Search PubMed⌕ Search

SEARCH · Search PubMed

Results for “quadruplex”

Search indexed PubMed citations on genomics, clinical trials, systematic reviews and public health. Explore titles, authors and supplied subject terms, then open the PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 181 records · Page 10Linked to original sources
PubMed2005

Ascididemin and meridine stabilise G-quadruplexes and inhibit telomerase in vitro.

Ascididemin and Meridine are two marine compounds with pyridoacridine skeletons known to exhibit interesting antitumour activities. These molecules have been reported to behave like DNA intercalators. In this study, dialysis competition assay and mass spectrometry experiments were used to determine the affinity of ascididemin and meridine for DNA structures among duplexes, triplexes, quadruplexes and single-strands. Our data confirm that ascididemin and meridine interact with DNA but also recognize triplex and quadruplex structures. These molecules exhibit a significant preference for quadruplexes over duplexes or single-strands. Meridine is a stronger quadruplex ligand and therefore a stronger telomerase inhibitor than ascididemin (IC50=11 and >80 muM, respectively in a standard TRAP assay).

Alkaloids↗
PubMed2004

Structural study of four-stranded quadruplex structures containing 2'-deoxy-8-(propyn-1-yl)adenosine.

In this paper, we report the NMR structural study of two quadruplex structures formed by truncations of the human telomeric sequence and containing a modified base, namely d(AprGGGT) and d(TAprGGGT), where Apr indicates 2'-deoxy-8-(propyn-1-yl)adenosines. Both oligonucleotides have been found to form 4-fold symmetric G-quadruplex structures with all strands parallel and equivalent to each other and characterized by higher thermal stabilities than the natural counterparts. The presence of the propynyl groups affects the conformations of the 5' edge of both quadruplexes in such a way to prevent the formation of one of the two possible H-bond patterns observed for a canonical A-tetrad. The increased thermal stabilities of the modified quadruplexes seem to be mostly due to a prevalent syn glycosidic conformation assumed by the Apr residues.

Base Sequence↗
PubMed2006

Specific interactions with intra- and intermolecular G-quadruplex DNA structures by hydrosoluble coronene derivatives: a new class of telomerase inhibitors.

In developing G-quadruplex interactive telomerase inhibitors two main features have to be taken into account: the hydrophobic interactions with the G-quartet plane and the electrostatic interactions with the negatively charged phosphates of the four grooves. In this paper, we report the synthesis of four hydrosoluble coronene derivatives, which are characterized by a large hydrophobic aromatic core and four orthogonal hydrophilic side chains. We have studied their ability to induce both inter- and intramolecular G-quadruplex structures and found a significant selectivity of all the coronene derivatives for the intramolecular G-quadruplex. The efficiency in inhibiting human telomerase has been evaluated in a cell-free system and the experimental results correlate with the relative affinities of these compounds for the G-quadruplex monomeric structure, as derived by molecular modelling simulations. Thus, the coronene derivatives can be considered as a new class of telomerase inhibitors, although further investigations are surely necessary to fully exploit their features.

Cell-Free System↗
PubMed2006

Structure-specific recognition of quadruplex DNA by organic cations: influence of shape, substituents and charge.

Combining structure-specific recognition of nucleic acids with limited sequence reading is a promising method to reduce the size of the recognition unit required to achieve the necessary selectivity and binding affinity to control function. It has been demonstrated recently that G-quadruplex DNA structures can be targeted by organic cations in a structure-specific manner. Structural targets of quadruplexes include the planar end surfaces of the G-tetrad stacked columns and four grooves. These provide different geometries and functional groups relative to duplex DNA. We have used surface plasmon resonance and isothermal titration calorimetry to show that binding affinity and selectivity of a series of quadruplex end-stacking molecules to human telomeric DNA are sensitive to compound shape as well as substituent type and position. ITC results indicate that binding is largely enthalpy driven. Circular dichroism was also used to identify a group of structurally related compounds that selectively target quadruplex grooves.

Calorimetry↗
PubMed2003

Structure of a G-quadruplex-ligand complex.

Stabilisation of G-quadruplex structures formed from telomeric DNA, by means of quadruplex-selective ligands, is a means of inhibiting the telomerase enzyme from catalysing the synthesis of telomeric DNA repeats. In order to understand the molecular basis of ligand-quadruplex recognition, the crystal structure has been determined of such a complex, at 1.75A resolution. This complex is between a dimeric antiparallel G-quadruplex formed from the Oxytricha nova telomeric DNA sequence d(GGGGTTTTGGGG), and a di-substituted aminoalkylamido acridine compound. The structure shows that the acridine moiety is bound at one end of the stack of G-quartets, within one of the thymine loops. It is held in place by a combination of stacking interactions and specific hydrogen bonds with thymine bases. The stability of the ligand in this binding site has been confirmed by a 2ns molecular dynamics simulation.

Acridines↗
PubMed2006

Verification of antiparallel G-quadruplex structure in human telomeres by using two-photon excitation fluorescence lifetime imaging microscopy of the 3,6-Bis(1-methyl-4-vinylpyridinium)carbazole diiodide molecule.

Different G-quadruplex structures for the human telomeric sequence d(T2AG3)4 in vitro have been documented in the presence of sodium and potassium. Verification of the G-quadruplex structures in human telomeres in vivo is the main issue in establishing the biological function of the G-quadruplex structures in telomeres as well as the development of anticancer agents. Here we have applied two-photon excitation fluorescence lifetime imaging microscopy to measure the fluorescence lifetime of the BMVC molecule upon interaction with various DNA structures. The distinction in lifetime measured with submicrometer spatial resolution in two-photon excitation fluorescence lifetime imaging microscopy provides a powerful approach not only to verify the existence of the antiparallel G-quadruplex structure in human telomeres but also to map its localizations in metaphase chromosomes.

Carbazoles↗
PubMed2000

Structural characterization of a guanine-quadruplex ligand complex.

The inhibition of telomerase by molecules such as disubstituted amidoanthraquinones is believed to be due to their stabilization of guanine-quadruplex complexes. The characterization is reported of a complex with the intermolecular parallel quadruplex formed from the sequence TGGGGT and a 1,4-bis-piperidino amidoanthraquinone. Crystals obtained did not give single-crystal diffraction; the fiber-like pattern has been interpreted in terms of a repeating unit with four guanine-quartets and two stacked/intercalated ligand molecules. The two categories of possible structures for the complex consistent with this interpretation have been examined by molecular dynamics simulations, with fully solvated environments and 1000 ps simulation times. The two central guanine-quartets in the intercalation model rapidly became highly distorted, whereas the two types of models with ligand stacked externally on the ends of the quadruplex remained very stable. It was concluded that the externally bound ligand complexes best represent the structure of this quadruplex complex, in agreement with earlier NMR results on related systems.

Anthraquinones↗
PubMed2001

Selection of zinc fingers that bind single-stranded telomeric DNA in the G-quadruplex conformation.

There is considerable interest in molecules that bind to telomeric DNA sequences and G-quadruplexes with specificity. Such molecules would be useful to test hypotheses for telomere length regulation, and may have therapeutic potential. The versatility and modular nature of the zinc finger motif makes it an ideal candidate for engineering G-quadruplex-binding proteins. Phage display technology has previously been widely used to screen libraries of zinc fingers for binding to novel duplex DNA sequences. In this study, a three-finger library has been screened for clones that bind to an oligonucleotide containing the human telomeric repeat sequence folded in the G-quadruplex conformation. The selected clones show a strong amino acid consensus, suggesting analogous modes of binding. Binding was found to be both sequence dependent and structure specific. This is the first example of an engineered protein that binds to G-quadruplex DNA, and represents a new type of binding interaction for a zinc finger protein.

Amino Acid Sequence↗
PubMed1999

Determinants of DNA quadruplex structural type: sequence and potassium binding.

There are DNA sequences which adopt the same quadruplex structural type in the presence of sodium as in the presence of sodium and potassium. There are also sequences that appear to have a requirement for the presence of potassium for the adoption of a particular quadruplex structural type. Information about the basis for these potassium effects has been obtained by examining the structures of a set of DNAs with differing numbers of loop residues and different lengths of runs of dG residues in the presence of sodium alone and in the presence of potassium and sodium. On the basis of the results, obtained primarily via solution-state NMR, it appears that very small loops favor parallel stranded quartet structures which do not require the presence of potassium. DNAs with loops of two to four residues and runs of two dG residues can form quadruplex structures of the "edge" or "chair" type in the presence of potassium but not in the presence of sodium alone. When all of the loops contain four residues, a "crossover" or "basket" type structure can be formed in the presence of sodium as well as in the presence of sodium and potassium. Structures with runs of three or four dG residues and with loops from two to four residues can form basket or crossover type structures in the absence of potassium. The presence of a purine in a loop can block both potassium binding and formation of chair type structures. Modeling of the interactions of cations with these quadruplex structures indicates that the potassium ions required for chair type structures interact with a terminal quartet and residues in the adjacent loop.

Base Sequence↗
PubMed2003

Small change in a G-rich sequence, a dramatic change in topology: new dimeric G-quadruplex folding motif with unique loop orientations.

NMR study has shown that DNA oligonucleotide d(G(3)T(4)G(4)) adopts an asymmetric bimolecular G-quadruplex structure in solution. The structure of d(G(3)T(4)G(4))(2) is composed of three G-quartets, overhanging G11 residue and G3, which is part of the loop. Unique structural feature of d(G(3)T(4)G(4))(2) fold is the orientation of the two loops. Thymidine residues T4-T7 form a diagonal loop, whereas T15-T18 form an edge type loop. The G-quadruplex core of d(G(3)T(4)G(4))(2) consists of two stacked G-quartets with syn-anti-anti-anti alternation of dG residues and one G-quartet with syn-syn-anti-anti alternation. Another unusual structural feature of d(G(3)T(4)G(4))(2) is a leap between G19 and G20 over the middle G-quartet and chain reversal between G19 and G20 residues. The presence of one antiparallel and three parallel strands reveals the hitherto unknown G-quadruplex folding motif consisting of antiparallel/parallel strands and diagonal as well as edge type loops. Further examination of the influence of different monovalent cations on the folding of d(G(3)T(4)G(4)) showed that it forms a bimolecular G-quadruplex in the presence of K+, Na+, and NH4+ ions with the same general fold.

DNA↗
PubMed2005

Putative DNA quadruplex formation within the human c-kit oncogene.

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

Base Sequence↗
PubMed2005

Fluorescent amplifying recognition for DNA G-quadruplex folding with a cationic conjugated polymer: a platform for homogeneous potassium detection.

Single-stranded DNA with G-rich sequences can fold into secondary structures, G-quadruplexes, via intramolecular hydrogen-bonding interactions. This conformational change can be detected by a homogeneous assay method based on fluorescence resonance energy transfer (FRET) from a water-soluble cationic conjugated polymer (CCP) to a fluorescein chromophore labeled at the terminus of the G-quadruplex DNA. The space charge density around the DNA controls the efficiency of FRET from the CCP to the fluorescein. The higher FRET efficiency for the CCP/G-quadruplex pair is correlated to the stronger electrostatic interactions between the more condensed G-quadruplex and the CCP in comparison to the CCP/ssDNA pair. Since the potassium ion can specifically bind to the G-quadruplex DNA, the G-quartet-DNA/CCPs assembly can also be used as a platform to sense the potassium ion in water with high selectivity and sensitivity.

Biosensing Techniques↗
PubMed2005

Characterization of the cation and temperature dependence of DNA quadruplex hydrogen bond properties using high-resolution NMR.

Variations in the hydrogen bond network of the Oxy-1.5 DNA guanine quadruplex have been monitored by trans-H-bond scalar couplings, (h2)J(N2N7), for Na(+)-, K(+)-, and NH(4)(+)-bound forms over a temperature range from 5 to 55 degrees C. The variations in (h2)J(N2N7) couplings exhibit an overall trend of Na(+) > K(+) > NH(4)(+) and correlate with the different cation positions and N2-H2...N7 H-bond lengths in the respective structures. A global weakening of the (h2)J(N2N7) couplings with increasing temperature for the three DNA quadruplex species is accompanied by a global increase of the acceptor (15)N7 chemical shifts. Above 35 degrees C, spectral heterogeneity indicates thermal denaturation for the Na(+)-bound form, whereas spectral homogeneity persists up to 55 degrees C for the K(+)- and NH(4)(+)-coordinated forms. The average relative change of the (h2)J(N2N7) couplings amounts to approximately 0.8 x 10(-3)/K and is thus considerably smaller than respective values reported for nucleic acid duplexes. The significantly higher thermal stability of H-bond geometries in the DNA quadruplexes can be rationalized by their cation coordination of the G-quartets and the extensive H-bond network between the four strands. A detailed analysis of individual (h2)J(N2N7) couplings reveals that the 5' strand end, comprising base pairs G1-G9* and G4*-G1, is the most thermolabile region of the DNA quadruplex in all three cation-bound forms.

Cations↗
PubMed2005

(3 + 1) Assembly of three human telomeric repeats into an asymmetric dimeric G-quadruplex.

We present an NMR study on the structure of a DNA fragment of the human telomere containing three guanine-tracts, d(GGGTTAGGGTTAGGGT). This sequence forms in Na(+) solution a unique asymmetric dimeric quadruplex, in which the G-tetrad core involves all three G-tracts of one strand and only the last 3'-end G-tract of the other strand. We show that a three-repeat human telomeric sequence can also associate with a single-repeat human telomeric sequence into a structure with the same topology that we name (3 + 1) quadruplex assembly. In this G-quadruplex assembly, there are one syn.syn.syn.anti and two anti.anti.anti.syn G-tetrads, two edgewise loops, three G-tracts oriented in one direction and the fourth oriented in the opposite direction. We discuss the possible implications of the new folding topology for understanding the structure of telomeric DNA, including t-loop formation, and for targeting G-quadruplexes in the telomeres.

Base Sequence↗
PubMed2006

Insulin capture by an insulin-linked polymorphic region G-quadruplex DNA oligonucleotide.

Insulin capture by a G-quadruplex DNA oligonucleotide containing a two-repeat sequence of the insulin-linked polymorphic region (ILPR) of the human insulin gene promoter region is reported. The immobilized oligonucleotide was demonstrated to capture human insulin from standard solutions and from nuclear extracts of pancreatic cells with high selectivity, using affinity MALDI mass spectrometry and affinity capillary chromatography. Insulin was preferentially captured by the two-repeat ILPR oligonucleotide over another G-quadruplex-forming oligonucleotide, the thrombin-binding aptamer, as well as over a single repeat of the ILPR sequence that is not capable of forming the G-quadruplex architecture. Binding was shown to involve the beta chain of insulin. The discovery raises the possibility that insulin may bind to G-quadruplex DNA formed in the ILPR in vivo and thereby play a role in modulation of insulin gene expression, and it provides a basis for design of insulin analogues to probe this hypothesis. The availability of a DNA ligand to human insulin has analytical importance as well, offering an alternative to antibodies for in vitro or in vivo detection and sensing of insulin as well as its isolation and purification from biological samples.

Aptamers, Nucleotide↗
PubMed2006

Cyclo[n]pyrroles: size and site-specific binding to G-quadruplexes.

Inhibiting the enzyme telomerase by stabilizing the G-quadruplex has potential in anticancer drug design. Diprotonated cyclo[n]pyrroles represent a set of expanded porphyrin analogues with structures similar to that of telomestatin, a natural product known to bind to and stabilize G-quadruplexes. As a first step toward testing whether cyclo[n]pyrroles display a similar function, a series of diprotonated cyclo[n]pyrroles (where n = 6, 7, and 8) was each added to the human telomere repeat sequence d(T(2)AG(3))(4) and examined with mass spectrometry, ion mobility, and molecular dynamics calculations. Nano-ESI-MS indicated that the smaller the cyclo[n]pyrrole, the more strongly it binds to the telomeric sequence. It was also found that cyclo[6]pyrrole bound to d(T(2)AG(3))(4) better than octaethylporphyrin, a finding rationalized by cyclo[6]pyrrole having a 2+ charge, while octaethylporphyrin bears no charge. Ion mobility measurements were used to measure the collision cross section of each d(T(2)AG(3))(4)/cyclo[n]pyrrole complex. Only one peak was observed in the arrival time distributions for all complexes, and the experimental cross sections indicated that only structures with d(T(2)AG(3))(4) in an antiparallel G-quadruplex arrangement and each cyclo[n]pyrrole externally stacked below the G-quartets occur under these experimental conditions. When the cyclo[n]pyrroles were intercalated or nonspecifically bound to the quadruplex, or if conformations different than antiparallel were considered for d(T(2)AG(3))(4), the theoretical cross sections did not match experiment. On this basis, it is inferred that (1) external stacking represents the dominant binding mode for the interaction of cyclo[n]pyrroles with d(T(2)AG(3))(4) and (2) the overall size and charge of the cyclo[n]pyrroles play important roles in defining the binding strength.

Binding Sites↗
PubMed2006

Hydration regulates thermodynamics of G-quadruplex formation under molecular crowding conditions.

The effect of molecular crowding on the structure and stability of biomolecules has become a subject of increasing interest because it can clarify how biomolecules behave under cell-mimicking conditions. Here, we quantitatively analyzed the effects of molecular crowding on the thermodynamics of antiparallel G-quadruplex formation via Hoogsteen base pairs and of antiparallel hairpin-looped duplex (HP duplex) formation via Watson-Crick base pairs. The free energy change at 25 degrees C for G-quadruplex formation decreased from -3.5 to -5.5 kcal mol(-1) when the concentration of poly(ethylene glycol) 200 was increased from 0 to 40 wt %, whereas that of duplex formation increased from -9.8 to -6.9 kcal mol(-1). These results showed that the antiparallel G-quadruplex is stabilized under molecular crowding conditions, but that the HP duplex is destabilized. Moreover, plots of stability (ln K(obs)) of the DNA structures versus water activity (ln a(w)) demonstrated that the ln K(obs) for G-quadruplex formation decreased linearly as the ln a(w) increased, whereas that for duplex formation increased linearly with the increase in ln a(w), suggesting that the slope approximately equals the number of water molecules released or taken up during the formation of these structures. Thus, molecular crowding affects the thermodynamics of DNA structure formation by altering the hydration of the DNA. The stabilization of the DNA structures with Hoogsteen base pairs and destabilization of DNA structures with Watson-Crick base pairs under molecular crowding conditions lead to structural polymorphism of DNA sequences regulated by the state of hydration.

Base Pairing↗
PubMed2006

FRET templated by G-quadruplex DNA: a specific ternary interaction using an original pair of donor/acceptor partners.

G-quadruplex represents a suitable scaffold for FRET (fluorescence resonance energy transfer) since its two external quartets offer two well-defined binding sites for concomitant trapping of donor/acceptor partners. Combining selective G-quadruplex binders (macrocyclic bis(quinacridine) BOQ(1) or monomeric quinacridine MMQ(1), donor) with a highly fluorescent DNA probe (thiazole orange, acceptor), we designed a structure-specific FRET-system based on an unprecedented noncovalent ternary complex. This system could be potentially usable as a signature for quadruplex-DNA conformation in solution, but also might offer a unique means for observing cation and ligand binding influence on quadruplex topology.

Acridines↗