiotherapy.

The food intake and nutritional status were assessed before, during and after radiotherapy in 143 women with gynaecological malignancies randomized to either a low fat, low lactose diet or a normal diet during treatment. The patients on the low fat, low lactose diet had an intake of fat of 34 g per day during radiotherapy, 41 g per day 6 weeks after radiotherapy and 52 g per day 1 year after radiotherapy, when they were no longer on the diet. The intake in the control group was 57 g per day, 67 g per day and 66 g per day respectively. The total energy intake was reduced in both groups during radiotherapy. The reduced intake of energy resulted in weight loss, greatest in the intervention group. 1 year after radiotherapy both groups had almost regained their initial weight. No marked changes were observed in nutritional status as a result of decreased nutritional intake during radiotherapy.

Journal Article↗

PubMed1992

Isolation of lactose-binding lectins from axolotl (Ambystoma mexicanum).

1. Lactose-inhibitable hemagglutination activity was identified in extracts of axolotl (Ambystoma mexicanum) larvae. 2. Two types of lectin were isolated from extracts by affinity chromatography on lactose-Sepharose. 3. A thiol-independent lectin of subunit mol. wt 15 kDa and a thiol-dependent lectin of subunit mol. wt 18 kDa were identified. 4. The 15 kDa and a 18 kDa polypeptides were weakly reactive with polyclonal anti-human galaptin serum.

Ambystoma↗

PubMed1989

Cloning of chromosomal genes of Lactococcus by heterologous complementation: partial characterisation of a putative lactose transport gene.

A cosmid gene library of the genome of Lactococcus lactis subsp. lactis 712 has been constructed in the broad host range plasmid pLAFR1 in Escherichia coli LE392. Three lactococcal genes from the bank were identified by heterologous complementation of specific mutations in strains of E. coli. A cosmid clone encoding a putative lactose transport gene was identified by complementing an E. coli lacY mutant. The complemented clone supported the uptake of 14C lactose in transport assays. The DNA fragment responsible was subcloned and localised to a 1.28 kb fragment of the lactococcal chromosome.

Biological Transport↗

PubMed1978

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.

Base Sequence↗

PubMedDate not supplied

Cloning and characterization of the natural lactose operator.

A 55-bp DNA segment carrying the wild-type lactose operator sequence has been cloned. Its sequence is: (Formula: see text). With the exceptions of the bases at positions 19 and 41, 26 and 34, and 28 and 32, the sequence is a perfect inverted repeat about base pair 30. This segment was obtained from the wild-type lactose promoter and operator region of lambda h80dlac phage DNA by a combination of in vitro and in vivo steps. Up to four direct-repeat copies of this segment have been cloned in plasmid pMB9 and pBR325. Repressor affinity for this 55-bp fragment does not differ significantly from that for a 40-bp synthetic operator fragment cloned previously, even though the 55-bp fragment contains the complete set of sequence symmetries associated with the natural operator, whereas the 40-bp fragment does not. An improved procedure for operator purification is described: this was used to prepare 14 mg of the 55-bp fragment over a 2-month period.

Bacteriophage lambda↗

PubMed2005

Effects of lactose permease of Escherichia coli on the anisotropy and electrostatic surface potential of liposomes.

The membrane transport protein lactose permease (LacY), a member of the Major Facilitator Superfamily (MFS) containing twelve membrane-spanning segments connected by hydrophilic loops, was reconstituted in liposomes of: (i) 1,2-dimyristoyl-sn-glycero-3-phosphocoline (DMPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) in equimolar proportions; and (ii) Escherichia coli total lipid extract. The structural order of the lipid membranes, in the presence and absence of LacY, was investigated using steady-state fluorescence anisotropy. The features of the anisotropy curves obtained with 1,6-phenyl-1,3,5-hexatriene (DPH) and 1-(4-trimethylammoniumphenyl)-6-phenyl-1,3,5-hexatriene p-toluene sulfonate (TMA-DPH) evidenced: (i) the insertion of LacY into the bilayer; and (ii) a surface effect on the membranes. The most dramatic effects were observed when LacY was reconstituted in the E. coli lipid matrix. The effect of the protein on the electrostatic surface potential of each bilayer was also examined using a fluorescent pH indicator, 4-Heptadecyl-7-hydroxycoumarin (HHC). Changes in surface potential were enhanced in the presence of the substrate (i.e. lactose) only when the lipid matrices were charged. These results suggest a role for charged phospholipids (i.e. phosphatidylethanolamine or phosphatidylglycerol) in proton transfer to the amino acids involved in substrate translocation.

Anisotropy↗

PubMed2006

NIR analysis of cellulose and lactose--application to ecstasy tablet analysis.

Cellulose and lactose are the most frequently used excipients in illicit ecstasy production. The aim of this project was to use near infrared reflectance spectroscopy (NIRS) for the determination of the different chemical forms of these two substances, as well as for the differentiation of their origin (producer). It was possible to distinguish between the different chemical forms of both compounds, as well as between their origins (producers), although within limits. Furthermore, the possibilities to apply NIR for the analysis of substances such as found in illicit tablets were studied. First, a few cellulose and lactose samples were chosen to make mixtures with amphetamine at three degrees of purity (5, 10 and 15%), in order to study the resulting changes in the spectra as well as to simultaneously quantify amphetamine and identify the excipient. A PLS2 model could be build to predict concentrations and excipient. Secondarily, the technique was to be applied to real ecstasy tablets. About 40 ecstasy seizures were analysed with the aim to determine the excipient and to check them against each other. Identification of the excipients was not always obvious, especially when more than one excipient were present. However, a comparison between tablets appeared to give groups of similar samples. NIR analysis results in spectra representing the tablet blend as a whole taking into account all absorbing compounds. Although NIRS seems to be an appropriate method for ecstasy profiling, little is known about intra- and intervariability of compression batches.

Journal Article↗

Refine your search to explore more results.